A hydroxyethyl starch-indole-3-acetic acid conjugate, and a preparation method and application thereof

Abstract

The application belongs to the field of biological medicine, and particularly relates to a hydroxyethyl starch-indole-3-acetic acid conjugate as well as a preparation method and application thereof. The conjugate has a substitution degree of 0.05-0.70 and is connected through an ester bond. In vitro and in vivo experiments show that the conjugate can resist upper gastrointestinal enzymolysis, and is specifