A flavone glycoside compound, a preparation method and application thereof, and a pharmaceutical composition for preventing and / or treating muscle dysfunction

Abstract

The present application relates to the technical field of biological medicine, in particular to a flavone glycoside compound, a preparation method and application thereof, and a pharmaceutical composition for preventing and / or treating muscle dysfunction. The flavone glycoside compound adopted in the present application can target to inhibit the PGAM5 protein phosphatase activity, reduce the polymerization of the PGAM5 protein, and the target is clear. Meanwhile, the flavone glycoside compound has a short metabolic cycle, less accumulation in the body, and no obvious side effects. The flavone glycoside compound provided in the present application shows good muscle protection effect in the treatment of muscle diseases, can effectively treat muscle atrophy caused by disuse atrophy, cachexia, etc., Duchenne muscular dystrophy and other muscle dysfunction, delay the reduction of muscle mass, enhance the strength and function of muscles, and improve the muscle movement ability, thereby providing a new technical path for treating muscle atrophy and dysfunction, and having a good application prospect in the clinic.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a flavonoid glycoside compound, its preparation method and application, and a pharmaceutical composition for the prevention and / or treatment of muscle dysfunction. Background Technology

[0002] Muscle atrophy or sarcopenia caused by prolonged bed rest (such as due to paralysis), aging, cachexia syndrome associated with chronic diseases (such as cancer and kidney failure), and hereditary diseases such as muscular dystrophy severely affect patients' motor ability and self-care ability, damage their physical and mental health, and currently there is a lack of effective treatment methods.

[0003] Muscle tissue is rich in mitochondria. As the cell's "energy factories," mitochondria play a crucial role in maintaining normal skeletal muscle function through their mediated energy metabolism, signal transduction, and ion homeostasis. Studies have shown that promoting mitochondrial biogenesis is an important guarantee for maintaining skeletal muscle development and normal function.

[0004] Currently, the main methods for improving muscle dysfunction include targeted drugs, gene therapy, hormone therapy, and exercise rehabilitation. However, these methods suffer from significant side effects, operational difficulties, or low success rates, making them challenging to achieve effective clinical treatment. Therefore, the development of drugs for treating sarcopenia and other muscle dysfunctions is of great importance. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide a flavonoid glycoside compound, its preparation method, and its application, as well as a pharmaceutical composition for the prevention and / or treatment of muscle dysfunction. The flavonoid glycoside compound provided by this invention can effectively treat muscle dysfunctions such as sarcopenia and Duchenne muscular dystrophy, and improve muscle function.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the use of flavonoid glycosides and / or their derivatives in the preparation of medicaments for the prevention and / or treatment of muscle dysfunction, wherein the flavonoid glycosides have the structure shown in Formula I or Formula II: ; Among them, R1~R6 include hydrogen, hydroxyl or alkoxy; R7~R9 include hydroxyl or acyloxy; R 10 Including hydroxymethyl, carboxyl, or acyloxyalkyl groups; R 11 Includes hydrogen or hydroxyl groups; wavy lines indicate R or S configurations.

[0007] Preferably, the muscle dysfunction includes muscle dysfunction caused by at least one of sarcopenia and Duchenne muscular dystrophy.

[0008] Preferably, the sarcopenia includes sarcopenia caused by at least one of disuse atrophy and cachexia.

[0009] Preferably, the cachexia includes cachexia caused by colon cancer.

[0010] Preferably, the derivative comprises at least one of a pharmaceutically acceptable salt, a prodrug, a hydrate, and a solvate.

[0011] The present invention also provides a flavonoid alloside compound having the structure shown in Formula III: Formula III.

[0012] This invention also provides a method for preparing the flavonoid alloside compound described in the above technical solution, comprising the following steps: Compound 1 and compound 2 were subjected to a glycosylation reaction to obtain compound 3; Compound 3 was subjected to a deacetylation reaction to obtain compound 4; The compound 4 was subjected to a catalytic hydrogenolysis reaction to obtain the flavonoid alloside compound; ; In compound 2, X includes hydroxyl, halogen, alkoxy, acyloxy, mercapto, thioether, sulfoxide, sulfone, or trichloroacetylimine ester group, and the wavy line indicates the R configuration or S configuration.

[0013] The present invention also provides derivatives of the flavonoid alloglycoside compounds described in the above technical solutions, characterized in that the derivatives include at least one of pharmaceutically acceptable salts, prodrugs, hydrates, and solvates.

[0014] The present invention also provides a pharmaceutical composition for the prevention and / or treatment of muscle dysfunction, characterized in that it comprises an active ingredient and pharmaceutically acceptable excipients, said active ingredient comprising at least one of flavonoid glycosides and their derivatives; said flavonoid glycosides having the structure shown in Formula I and / or Formula II: ; Among them, R1~R6 include hydrogen, hydroxyl or alkoxy; R7~R9 include hydroxyl or acyloxy; R 10 Including hydroxymethyl, carboxyl, or acyloxyalkyl groups; R 11 Includes hydrogen or hydroxyl groups; wavy lines indicate R or S configurations.

[0015] Preferably, the active component includes at least one of the flavonoid alloside compounds described in the above-described technical solutions and derivatives of the flavonoid alloside compounds described in the above-described technical solutions.

[0016] PGAM5 polymerization promotes its phosphatase activity. The flavonoid glycosides provided by this invention can target the mitochondrial protein phosphatase PGAM5, interfering with PGAM5 protein polymer formation, inhibiting PGAM5 protein phosphatase activity, promoting mitochondrial biogenesis, and improving mitochondrial quality. The flavonoid glycosides provided by this invention have a clear target for PGAM5, and also exhibit a short metabolic cycle, low in vivo accumulation, and no significant side effects. By inhibiting PGAM5 protein phosphatase activity, the flavonoid glycosides provided by this invention can effectively improve muscle dysfunction caused by disuse atrophy, cachexia, and Duchenne muscular dystrophy (DMD), delaying muscle mass loss, enhancing muscle strength and function, and improving muscle movement ability. Furthermore, the flavonoid glycosides and their derivatives have few side effects, are simple to operate, and have a high success rate, providing a new technical approach for the treatment of muscle dysfunction and showing promising clinical application prospects.

[0017] This invention, through experiments using a hindlimb fixation-induced disuse muscle atrophy model, a cachexia-induced muscle atrophy model, and a Duchenne muscular dystrophy model, showed that: The flavonoid glycosides provided by this invention exhibit good muscle protection in the fight against muscle dysfunction. They can directly bind to the PGAM5 protein and inhibit its phosphatase activity by inhibiting the formation of PGAM5 protein polymers. Furthermore, they reduce the activity of PGAM5 phosphatase in a concentration-dependent manner, thereby achieving the purpose of preventing and treating muscle-related diseases.

[0018] The flavonoid glycoside compounds provided by this invention can effectively inhibit the activity of PGAM5 protein phosphatase and activate the mitochondrial biogenesis signaling pathway, increasing mitochondrial content, which is beneficial for the prevention and treatment of muscle-related diseases.

[0019] The flavonoid glycoside compounds provided by this invention can improve disuse muscle atrophy caused by reduced activity, restore muscle fiber area to normal size and shape, increase muscle weight, and improve exercise capacity.

[0020] In the cachexia-induced muscle atrophy model experiment, the flavonoid glycoside compounds provided by this invention can effectively restore muscle fiber area and enhance muscle quality, thereby improving the quality of life of mice in the cachexia model.

[0021] The flavonoid glycosides provided by this invention can effectively restore muscle fiber area and enhance muscle quality, thereby improving muscle function and enhancing motor ability in Duchenne muscular dystrophy (DMD) mice.

[0022] This invention also provides a method for preparing flavonoid alloside compounds. Using compounds 1 and 2 as raw materials, selective glycosylation of luteolin can be achieved. The flavonoid alloside compounds are obtained through a two-step efficient deprotection process involving deacetylation and catalytic hydrogenolysis. The preparation method provided by this invention is simple in route and operation, produces stable intermediates, exhibits high product selectivity and high overall yield, and has low production cost, making it suitable for industrial production. Attached Figure Description

[0023] Figure 1 This is a molecular docking diagram of the flavonoid glycoside compound S1395 and PGAM5 in Example 2; Figure 2 The image shows the results of the immunoblotting test of compounds S1395, 1395, apigenin-7-O-β-D-glucoside, luteolin, and 7-methoxycoumarin in Example 4. Figure 3 This is a diagram showing the staining results of different compounds in the cachexia (MC38 tumor) induced muscle atrophy model in Example 6. Figure 4 This is a diagram showing the staining results after the action of flavonoid glycosides in the cachexia (MC38 tumor) induced muscle atrophy model in Example 7; Figure 5 This is a staining result of the hindlimb fixation-induced disuse muscle atrophy model in Example 8 after treatment with flavonoid glycoside compounds. Figure 6 This is a staining result of the Duchenne muscular dystrophy (DMD) mouse model (Mdx) in Example 9 after treatment with flavonoid glycoside compounds. Detailed Implementation

[0024] This invention provides the use of flavonoid glycosides and / or their derivatives in the preparation of medicaments for the prevention and / or treatment of muscle dysfunction, wherein the flavonoid glycosides have the structure shown in Formula I or Formula II: ; Among them, R1~R6 include hydrogen, hydroxyl or alkoxy; R7~R9 include hydroxyl or acyloxy; R 10 Including hydroxymethyl, carboxyl, or acyloxyalkyl groups; R 11 Includes hydrogen or hydroxyl groups; wavy lines indicate R or S configurations.

[0025] In this invention, the alkoxy group may include C1-C10 alkoxy groups or C1-C6 alkoxy groups; the acyloxy group may include C1-C10 acyloxy groups or C1-C6 acyloxy groups; the acyloxyalkyl group may include C1-C10 acyloxyalkyl groups or C1-C6 acyloxyalkyl groups. In this invention, the number of carbon atoms in the C1-C10 alkoxy group, C1-C10 acyloxy group, and C1-C10 acyloxyalkyl group can independently be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In this invention, the alkoxy group may specifically be a methoxy group; the acyloxy group may specifically be an acetoxy group; and the acyloxymethyl group may specifically be an acetoxymethyl group (-CH2-OAc).

[0026] In this invention, the muscle dysfunction may include muscle dysfunction caused by at least one of sarcopenia and Duchenne muscular dystrophy. In this invention, the sarcopenia may include sarcopenia caused by disuse atrophy and / or cachexia; the cachexia may include cachexia caused by colon cancer. In this invention, the disuse atrophy may include muscle atrophy caused by limb immobilization.

[0027] In this invention, the derivative may include at least one of a pharmaceutically acceptable salt, a prodrug, a hydrate, and a solvate. In this invention, the pharmaceutically acceptable salt may include one or more of a sodium salt, potassium salt, calcium salt, ammonium salt, organic amine salt, and magnesium salt. In this invention, the solvate may include an ethanolide.

[0028] PGAM5 polymerization promotes its phosphatase activity. The flavonoid glycosides and their derivatives used in this invention can target the mitochondrial protein phosphatase PGAM5, interfering with the formation of PGAM5 protein polymers, inhibiting PGAM5 protein phosphatase activity, promoting mitochondrial biogenesis, and improving mitochondrial quality. The flavonoid glycosides provided by this invention have a clear target for PGAM5, and also have a short metabolic cycle, low in vivo accumulation, and no obvious side effects. The flavonoid glycosides used in this invention, by inhibiting PGAM5 protein phosphatase activity, can effectively improve muscle dysfunction such as sarcopenia and Duchenne muscular dystrophy (DMD) caused by disuse atrophy and cachexia, delay muscle mass loss, enhance muscle strength and function, and improve muscle movement ability. Furthermore, the flavonoid glycosides and their derivatives are simple to operate and have a high success rate, providing a new technical approach for the treatment of muscle dysfunction and showing good application prospects in clinical practice.

[0029] The present invention also provides a flavonoid alloside compound having the structure shown in Formula III.

[0030] Formula III.

[0031] This invention also provides a method for preparing the flavonoid alloside compound described in the above technical solution, comprising the following steps: Compound 1 and compound 2 were subjected to a glycosylation reaction to obtain compound 3; Compound 3 was subjected to a deacetylation reaction to obtain compound 4; The compound 4 was subjected to a catalytic hydrogenolysis reaction to obtain the flavonoid alloside compound; ; In the structural formula of compound 2, X includes hydroxyl, halogen, alkoxy, acyloxy, mercapto, thioether, sulfoxide, sulfone, or trichloroacetylimine ester group, and the wavy line indicates the R configuration or S configuration.

[0032] Unless otherwise specified, the materials and equipment used in this invention are all commercially available products in the field.

[0033] In this invention, compound 1 and compound 2 are subjected to a glycosylation reaction to obtain compound 3.

[0034] In this invention, the halogen may include fluorine, chlorine, bromine, or iodine, specifically bromine; the alkoxy group may be a C1-C10 alkoxy group or a C1-C6 alkoxy group, and the number of carbon atoms in the C1-C10 alkoxy group may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; the acyloxy group may include an acetoxy group (-OAc). In this invention, the thioether group may include a methyl sulfide group, an ethyl sulfide group, a phenyl sulfide group, or a p-phenylmethyl sulfide group.

[0035] In this invention, the glycosylation reaction can be carried out under the conditions of a phase transfer catalyst, an alkaline reagent, and a first organic solvent. Specifically, compound 1, compound 2, the phase transfer catalyst, the alkaline reagent, and the first organic solvent are mixed to carry out the glycosylation reaction.

[0036] In this invention, the molar ratio of compound 1 to compound 2 can be 1:0.5~3, or 1:1~2.5, or even 1:1.5~2.

[0037] In this invention, the phase transfer catalyst may include a quaternary ammonium salt phase transfer catalyst, specifically including tetrabutylammonium bromide (TBAB) and / or tetrabutylammonium chloride (TBAC). In this invention, the molar ratio of compound 1 to the phase transfer catalyst may be 1:0.1~1, or 1:0.3~0.8, or even 1:0.5~0.6.

[0038] In this invention, the alkaline reagent may include carbonates, which may include alkali metal carbonates, specifically sodium carbonate and / or potassium carbonate. In this invention, the molar ratio of compound 1 to the alkaline reagent may be 1:0.5~3, or 1:1~2.5, or even 1:1.5~2. In this invention, the alkaline reagent may be used in the form of an aqueous solution, and the concentration of the aqueous solution may be 0.01~1 mol / L, or 0.1~0.5 mol / L, or even 0.2~0.4 mol / L.

[0039] In this invention, the first organic solvent may include a halocarbon solvent, specifically chloroform and / or dichloromethane (DCM). In this invention, the molar ratio of compound 1 to the volume of the first organic solvent may be 1 mol: 1~100 L, or 1 mol: 10~50 L, or even 1 mol: 15~20 L.

[0040] In this invention, the temperature of the glycosylation reaction can be 40~50℃, or 42~48℃, or even 44~46℃; the time of the glycosylation reaction can be 1~10h, or 2~8h, or even 3~5h.

[0041] After completing the glycosylation reaction, the present invention may further include: extracting the reaction solution obtained from the glycosylation reaction, concentrating the obtained organic phase, and purifying it by silica gel column chromatography to obtain compound 3. In the present invention, the organic extractant used for extraction may include dichloromethane and / or chloroform; the number of extractions may be 1 to 5 times, or 2 to 4 times, specifically 3 times. The present invention does not have a special limitation on the concentration, as long as a concentration method well known to those skilled in the art is used to remove the solvent. In the present invention, the eluent used for silica gel column chromatography purification may include petroleum ether and ethyl acetate, and the volume ratio of petroleum ether to ethyl acetate may be 10:1 to 2:1; the elution method for silica gel column chromatography purification may be gradient elution, and the volume ratio of petroleum ether to ethyl acetate during the gradient elution process may be 10:1, 8:1, 6:1, 4:1, and 2:1 respectively.

[0042] After obtaining compound 3, the present invention performs a deacetylation reaction on compound 3 to obtain compound 4.

[0043] In this invention, the deacylation reaction can be carried out under the conditions of a deacylation reagent and a second organic solvent. Specifically, compound 3, the deacylation reagent, and the second organic solvent are mixed to carry out the deacylation reaction.

[0044] In this invention, the deacylation reagent may include sodium methoxide and / or sodium ethoxide. In this invention, the molar ratio of compound 3 to the deacylation reagent may be 1:1 to 10, or 1:2 to 8, or even 1:4 to 6.

[0045] In this invention, the second organic solvent may comprise a mixed solvent of a lower alcohol and a halogenated hydrocarbon; the lower alcohol may comprise methanol and / or ethanol; the halogenated hydrocarbon may comprise chloroform and / or dichloromethane; the volume ratio of the lower alcohol to the halogenated hydrocarbon in the mixed solvent may be 1-5:1, or 2-4:1, or even 2-3:1. In this invention, the molar ratio of compound 3 to the volume ratio of the second organic solvent may be 1 mol: 1-100 L, or 1 mol: 10-50 L, or even 1 mol: 20-30 L.

[0046] In this invention, the temperature of the deacylation reaction can be 15~40℃, or 20~35℃, or even 20~30℃; the time of the deacylation reaction can be 1~10h, or 2~5h, or even 2~3h.

[0047] After completing the deacylation reaction, the present invention may further include: purifying the reaction solution obtained from the deacylation reaction using a cation exchange resin, filtering, and concentrating the resulting filtrate to obtain compound A. In the present invention, the cation exchange resin may include one or more of strong acid cation exchange resins, weak acid cation exchange resins, styrene-based cation exchange resins, and acrylic acid-based cation exchange resins, specifically cation exchange resin 001x7; the eluent for cation exchange resin purification may include methanol. The present invention does not have a particular limitation on the concentration; any concentration method well known to those skilled in the art that can remove the solvent is acceptable.

[0048] After obtaining compound 4, the present invention performs a catalytic hydrogenolysis reaction on compound 4 to obtain the flavonoid alloside compound.

[0049] In this invention, the catalytic hydrogenolysis reaction can be carried out under hydrogen atmosphere, hydrogenolysis catalyst and solvent conditions. Specifically, compound 4, hydrogenolysis catalyst and solvent are mixed and the catalytic hydrogenolysis reaction is carried out under hydrogen atmosphere.

[0050] In this invention, the hydrogenolysis catalyst may include a palladium-on-carbon catalyst, wherein the mass percentage of palladium in the palladium-on-carbon catalyst may be 5-20%, or even 10-15%. In this invention, the mass ratio of compound 4 to the hydrogenolysis catalyst may be 1:0.5-3, or even 1:1-2, or further 1:1.1-1.5.

[0051] In this invention, the solvent may include one or more of lower alcohols, ether solvents, and water; the lower alcohol may include ethanol and / or methanol; the ether solvent may include tetrahydrofuran (THF) and / or dioxane. In this invention, the solvent may specifically be an ethanol-tetrahydrofuran-water mixed solvent, or an ethanol-dioxane mixed solvent. In this invention, in the ethanol-tetrahydrofuran-water mixed solvent, the volume ratio of ethanol to tetrahydrofuran may be 1:0.1~1, or 1:0.2~0.8, or further 1:0.2~0.5, or specifically 1:0.25; the volume ratio of ethanol to water may be 30~200:1, or 50~150:1, or further 80~120:1, or specifically 100:1. In this invention, the volume ratio of ethanol to dioxane in the ethanol-dioxane mixed solvent can be 2~20:1, or 5~15:1, or even 8~12:1, or specifically 9:1.

[0052] In this invention, the temperature of the catalytic hydrogenolysis reaction can be 15~40℃, or 20~35℃, specifically 15℃, 20℃, 25℃, 30℃, 35℃ or 40℃; the time of the catalytic hydrogenolysis reaction can be 1~24h, or 5~20h, or even 10~15h, specifically 12h.

[0053] After completing the catalytic hydrogenolysis reaction, the present invention may further include: filtering the reaction solution obtained from the catalytic hydrogenolysis reaction through diatomaceous earth, concentrating the resulting filtrate, and then purifying it by pulping to obtain flavonoid alloside compounds. The present invention does not have a specific limitation on the concentration; any concentration method well-known to those skilled in the art that can remove the solvent is acceptable. In the present invention, the solvent used for pulping and purification may include a mixed solvent of n-hexane and ethyl acetate, wherein the volume ratio of n-hexane to ethyl acetate may be 1~20:1, or 10~15:1, or even 10~12:1.

[0054] In this invention, the preparation method of compound 1 may include the following steps: subjecting luteolin to a nucleophilic substitution reaction with dihalodiphenylmethane to obtain compound 1.

[0055] In this invention, the nucleophilic substitution reaction can be carried out in the presence of a third organic solvent. Specifically, luteolin, dihalodiphenylmethane, and the third organic solvent are mixed to carry out the nucleophilic substitution reaction.

[0056] In this invention, the halogen in the dihalodiphenylmethane may include fluorine, chlorine, bromine or iodine, and may specifically be chlorine.

[0057] In this invention, the molar ratio of luteolin and dihalodiphenylmethane can be 1:0.5~3, or 1:1~2.5, or even 1:1.5~2.

[0058] In this invention, the third organic solvent may include an inert solvent, specifically including diphenyl ether and / or chlorobenzene. In this invention, the molar ratio of luteolin to the volume of the organic solvent may be 1 mol: 1~10 mL, or 1 mol: 5~30 L, or even 1 mol: 5~10 L.

[0059] In this invention, the temperature of the nucleophilic substitution reaction can be 160~190℃ or 170~180℃; the time of the nucleophilic substitution reaction can be 1~10h or 3~5h, specifically 2~4h or 3h.

[0060] After completing the nucleophilic substitution reaction, the present invention may further include: cooling the reaction solution obtained from the nucleophilic substitution reaction to room temperature, diluting it with water, extracting it with petroleum ether, extracting the resulting aqueous phase with ethyl acetate, washing the resulting organic phase sequentially with saturated brine, drying it with anhydrous sodium sulfate, and filtering it, concentrating the resulting filtrate under reduced pressure, and purifying it by silica gel column chromatography to obtain compound 1. In the present invention, the number of petroleum ether extraction and ethyl acetate extraction can be independently 1 to 5 times, or 2 to 4 times, specifically 3 times. In the present invention, the purpose of petroleum ether extraction is to remove nonpolar impurities, and the purpose of ethyl acetate extraction is to extract compound 1. The present invention does not have a special limitation on the concentration; any concentration method well known to those skilled in the art that can remove the solvent is acceptable. In this invention, the eluent used in the silica gel column chromatography purification can be a mixed solvent of petroleum ether and ethyl acetate, and the volume ratio of petroleum ether to ethyl acetate can be 20:1 to 4:1; the elution method of the silica gel column chromatography purification can be gradient elution, and the volume ratio of petroleum ether to ethyl acetate in the gradient elution process can be 20:1, 15:1, 10:1, 8:1, 6:1 and 4:1 in sequence.

[0061] In this invention, the preparation method of compound 2 may include the following steps: acylation-substitution reaction of allose, acetylation reagent and halogenation agent under acidic conditions to obtain compound 2.

[0062] In this invention, the acetylation reagent may include acetic anhydride. In this invention, the molar ratio of allose (D-allulose) to the acetylation reagent may be 1:0.5~3, or 1:1~2.5, or even 1:1.5~2.

[0063] In this invention, the halogenating agent may include hydrofluoric acid, hydrochloric acid, hydrobromic acid, or hydroiodic acid. In this invention, the molar ratio of allose to the halogenating agent may be 1:0.2~5, or 1:1~4, or further 1:1.5~3, and specifically 1:2.

[0064] In this invention, the acid used in the acidic conditions may include acetic acid. In this invention, the molar ratio of allose to acid may be 1:1 to 5, or 1:1 to 4, or further 1:1.5 to 3, or specifically 1:2.

[0065] In this invention, the acylation-substitution reaction may include: mixing allose and an acetylation reagent to obtain an allose-acetylation reagent mixture; mixing a halogenating agent and an acid to obtain a halogenating agent-acid mixture; adding a portion of the halogenating agent-acid mixture to the allose-acetylation reagent mixture to carry out a first acylation-substitution reaction; and then adding the remaining halogenating agent-acid mixture under low temperature conditions to carry out a second acylation-substitution reaction. In this invention, the volume of the portion of the halogenating agent-acid mixture accounts for 10-40% of the total volume of the halogenating agent-acid mixture, and may also be 15-30%, or even more specifically 16.7-20%. In this invention, the temperature of the allose-acetylation reagent mixture may be -20-40°C, or may also be -10-10°C, or even more specifically -5-5°C, or even 0°C.

[0066] In this invention, the temperature of the acylation-substitution reaction can be 0~60℃, or 10~50℃, or 20~40℃, or specifically 25~30℃; the time of the acylation-substitution reaction can be 1~10h, or 2~5h, or 2~4h, or specifically 3h.

[0067] After completing the acylation-substitution reaction, the present invention may further include: diluting the reaction solution obtained from the acylation-substitution reaction with dichloromethane, pouring it into ice water, adding dichloromethane for extraction, washing the obtained organic phase sequentially with saturated NaHCO3 solution, washing with saturated brine, drying with anhydrous sodium sulfate, and filtering, concentrating the obtained filtrate, and purifying it by silica gel column chromatography to obtain compound 2. In the present invention, the number of dichloromethane extractions can be 1 to 5 times, or 2 to 4 times, specifically 3 times. The present invention does not have a special limitation on the concentration; any concentration method well known to those skilled in the art that can remove the solvent is acceptable. In the present invention, the elution method for silica gel column chromatography purification can be gradient elution, and the eluent used for silica gel column chromatography purification can include a mixed solvent of petroleum ether and ethyl acetate, wherein the volume ratio of petroleum ether to ethyl acetate can be 10:1 to 1:1, specifically 10:1, 8:1, 6:1, 4:1, 3:1, 2:1, and 1:1.

[0068] By using the specific protecting group strategy and glycosylation reaction conditions described above, the present invention achieves selective glycosylation of allose, with a high yield of compound 2.

[0069] The method for preparing flavonoid alloside compounds provided by this invention is simple, efficient, and easy to operate. The intermediates are stable, the product selectivity is high, the overall yield is high, the reaction conditions in each step are mild, and the intermediates are easy to purify and preserve, making it suitable for industrial production.

[0070] The present invention also provides derivatives of the flavonoid alloside compounds described in the above technical solutions, wherein the derivatives include at least one of pharmaceutically acceptable salts, prodrugs, hydrates and solvates.

[0071] In this invention, the pharmaceutically acceptable salt may include one or more of sodium, potassium, calcium, ammonium, organic ammonium, and magnesium salts. The phenolic hydroxyl groups in the flavonoid alloside compounds provided by this invention can dissociate H+. + It can react with alkali to form the aforementioned pharmaceutically acceptable salt.

[0072] In this invention, the solvate may include an ethanolate.

[0073] The present invention does not impose any particular limitation on the preparation method of the derivatives of the flavonoid alloside compounds, and any pharmaceutically acceptable preparation method known to those skilled in the art, using salts, prodrugs, hydrates and solvates, is acceptable.

[0074] The present invention also provides a pharmaceutical composition for the prevention and / or treatment of muscle dysfunction, comprising an active ingredient and pharmaceutically acceptable excipients, said active ingredient comprising at least one of flavonoid glycosides and their derivatives; said flavonoid glycosides having the structure shown in Formula I and / or Formula II: ; In Equations I and II, R1~R 11 The definition of the wavy line is the same as that of Equations I and II mentioned above, and will not be repeated here.

[0075] In this invention, the active component may include at least one of the flavonoid alloside compounds described in the above technical solutions and derivatives of the flavonoid alloside compounds described in the above technical solutions.

[0076] In this invention, the derivative may include at least one of a pharmaceutically acceptable salt, a prodrug, a hydrate, and a solvate. In this invention, the pharmaceutically acceptable salt may include one or more of a sodium salt, potassium salt, calcium salt, ammonium salt, organic amine salt, and magnesium salt. The phenolic hydroxyl group provided by this invention can dissociate H... +It can react with a base to form the aforementioned pharmaceutically acceptable salt. In this invention, the solvate may include an ethanolide.

[0077] In this invention, the muscle dysfunction can include muscle dysfunction caused by at least one or more of sarcopenia and Duchenne muscular dystrophy. In this invention, the sarcopenia can include sarcopenia caused by disuse atrophy and / or cachexia. In this invention, the cachexia can include cachexia caused by colon cancer. In this invention, the disuse atrophy can include muscle atrophy caused by limb immobilization.

[0078] The present invention does not specifically limit the pharmaceutically acceptable excipients, and any pharmaceutically acceptable excipients well known to those skilled in the art can be used, specifically such as at least one of the following pharmaceutically acceptable carriers, excipients, binders, suspending agents, emulsifiers, diluents, fillers, granulating agents, adhesives, disintegrants, lubricants, anti-adhesion agents, flow aids, wetting agents, gelling agents, absorption delay agents, dissolution inhibitors, reinforcing agents, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, and sweeteners.

[0079] In this invention, the dosage form of the pharmaceutical composition for preventing and / or treating muscle dysfunction may include liquid formulations, solid formulations, sprays, or inhalers; the liquid formulations may include injections, suspensions, emulsions, solutions, or syrups; the solid formulations may include tablets, capsules, granules, or powders.

[0080] In this invention, the mass content of the active ingredient in the pharmaceutical composition for preventing and / or treating muscle dysfunction can be 0.1-99%, or 0.5-80%, specifically 0.1%, 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

[0081] In this invention, the pharmaceutical composition for the prevention and / or treatment of muscle dysfunction may further include one or more of quercetin and its derivatives, apigenin and its derivatives, and luteolin and its derivatives.

[0082] In this invention, the administration route of the pharmaceutical composition for preventing and / or treating muscle dysfunction may include injection, oral administration, sublingual administration, or mucosal dialysis; the injection may include intravenous injection, intravenous infusion, intramuscular injection, intraperitoneal injection, or subcutaneous injection. In this invention, when the pharmaceutical composition is used to treat muscle dysfunction in mice, the effective dose may be ≥0.1 mg / kg, or may be 0.1~10 mg / kg, specifically 0.1 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, or 10 mg / kg. In this invention, when the pharmaceutical composition is used to treat human muscle dysfunction, the effective dose can be ≥0.008 mg / kg, or 0.008~0.8 mg / kg, specifically 0.008 mg / kg, 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg or 0.8 mg / kg.

[0083] The present invention does not have any particular limitation on the preparation method of the pharmaceutical composition for preventing and / or treating muscle dysfunction, and any preparation method well known in the art can be used.

[0084] Previous studies have shown that inhibiting PGAM5 protein effectively enhances muscle mass and improves athletic performance. The flavonoid glycosides provided by this invention can act as PGAM5 protein inhibitors for the prevention and treatment of muscle dysfunction. Specifically: flavonoid glycosides inhibit the formation of PGAM5 protein polymers, thereby inhibiting its phosphatase activity; flavonoid glycosides promote mitochondrial biogenesis; flavonoid glycosides improve disuse-induced muscle loss, enhancing muscle strength and function; flavonoid glycosides delay muscle mass decline caused by cachexia while enhancing muscle function; and flavonoid glycosides improve muscle function and enhance athletic performance in Duchenne muscular dystrophy (DMD) mice. The flavonoid glycosides provided by this invention show promising applications in the prevention and / or treatment of muscle dysfunction.

[0085] To further illustrate the present invention, the following detailed descriptions, in conjunction with embodiments, illustrate the flavonoid glycoside compounds, their preparation methods, applications, and pharmaceutical compositions for the prevention and / or treatment of muscle dysfunction provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0086] Example 1 Pgam5 Knockout Pgam5KO mice showed enhanced motor function and increased mitochondrial biogeneration in skeletal muscle. According to publicly available bioinformatics databases such as NCBI and Ensembl, at a distance Pgam5 Two specific sgRNAs (sg1 sequence number SEQ ID NO.14: GGCTATATTATATTCCCGAG; sg2 sequence number SEQ ID NO.15: ACAGTGGCATGTATAGCGAG) were designed and constructed from the intron regions flanking exon3. These sgRNAs, along with the Cas9 protein, were introduced into mouse zygotes using embryo electroporation. Once the zygotes reached the 2-cell stage, the treated embryos were transferred into the oviducts of ICR pseudopregnant female mice. After pregnancy and delivery, the offspring mice (F0 generation) were identified using molecular biology methods including PCR and sequencing, confirming the successful acquisition of Pgam5 KO first-generation mice. These first-generation mice were then mated with wild-type C5BL / 6N mice to obtain Pgam5 KO heterozygous F1 generation mice. These heterozygous F1 generation mice were then self-crossed to obtain Pgam5-KO homozygous mice.

[0087] DNA was extracted from mouse toes or tails using the Beyotime rapid tail extraction kit. The specific procedure was as follows: 48 μL of DNA extraction buffer was added to 2 μL of protease to prepare a digestion solution, ensuring the sample was fully immersed. The sample was first immersed at 55°C for 15 min, then at 95°C for 5 min. Stop buffer was then added before PCR amplification. PCR amplification was used to identify positive individuals carrying the gene mutation in the F0 generation of mice. The primer sequences were: Pgam5 Forward: TGGCGGCCTGTGGTCTGG (sequence number see SEQ ID NO.16, upstream primer), Reverse: CAGGTGCTTGCTGATGATGTCT (sequence number see SEQ ID NO.17, downstream primer). The amplification system is shown in Table 1.

[0088] Table 1 PCR system

[0089] Mouse running ability test: The treadmill program was set to three steps: accelerating to 5 m / min in 10 seconds and maintaining it for 60 seconds; accelerating to 10 m / min in 2 seconds and maintaining it for 120 seconds; and accelerating to the detection speed in 30 seconds and maintaining it for 1500 seconds. 22 m / min was selected as the optimal detection speed. The distance traveled by each mouse after a cumulative total of 30 electric shocks was recorded, and data were analyzed by group.

[0090] The experimental results are shown in Table 2. Pgam5KO mice ran farther, and analysis of muscle percentage showed that Pgam5 KO mice had heavier skeletal muscle, indicating a significant improvement in muscle movement ability. Table 2. Results of running ability test in mice under the action of compound S1395 (mean ± SEM, n=7)

[0091] Quantitative real-time PCR experiment: Fresh tissue was taken, and small pieces with a diameter of about 2-4 mm were cut. The pieces were then transferred to 2 mL thickened EP tubes, and total RNA was extracted from the gastrocnemius muscle tissue using the Promega Eastep® Super Total RNA Extraction Kit. Reverse transcription was performed using the Hifair® AdvanceFast 1st Strand cDNA Synthesis Kit (No Dye), with 1 μg of RNA used per group. The primer sequences are as follows: Pgc-1α: For-GCTTTCTGGGTGGACTCAAGT (sequence number see SEQ ID NO.2, upstream primer), Rev-GAGGGCAATCCGTCTTCATCC (sequence number see SEQ ID NO.3, downstream primer); mtNd1: For-CCTAGCCGTTTACTCAATCCT (sequence number see SEQ ID NO.4, upstream primer), Rev-TGATGGCTAGGGTGACTTCAT (sequence number see SEQ ID NO.5, downstream primer); Myod For-CGGGACATAGACTTGACAGGC (sequence number see SEQ ID NO.6, upstream primer), Rev-TCGAAACACGGGTCATCATAGA (sequence number see SEQ ID NO.7, downstream primer); Myog For-GAGACATCCCCCTATTTCTACCA (sequence number see SEQ ID NO.8, upstream primer), Rev-GCTCAGTCCGCTCATAGCC (sequence number see SEQ ID NO.5, downstream primer); Myog For-GAGACATCCCCCTATTTCTACCA (sequence number see SEQ ID NO.8, upstream primer), Rev-GCTCAGTCCGCTCATAGCC (sequence number see SEQ ID NO.3, downstream primer). No. 9 (downstream primer), Il-6: For-CCAGGTAGCTATGGTACTCCA (sequence number see SEQ ID NO. 10, upstream primer), Rev-GCTACCAAACTGGCTATAATC (sequence number see SEQ ID NO. 11, downstream primer); Tnfα: For-CCCTCACACTCAGATCATCTT (sequence number see SEQ ID NO. 12, upstream primer), Rev-GCTACGACGTGGGCTACAG (sequence number see SEQ ID NO. 13, downstream primer). After diluting the DNA template to 50 ng / μL, experiments were performed using the SYBR method according to the system in Table 3.

[0092] Table 3. Quantitative Real-Time PCR System

[0093] The results are shown in Table 4. It can be seen that Pgam5 KO mice can increase the mitochondrial biogenesis genes Pgc-1α and mtNd1, thus promoting mitochondrial biogenesis.

[0094] Table 4. Results of mitochondrial biogenesis-related genes (Pgc-1α, mtNd1) in Pgam5 KO mice (mean ± SEM, n=4)

[0095] Example 2 1.1 Detection of PGAM5 protein phosphatase activity in vitro Drug solution: The drugs were dissolved in DMSO to obtain a 10 mM solution. The drugs included were compounds 3, 4, 6, 7, S1395, 1395, 64, 94, 15, 86, 41, 92, 58, 33, 73, 89, 11, 18, 69, 25, 13, 189, 88, 125, 9018, 130, 131, and 17.

[0096] Phosphorylated substrate stock solution: The sequence of the phosphorylated substrate is DDA(pT)VA (sequence number see SEQ ID NO.1, peptide purity 95%, Nanjing Peptide Co., Ltd.), concentration 1 mg / mL, 20 mM Tris-Cl, pH=8.0, 500 mM NaCl, 0.5 mM TCEP buffer. Store at 4℃ and prepare fresh before use.

[0097] The in vitro recombinant PGAM5 protein, phosphorylated substrate stock solution, and drug solution were mixed. The resulting mixture (in vitro recombinant PGAM5 protein concentration of 20 nM, phosphorylated substrate concentration of 50 μmol / L, and drug solution concentration of 100 μmol / L) was incubated at 30 °C for 15 min, and reacted with Malachite Green Phosphate Detection Kit (Beyotime) for 30 min. The absorbance was measured at 630 nm, and the free phosphate concentration was calculated according to the standard curve. The PGAM5 protease inhibition rate was calculated as shown in Equation 1, and the test results are shown in Table 5.

[0098] Inhibition rate = (absorbance of drug sample well - absorbance of blank well) / (absorbance of drug-free control well - absorbance of blank well) ... (Equation 1).

[0099] Table 5. Results of PGAM5 protease inhibition rate under the action of different compounds (n=3)

[0100] As shown in Table 5, compounds S1395 and 1395 both exhibit good inhibitory activity against PGAM5 protein phosphatase, with S1395 showing the best inhibitory effect.

[0101] 1.2 Molecular docking of PGAM5 and S1395 Maestro docking software was used for protein preparation: the resolved structure of the PGAM5 protein was found in the RCSB protein database (https: / / www.rcsb.org / ), and a single protein was extracted from the structure of the PGAM5 dimer (PDB ID: 6CNI). The receptor was prepared using the Maestro-Protein Preparation Wizard module in Schrodinger, which removed water molecules, repaired missing residues, and minimized energy. Ligand preparation: molecules from the FDA database were subjected to Maestro-LigPrep, which included hydrogenation, removal of salt ions, neutralization of charged groups, protonation, generation of tautomers, generation of the correct chiral structure, output of the 3D structure, and minimization of energy. For molecular docking experiments, the Maestro-Ligand Docking module was selected. The docking box and ligand molecules were input, the docking precision was set to XP, and after clicking RUN, the 3D plot of the docking results was analyzed. The results are shown in [link to results]. Figure 1 .Depend on Figure 1 It was found that S1395 can directly bind to the interface at which PGAM5 protein dimers form multimers.

[0102] Example 3 Effects of PGAM5 inhibitors on mitochondrial biology and proliferation / differentiation of C2C12 myoblasts Experimental Cells and Methods: The experimental cells were mouse C2C12 cells purchased from ATCC. The culture medium used was DMEM purchased from Gibco, supplemented with 10wt% fetal bovine serum (FBS, Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific). The cell culture environment was a 5% CO2, 37℃ incubator. When the cells in the cell culture dish reached 90% cell growth, the culture medium was removed, the cells were digested with EDTA, and DMEM preheated to 37℃ was added to terminate the cell growth. The cells were centrifuged at 4℃, 1000 rpm for 5 min, the supernatant was aspirated, and the cells were resuspended in fresh DMEM. The cells were seeded in new culture dishes at the required ratio, mixed horizontally in a crosswise direction, and then placed in the incubator. For cell thawing, remove the cell cryopreservation tubes from the liquid nitrogen tank and quickly place them in a 37°C water bath to thaw. Gently shake the tubes by hand until the ice crystals in the cell suspension have completely disappeared. Then, centrifuge the cells at 4°C and 1000 rpm for 5 minutes, remove the cryopreservation solution, add 1 mL of fresh culture medium to suspend the cells, transfer them to a new culture dish, and place the dish in an incubator.

[0103] 20×10 4 Cells were seeded in 6-well plates, with a total volume of 2 mL per well, mixed well, and incubated overnight at 37°C. Drug solutions: Each compound was dissolved in DMSO to obtain a concentration of 10 mM. The effective concentrations of compounds S1395 and 1395 were 1 µM, and the effective concentrations of the remaining compounds were 10 µM. Each drug solution was used to treat C2C12 cells for 4 h.

[0104] The quantitative real-time PCR experiment was performed according to Example 1, and the results are shown in Table 6. It can be seen that all compounds can increase the expression of mitochondrial biogenesis genes Pgc-1α and Myod. Among them, compounds S1395 and 1395 significantly promoted the expression of genes regulating mitochondrial biogenesis and muscle differentiation in C2C12 myoblasts at low concentrations, indicating that compounds S1395 and 1395 had the strongest effects.

[0105] Table 6. Results of tests on mitochondrial biogenesis-related genes (Pgc-1α) and muscle differentiation regulatory genes (Myod) of each compound after 4 hours of treatment (mean ± SD, n=3)

[0106] Example 4 Effects of compound S1395 on the proliferation and differentiation of C2C12 myoblasts Experimental Cells and Methods: The experimental cells were mouse C2C12 cells purchased from ATCC. The culture medium used was DMEM purchased from Gibco, supplemented with 10wt% fetal bovine serum (FBS, Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific). The cell culture environment was a 5% CO2, 37℃ incubator. When the cells in the cell culture dish reached 90% cell growth, the culture medium was removed, the cells were digested with EDTA, and DMEM preheated to 37℃ was added to terminate the cell growth. The cells were centrifuged at 4℃, 1000 rpm for 5 min, the supernatant was aspirated, and the cells were resuspended in fresh DMEM. The cells were seeded in new culture dishes at the required ratio, mixed horizontally in a crosswise direction, and then placed in the incubator. For cell thawing, remove the cell cryopreservation tubes from the liquid nitrogen tank and quickly place them in a 37°C water bath to thaw. Gently shake the tubes by hand until the ice crystals in the cell suspension have completely disappeared. Then, centrifuge the cells at 4°C and 1000 rpm for 5 minutes, remove the cryopreservation solution, add 1 mL of fresh culture medium to suspend the cells, transfer them to a new culture dish, and place the dish in an incubator.

[0107] Immunoblot assay: 20 × 10 4 Cells were seeded in 6-well plates, with a total volume of 2 mL per well, mixed well, and incubated overnight at 37°C. Drug solutions: Compound S1395, compound 1395, apigenin-7-O-β-D-glucoside, luteolin, and 7-methoxycoumarin were dissolved in DMSO to obtain 10 mM solutions for treatment at 1 µM. C2C12 cells were treated with these solutions for 2 h. Cells were then lysed using cell lysis buffer (100 mM NaCl, 20 mM Tris·HCl, 1 mM EDTA, 1 wt% NP-40, 30 wt% glycerol, water, stored at 4°C). Loading buffer was added, and cells were denatured at 100°C for 10 min before Western blotting analysis. Results are shown below. Figure 2 It can be seen that, compared with the untreated group, the protein levels of MYOG, MYOD and phosphorylated AKT that promote muscle development were significantly increased after S1395 treatment, while the protein level of TRIM63 that induces muscle atrophy was significantly reduced. Moreover, under the same dose and experimental conditions, compound S1395 had a stronger effect on promoting myoblast proliferation and differentiation.

[0108] The quantitative real-time PCR experiment was performed according to Example 1. The results are shown in Tables 7 and 8. It can be seen that compound S1395 can increase the mitochondrial biogenesis genes Pgc-1α and mtNd1, and can promote the genes regulating mitochondrial biogenesis and muscle differentiation in C2C12 myoblasts. At the same dose and under the same experimental conditions, compound S1395 has a stronger effect on promoting the genes regulating mitochondrial biogenesis and muscle differentiation.

[0109] Table 7. Results of mitochondrial biogenesis-related gene (Pgc-1α, mtNd1) assays for each compound after 24 hours (mean ± SD, n=3)

[0110] Table 8. Results of muscle differentiation regulatory genes (Myod\Myog) detected by each compound after 24 hours (mean ± SD, n=3)

[0111] Example 5 Effects of compound S1395 on mitochondrial function in C2C12 myoblasts Experimental Cells and Methods: The experimental cells were mouse C2C12 cells purchased from ATCC. The culture medium used was DMEM purchased from Gibco, supplemented with 10wt% fetal bovine serum (FBS, Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific). The cell culture environment was a 5% CO2, 37℃ incubator. When the cells in the cell culture dish reached 90% cell growth, the culture medium was removed, the cells were digested with EDTA, and DMEM preheated to 37℃ was added to terminate the cell growth. The cells were centrifuged at 4℃, 1000 rpm for 5 min, the supernatant was aspirated, and the cells were resuspended in fresh DMEM. The cells were seeded in new culture dishes at the required ratio, mixed horizontally in a crosswise direction, and then placed in the incubator. For cell thawing, remove the cryovials from the liquid nitrogen container and quickly place them in a 37°C water bath to thaw. Gently shake the container by hand until all ice crystals in the cell suspension have disappeared visually. Then, centrifuge at 4°C and 1000 rpm for 5 minutes, aspirate the cryopreservation solution, add 1 mL of fresh culture medium to resuspend the cells, transfer them to a new culture dish, and place the dish in an incubator. (20 × 10⁶ cells / mL) 4 Cells were seeded in 6-well plates, with a total volume of 2 mL per well, mixed well, and incubated overnight at 37°C. Drug solution: Compound S1395 was dissolved in DMSO to obtain a drug solution of 10 mM. The treatment concentration was 1 µM. C2C12 cells were treated with the drug solution for 2 h and 4 h, respectively. An untreated group was set up as a blank control.

[0112] Intracellular ATP detection: The enhanced ATP detection kit (Meilun Biotechnology, catalog number MA0440) was used according to the instructions. First, the culture medium in the 6-well plate was discarded. 200 μL of the lysis buffer from the kit was added to each well. Cells were thoroughly lysed by repeatedly pipetting or shaking the plate. After lysis, the plate was centrifuged at 10,000 rpm for 5 min at 4°C. The supernatant was collected for subsequent measurements. An ATP standard curve was prepared. The reagents were thawed on ice. The ATP standard solution was diluted with ATP detection lysis buffer to seven concentrations: 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 μM. 100 μL of the ATP detection reagent was added to a white 96-well plate and incubated at room temperature for 3-5 min. Then, 10 μL of sample or diluted ATP standard solution was added to each well. The RLU value was measured using a chemiluminescence analyzer.

[0113] The results are shown in Table 9. It can be seen that compound S1395 can increase the ATP content of C2C12 myoblasts. The increase was significant after 2 hours of treatment and could be sustained up to 4 hours.

[0114] Table 9. S1395 increases intracellular ATP content in C2C12 myoblasts (n=3)

[0115] The quantitative real-time PCR experiment was performed according to Example 1, and the results are shown in Table 10. It can be seen that compound S1395 can significantly increase the mitochondrial biogenesis genes Pgc-1α and mtNd1 of C2C12 myoblasts within 2h to 4h, promote the mitochondrial biogenesis and muscle differentiation regulatory genes of C2C12 myoblasts, and the longer the time, the more significant the effect.

[0116] Table 10. Results of testing for mitochondrial biogenesis-related genes (Pgc-1α, mtNd1) and muscle differentiation regulatory genes (Myod, Myog) under the action of each compound from 2h to 4h (mean ± SD, n=3)

[0117] Example 6 Experimental model of cachexia-induced muscle atrophy The experimental animals were C57BL / 6J mice, purchased from Vital Rivers Ltd., and were routinely fed in a barrier environment.

[0118] Drug solution: Dissolve the compound (compound S1395, compound 1395, apigenin or quercetin) in DMSO to obtain a stock solution with a concentration of 10 mg / mL. Dilute 10 μL of the stock solution in 990 μL of physiological saline to obtain the drug solution. Prepare fresh before use.

[0119] Experimental Cells and Methods: The experimental cells were human MC38 cell line purchased from ATCC. The culture medium used was DMEM purchased from Gibco, with 10wt% fetal bovine serum (FBS, Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific) added. The cell culture environment was a 5% CO2, 37℃ incubator. When the cells in the cell culture dish reached 90% cell growth, the culture medium was removed, the cells were digested with EDTA, and DMEM preheated to 37℃ was added to terminate the cell growth. The cells were centrifuged at 4℃, 1000 rpm for 5 min, the supernatant was aspirated, and the cells were resuspended in fresh DMEM. The cells were seeded in new culture dishes at the required ratio, shaken horizontally in a cross shape, and then placed in the incubator. For cell thawing, remove the cell cryopreservation tubes from the liquid nitrogen tank and quickly place them in a 37°C water bath to thaw. Gently shake the tubes by hand until the ice crystals in the cell suspension have completely disappeared. Then, centrifuge the cells at 4°C and 1000 rpm for 5 minutes, remove the cryopreservation solution, add 1 mL of fresh culture medium to suspend the cells, transfer them to a new culture dish, and place the dish in an incubator.

[0120] Experimental groups: The untreated group consisted of mice that received no treatment; the model group consisted of mice that underwent cachexia-induced muscle atrophy (treated by subcutaneous injection of 2×10⁶ MC38 tumor cells into the lateral aspect of both hind limbs). 6 (Inducing muscle atrophy); Model group + S1395: Model group mice were administered compound S1395 at 1 mg / kg daily at 9 AM; Model group + 1395: Model group mice were administered compound 1395 at 1 mg / kg daily at 9 AM; Model group + apigenin: Model group mice were administered apigenin at 1 mg / kg daily at 9 AM; Model group + 1395: Model group mice were administered quercetin at 1 mg / kg daily at 9 AM.

[0121] Using the MC38 tumor model, the model group received subcutaneous injections of 2×10⁶ tumor cells into the lateral aspect of both hindlimbs. 6 Subsequently, mice in the treatment groups (compound S1395, compound 1395, baicalin, and quercetin) were administered the drug by gavage at a dose of 1 mg / kg / day for 15 consecutive days. On day 16, blood was collected from each eye after enucleation, and tumors and bilateral gastrocnemius muscles were also collected for subsequent pathological and biochemical analysis. The therapeutic effects of S1395 on cachexia were compared with those of other compounds. The results are shown in Table 11. The muscle percentage was calculated as gastrocnemius muscle / body weight × 100%.

[0122] H&E staining experiment: Paraffin sections need to be baked first, then dewaxed in a gradient manner, rinsed with running water for 10 min, and then stained with hematoxylin for nuclei. Frozen sections are taken out and brought to room temperature, then washed with PBS three times for 10 min each time. After rinsing with running water for 10 min, hematoxylin staining is performed. The hematoxylin staining time is 1~1.5 min, and then the sections are rinsed with warm water. The staining effect is observed under a microscope to see if differentiation is needed. Then, rinse with running water for 20 min for bluing. After bluing, counterstain with eosin for about 1 min, and rinse with warm water first to observe the staining intensity. The staining intensity can be adjusted by decolorizing with 75 v / v% ethanol-water. After staining, the sections are directly immersed in 95 v / v% ethanol-water for 30 s, in anhydrous ethanol for 1 min, in anhydrous ethanol for 5 min, in xylene for 15 min, in xylene for 10 min, and then mounted with neutral resin.

[0123] Analysis of muscle percentage statistics and H&E staining results is shown in the figure. Figure 3 From Table 11 and Figure 3 It can be seen that, compared with other compounds, the skeletal muscle of mice was heavier and the cross-sectional area of ​​the muscle fibers was larger after administration of compound S1395, which is closer to that of wild-type mice. This indicates that compound S1395 has a stronger protective effect on skeletal muscle under the same dose and experimental conditions.

[0124] Table 11 Experimental results of each compound effectively increasing the muscle percentage of the gastrocnemius muscle (mean ± SEM, n=3)

[0125] Blood creatine kinase (CK) level detection: After enucleation of mice, whole blood was collected and incubated at 4°C for 3 hours, then centrifuged at 3000 rpm for 5 minutes at 4°C. Serum was transferred to new 1.5 mL centrifuge tubes and microplate analysis was performed according to the instructions provided with the CheKine™ Creatine Kinase (CK) Activity Assay Kit (Micro Method). The results are shown in Table 12. It can be seen that under the same dosage and experimental conditions, compound S1395 can better inhibit the release of creatine kinase.

[0126] Table 12 Experimental results of blood creatine kinase (CK) under the action of various compounds (mean ± SEM, n=3)

[0127] The quantitative real-time PCR experiment was performed according to Example 1, and the results are shown in Table 13. It can be seen that compound S1395 can increase the mitochondrial biogenesis genes Pgc-1α and mtNd1, and can resist muscle atrophy caused by cachexia by promoting mitochondrial biogenesis. Furthermore, under the same dosage and experimental conditions, compound S1395 has a stronger effect in promoting mitochondrial biogenesis.

[0128] Table 13. Results of tests on mitochondrial biogenesis-related genes (Pgc-1α, mtNd1) under the action of compound S1395 (mean ± SEM, n=3)

[0129] Example 7 Experimental model of cachexia-induced muscle atrophy The experimental animals were C57BL / 6J mice, purchased from Vital Rivers Ltd., and were routinely fed in a barrier environment.

[0130] S1395 solution: Dissolve compound S1395 in DMSO to obtain a stock solution of S1395 with a concentration of 10 mg / mL. Dilute 10 μL of the stock solution in 990 μL of physiological saline to obtain the S1395 solution. Prepare fresh before use.

[0131] After anesthetizing the mice, the recovered MC38 cells were inoculated into the outer side of the hind limbs at a dose of 1×10⁻⁶. 6 One week after inoculation, tumors formed. Mice were administered the drug via gavage at 9:00 AM daily, according to their body weight. After the experiment, blood was collected from each eyeball, and tumors and bilateral gastrocnemius muscles were also collected for subsequent pathological and biochemical analysis.

[0132] Experimental groups: Untreated group consisted of mice that did not receive any treatment; Model group consisted of mice with cachexia-induced muscle atrophy; Model group + S1395 0.1 mg / kg consisted of mice in the model group that were given 0.1 mg / kg of S1395 at 9:00 AM daily; Model group + S1395 1 mg / kg consisted of mice in the model group that were given 1 mg / kg of S1395 at 9:00 AM daily.

[0133] The gastrocnemius muscle was isolated from the hind limb muscles of mice, and the tissue weight was weighed and then flash-frozen in liquid nitrogen and stored at -80℃. The muscle percentage was calculated, and the results are shown in Table 14. It can be seen that compound S1395 can resist the phenomenon of muscle loss caused by tumors, and can resist muscle atrophy at a concentration of 0.1 mg / kg.

[0134] Table 14 Results of compound S1395 effectively increasing the muscle percentage of the gastrocnemius muscle (mean ± SEM, n=3)

[0135] H&E staining experiment: The H&E staining experiment was performed according to Example 6. The results are shown below. Figure 4 It can be seen that, in terms of muscle tissue morphology, the muscle fibers in the model group were significantly smaller than those in the untreated group. After treatment with compound S1395, the muscle fibers could be restored to a size that was basically the same as that in the untreated group, indicating that compound S1395 can resist muscle atrophy.

[0136] Blood creatine kinase (CK) content detection: The experiment was conducted according to the blood creatine kinase (CK) content detection in Example 6. The results are shown in Table 15. It can be seen that cachexia will cause muscle atrophy, which leads to an increase in creatine kinase. Compound S1395 can reduce the excessive release of creatine kinase, and can reduce the release of creatine kinase at a concentration of 0.1 mg / kg.

[0137] Table 15. Results of blood creatine kinase assay under the action of compound S1395 (mean ± SEM, n=3)

[0138] Quantitative real-time PCR experiment: The experiment was conducted according to the quantitative real-time PCR in Example 1. The results are shown in Table 16. It can be seen that compound S1395 can increase the mitochondrial biogenesis genes Pgc-1α and mtNd1, and resist the muscle atrophy caused by tumor by promoting mitochondrial biogenesis. Moreover, it can effectively promote mitochondrial biogenesis at a concentration of 0.1 mg / kg.

[0139] Table 16. Results of tests on mitochondrial biogenesis-related genes (Pgc-1α, mtNd1) under the action of compound S1395 (mean ± SEM, n=3)

[0140] Example 8 Experimental model of hindlimb fixation-induced disuse muscle atrophy The experimental animals were 8-week-old C57BL / 6J mice purchased from Vital River Co., Ltd., and all were routinely fed in a barrier environment.

[0141] S1395 solution: Dissolve compound S1395 in DMSO to obtain a stock solution of S1395 with a concentration of 10 mg / mL. Dilute 10 μL of the stock solution in 990 μL of physiological saline to obtain the S1395 solution. Prepare fresh before use.

[0142] After anesthetizing the mice, their hind limbs were immobilized with plaster casts to ensure complete fixation of the joints. Once the casts were completely dry, the mice were returned to their cages. The experiment lasted for two weeks. From the start of immobilization, the mice were administered medication via gavage at 9:00 AM daily, according to their body weight. After the experiment, blood was collected from each eye, and tumors and bilateral gastrocnemius muscles were also harvested for subsequent pathological and biochemical analysis.

[0143] Experimental groups: Untreated group consisted of mice that received no treatment; Model group consisted of mice whose hind limbs were fixed; Model group + S1395 0.1 mg / kg consisted of mice in the model group that received 0.1 mg / kg of S1395 at 9:00 AM daily; Model group + S1395 1 mg / kg consisted of mice in the model group that received 1 mg / kg of S1395 at 9:00 AM daily; Model group + S1395 10 mg / kg consisted of mice in the model group that received 10 mg / kg of S1395 at 9:00 AM daily.

[0144] Muscle percentage test: After the experiment, the gastrocnemius muscle in the hind limb muscles of mice was isolated, the tissue weight was weighed and then flash-frozen in liquid nitrogen and stored in an environment of -80℃. The muscle percentage = gastrocnemius muscle / body weight × 100%. The results are shown in Table 17. It can be seen that in the hind limb fixation-induced disuse muscle atrophy model, compound S1395 can resist muscle atrophy and effectively increase muscle mass at a concentration of 0.1 mg / kg.

[0145] Table 17 Results of test on the effectiveness of compound S1395 in increasing the muscle percentage of the gastrocnemius muscle (mean ± SEM, n=3)

[0146] H&E staining experiment: The H&E staining experiment was performed according to Example 6. The results are shown below. Figure 5 It can be seen that, in terms of muscle tissue morphology, the muscle fibers in the model group were significantly smaller than those in the untreated group. After treatment with compound S1395, the muscle fibers could be restored to a size that was basically the same as that in the untreated group, indicating that compound S1395 can resist muscle atrophy.

[0147] Blood creatine kinase (CK) content detection: CK content was tested according to Example 6. The experimental results are shown in Table 18. It can be seen that compound S1395 can reduce the excessive release of creatine kinase, and the effect of reducing creatine kinase release is better as the concentration of compound S1395 increases.

[0148] Table 18. Results of serum creatine kinase levels under the action of compound S1395 (mean ± SEM, n=3)

[0149] Real-time PCR experiment: Real-time PCR experiment was performed according to Example 1. The results are shown in Table 19. It can be seen that compound S1395 can increase mitochondrial biogenesis genes Pgc-1α and mtNd1, promote mitochondrial biogenesis and restore muscle function. The effect is best at a concentration of 1 mg / kg.

[0150] Table 19 Results of tests on mitochondrial biogenesis-related genes (Pgc-1α and mtNd1) under the action of compound S1395 (mean ± SEM, n=3)

[0151] Example 9 Duchenne muscular dystrophy model experiment (DMD (Mdx mutation)) The experimental animals were DMD (Mdx, chrX:g.83803333 C>T mutation, resulting in nonsense mutation in exon 23 of the DMD gene) C57BL / 6J mice, all of which were routinely fed in a barrier environment.

[0152] S1395 solution: Dissolve compound S1395 in DMSO to obtain a stock solution of S1395 with a concentration of 10 mg / mL. Dilute 10 μL of the stock solution in 990 μL of physiological saline to obtain the S1395 solution. Prepare fresh before use.

[0153] Mice were raised to 6 weeks of age and then administered the drug via gavage at 9 a.m. daily, according to the mice's weight.

[0154] Experimental groups: The untreated group consisted of healthy wild-type mice; the model group consisted of DMD Duchenne muscular dystrophy mice; and the treatment group consisted of the model group plus S1395 1mg / kg, administered at 9:00 AM daily according to body weight.

[0155] Muscle percentage test: After the experiment, the gastrocnemius muscle in the hind limb muscles of mice was isolated, the tissue weight was weighed and then flash-frozen in liquid nitrogen and stored in an environment of -80℃. The muscle percentage was calculated and the results are shown in Table 20. It can be seen that in the DMD (Mdx mutation) model, mice showed muscle atrophy at 6 weeks of age, and compound S1395 can resist the muscle reduction caused by Mdx mutation.

[0156] Table 20 Results of compound S1395 effectively increasing the muscle percentage of the gastrocnemius muscle (mean ± SEM, n=9)

[0157] H&E staining: The H&E staining experiment was performed according to Example 6, and the results are shown below. Figure 6 It can be seen that in the DMD (Mdx mutation) model, mice develop muscle atrophy at 6 weeks of age, and compound S1395 can effectively increase the proportion of gastrocnemius muscle and muscle fiber area.

[0158] Sirius red staining: After the frozen sections were removed and brought to room temperature, they were washed three times with PBS for 10 minutes each time. After rinsing with running water for 10 minutes, hematoxylin staining was performed. The hematoxylin staining time was 1-1.5 minutes, followed by rinsing the sections with warm water. The staining effect was observed under a microscope to determine if differentiation was necessary. Then, the sections were rinsed with running water for 20 minutes for bluing. Sirius red staining solution (Beijing Solarbio Science & Technology Co., Ltd., catalog number G1473) was used for staining for 45 minutes. A warm water rinse could be performed first to observe the staining intensity. The staining intensity could be adjusted by decolorizing with 75v / v% ethanol-water. After staining, the sections were directly immersed in 95v / v% ethanol-water for 30 seconds, then in anhydrous ethanol for 1 minute, then in anhydrous ethanol for 5 minutes, then in xylene for 15 minutes, then in xylene for 10 minutes, and finally mounted with neutral resin. Experimental results are shown below. Figure 6 It can be seen that in the DMD (Mdx mutation) model, 6-week-old mice showed obvious fibrosis, and compound S1395 can effectively reduce the fibrosis area.

[0159] Blood creatine kinase (CK) level detection: CK level was tested according to Example 6, and the results are shown in Table 21. It can be seen that compound S1395 can reduce the level of creatine kinase in serum.

[0160] Table 21. Results of blood creatine kinase assay under the action of compound S1395 (mean ± SEM, n=9)

[0161] Quantitative real-time PCR experiment: The quantitative real-time PCR experiment was performed according to Example 1. The results are shown in Tables 22-24. It can be seen that compound S1395 can increase the mitochondrial biogenesis genes Pgc-1α and mtNd1, while decreasing the inflammatory genes Il-6 and Tnf-α. It can resist the muscle atrophy caused by Mdx mutation by promoting mitochondrial biogenesis.

[0162] Table 22 Experimental results of the level of Pgc-1α, a gene related to mitochondrial biogenesis, under the action of compound S1395 (mean ± SEM, n=9)

[0163] Table 23 Experimental results of the level of mt-Nd1, a gene related to mitochondrial biogenesis, under the action of compound S1395 (mean ± SEM, n=9)

[0164] Table 24 Experimental results of inflammation-related gene (IL-6\Tnf-α) levels under the action of compound S1395 (mean ± SEM, n=5)

[0165] Running ability test in mice: The treadmill program was set to three steps: accelerating to 5 m / min in 10 seconds and maintaining it for 60 seconds; accelerating to 10 m / min in 2 seconds and maintaining it for 120 seconds; and accelerating to the detection speed in 30 seconds and maintaining it for 1500 seconds. 22 m / min was selected as the optimal detection speed. The distance traveled by each mouse after a cumulative 30 electric shocks was recorded, and data were analyzed by group. The experimental results are shown in Table 25, indicating that compound S1395 can promote muscle movement ability in mice with DMD.

[0166] Table 25 Results of running ability test in mice under the action of compound S1395 (mean ± SEM, n=9)

[0167] Example 10 (1) Synthesis of compound 1 (a luteolin derivative protected by a monophenolic hydroxyl group) Under stirring conditions, dichlorodiphenylmethane (2.67 mmol, 1.5 equiv.) was added to a solution of luteolin (1.78 mmol, 1.0 equiv.) in diphenyl ether (10 mL). The resulting mixture was heated to 185 °C and stirred for 2 h. After cooling to room temperature, the reaction solution was poured into water (50 mL) and extracted three times with petroleum ether (50 mL each time). Ethyl acetate was added to the resulting aqueous phase and extracted three times (50 mL each time). The organic phases were combined, washed with saturated brine (50 mL), dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (gradient elution, eluent: petroleum ether and ethyl acetate volume ratios of 20:1, 15:1, 10:1, 8:1, 6:1, and 4:1, respectively) to give compound 1 (321 mg, yield 40%).

[0168] Appearance: Yellow powder; TLC: R f = 0.34 (silica gel, petroleum ether: ethyl acetate volume ratio = 2:1); 1H NMR (400 MHz, CDCl3): δ = 12.88 (s, 1H), 10.91 (s, 1H), 7.77 (d, J = 2.0 Hz, 1H), 7.69 (dd, J = 8.3, 2.0 Hz, 1H), 7.59 - 7.51 (m, 4H), 7.49 - 7.40 (m, 6H),7.21 (d, J = 8.3 Hz, 1H), 6.88 (s, 1H), 6.52 (d, J = 2.1 Hz, 1H), 6.20 (d, J= 2.1 Hz, 1H) ppm; 13 C NMR (101 MHz, CDCl3): δ = 181.8, 164.3, 162.8, 161.4,157.3, 149.5, 147.3, 139.2, 129.6, 128.7, 125.8, 125.1, 122.2, 117.6, 109.2,106.8, 104.2, 103.8, 99.0, 94.1 ppm; FT-IR (KBr): ν max = 3462, 3026, 2921, 2625,1738, 1492, 1374, 1339, 948, 760 cm -1 ; HRMS (ESI-TOF): m / z [M + Na] + calcdC 28 H 18 NaO6 + : 473.0996, found 473.0997.

[0169] (2) Synthesis of compound 2 (peracetylated bromoxyaloose) At 0°C with stirring, 2 mL of HBr-HOAc solution (1:1 molar ratio of HBr to HOAc) was added to a mixed solution of allose (type D) (10.7 mmol, 1.0 equiv.) and acetic anhydride (10 mL). After raising the temperature to room temperature, the reaction was carried out for 2 h. Then, 10 mL of HBr-HOAc solution was added again at 0°C with stirring, and the reaction was continued at room temperature for another 3 h. The resulting reaction solution was diluted with DCM (20 mL) and poured into ice water. The solution was extracted three times with DCM (20 mL each time). The organic phases were combined, washed with 40 mL of saturated NaHCO3 solution and 60 mL of saturated brine, dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated. The crude product was purified by silica gel column chromatography (gradient elution, eluent: petroleum ether / ethyl acetate volume ratio of 10:1, 8:1, 6:1, 4:1, 3:1, 2:1, and 1:1, respectively) to obtain compound 2 (2.35). g, yield 54%.

[0170] Appearance: Colorless, foamy powder; Specific rotation: [α] 23 D = +69.93 ( c = 1.0, CHCl3); 1 H NMR (400 MHz, CDCl3): δ = 6.50 (d, J = 4.6 Hz, 1H), 5.67 (dt, J = 9.4, 3.1 Hz, 1H), 5.06 (dd, J = 10.5, 2.9 Hz, 1H), 4.99 (t, J = 4.0 Hz, 1H), 4.49 (d, J =12.5 Hz, 1H), 4.35 (dd, J = 12.6, 4.2 Hz, 1H), 4.20 (dd, J = 12.5, 2.3 Hz,1H), 2.20 (s, 3H), 2.09 (s, 3H), 2.08 (s, 3H), 2.03 (s, 3H) ppm; FT-IR (KBr): ν max = 3437, 3032, 2963, 2928, 2916, 1749, 1635, 1455, 802, 713 cm -1 .

[0171] (3) Preparation of compound 3 Under stirring conditions, a chloroform (2 mL) solution of compound 1 (0.127 mmol, 1.0 equiv.) was mixed with compound 2 (0.255 mmol, 2.0 equiv.), TBAB (0.0635 mmol, 0.5 equiv.), and potassium carbonate aqueous solution (0.25 M, 0.255 mmol, 2.0 equiv.). The resulting mixture was heated to 45 °C and stirred for 4 h. The mixture was extracted three times with DCM (50 mL each time). The resulting organic phase was concentrated to remove the solvent. The crude product was purified by silica gel column chromatography (gradient elution, eluent: petroleum ether / ethyl acetate volume ratio = 10:1, 8:1, 6:1, 4:1, and 2:1) to give compound 3 (20.6 mg, yield 21%).

[0172] Appearance: White powder; TLC: R f = 0.57 (silica gel, petroleum ether: ethyl acetate volume ratio = 1:1); 1 H NMR(400 MHz, CDCl3): δ = 12.81 (s, 1H), 7.58 (dd, J = 6.8, 3.2 Hz, 5H), 7.46 (d,J = 8.2 Hz, 1H), 7.43 - 7.36 (m, 8H), 7.00 (d, J = 8.2 Hz, 1H), 6.59 (d, J =2.4 Hz, 1H), 6.55 (d, J = 2.2 Hz, 1H), 6.49 (d, J = 2.4 Hz, 1H), 5.76 (t, J =2.9 Hz, 1H), 5.46 (d, J = 8.1 Hz, 1H), 5.19 (dd, J = 8.2, 3.1 Hz, 1H), 5.05(dd, J = 9.9, 2.8 Hz, 1H), 4.26 (d, J = 3.2 Hz, 1H), 2.19 (s, 3H), 2.11 (s,3H), 2.09 - 1.99 (m, 6H) ppm; 13C NMR (101 MHz, CDCl3): δ = 182.9, 171.2,170.2, 169.6, 169.5, 164.6, 162.7, 157.7, 151.0, 148.6, 139.9, 129.9, 129.5,128.9, 126.6, 125.4, 122.2, 109.5, 106.9, 105.2, 100.2, 96.9, 96.1, 71.2,69.0, 68.8, 66.5, 62.7, 21.2, 21.0 ppm; FT-IR (KBr): ν max = 3419, 2927, 1671,1472, 1380, 1273, 1211, 1099, 927, 888 cm -1 HRMS (ESI-TOF): C 42 H 36 NaO 15 + [M+Na] + calcd 803.1946, found 803.2228.

[0173] (4) Preparation of flavonoid glycosides (compound S1395, formula III; equivalent to R1, R4~R6 and R8~R9 being hydrogen in formula I, R2, R3, R7 and R... 10 ~R 13 (for -OH).

[0174] Under stirring conditions, sodium methoxide (14.4 mmol, 6.0 equiv.) was added to a mixed solution of compound 3 (2.40 mmol, 1.0 equiv.) in methanol (36 mL) and chloroform (18 mL). The mixture was reacted at room temperature with stirring for 2 h. The resulting reaction solution was purified by quenching with cation exchange resin 001x7 (eluent was methanol). After filtration, the filtrate was concentrated to remove the solvent, yielding crude compound 4, which was directly used in the next reaction step.

[0175] The crude compound 4 (1.47 g) was dissolved in a mixed solvent of ethanol (100 mL), tetrahydrofuran (25 mL) and water (1 mL), and 10 wt% Pd / C (1.70 g) was added. The reaction was carried out at room temperature under a hydrogen atmosphere and with stirring for 12 h. The resulting reaction solution was filtered through diatomaceous earth. The filtrate was concentrated to remove the solvent and then purified by slurrying with n-hexane-ethyl acetate (volume ratio = 10:1) to obtain compound S1395 (1.06 g, with an overall yield of 98% for the two-step reaction of deacetylation and catalytic hydrogenolysis).

[0176] Appearance: Yellow powder; TLC: R f = 0.63 (silica gel, dichloromethane:methanol volume ratio = 4:1); 1 H NMR (400MHz, CDCl3): δ = 7.01 (d, J = 1.1 Hz, 1H), 6.92 (d, J = 1.1 Hz, 1H), 4.58 (d,J = 1.1 Hz, 2H), 4.08 (q, J = 7.0 Hz, 2H), 3.87 (s, 3H), 1.46 (td, J = 7.0,1.2 Hz, 3H) ppm. 13 C NMR (101 MHz, CDCl3): δ = 149.4, 148.9, 128.7, 116.8,115.1, 113.7, 64.9, 56.3, 34.4, 14.7 ppm. FT-IR (KBr): ν max = 3429, 1658, 1606,1495, 1448, 1302, 1254, 1099, 816, 717 cm -1 HRMS (ESI-TOF): C 21 H 20 NaO 11 + [M+Na] + Calcd 471.0898, found 471.0900.

[0177] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of flavonoid glycosides and / or their derivatives in the preparation of medicaments for the prevention and / or treatment of muscle dysfunction, characterized in that, The flavonoid glycoside compound has the structure shown in Formula I or Formula II: ； Among them, R1~R6 include hydrogen, hydroxyl or alkoxy; R7~R9 include hydroxyl or acyloxy; R 10 Including hydroxymethyl, carboxyl, or acyloxyalkyl groups; R 11 Includes hydrogen or hydroxyl groups; wavy lines indicate R or S configurations.

2. The application according to claim 1, characterized in that, The muscle dysfunction includes muscle dysfunction caused by at least one of sarcopenia and Duchenne muscular dystrophy.

3. The application according to claim 2, characterized in that, The sarcopenia includes sarcopenia caused by at least one of disuse atrophy and cachexia.

4. The application according to claim 3, characterized in that, The cachexia mentioned includes cachexia caused by colon cancer.

5. The application according to claim 1, characterized in that, The derivatives include at least one of pharmaceutically acceptable salts, prodrugs, hydrates, and solvates.

6. A flavonoid alloside compound, characterized in that, It has the structure shown in Formula III: Formula III.

7. The method for preparing the flavonoid alloside compound according to claim 6, characterized in that, Includes the following steps: Compound 1 and compound 2 were subjected to a glycosylation reaction to obtain compound 3; Compound 3 was subjected to a deacetylation reaction to obtain compound 4; The compound 4 was subjected to a catalytic hydrogenolysis reaction to obtain the flavonoid alloside compound; ； In compound 2, X includes hydroxyl, halogen, alkoxy, acyloxy, mercapto, thioether, sulfoxide, sulfone, or trichloroacetylimine ester group, and the wavy line indicates the R configuration or S configuration.

8. The derivative of the flavonoid alloside compound according to claim 6, characterized in that, The derivatives include at least one of pharmaceutically acceptable salts, prodrugs, hydrates, and solvates.

9. A pharmaceutical composition for the prevention and / or treatment of muscle dysfunction, characterized in that, It includes an active ingredient and pharmaceutically acceptable excipients, said active ingredient comprising at least one of flavonoid glycosides and their derivatives; said flavonoid glycosides having the structure shown in Formula I and / or Formula II: ； Among them, R1~R6 include hydrogen, hydroxyl or alkoxy; R7~R9 include hydroxyl or acyloxy; R 10 Including hydroxymethyl, carboxyl, or acyloxyalkyl groups; R 11 Includes hydrogen or hydroxyl groups; wavy lines indicate R or S configurations.

10. The pharmaceutical composition according to claim 9, characterized in that, The active component includes at least one of the flavonoid alloside compound of claim 6 and the derivative of the flavonoid alloside compound of claim 8.

Images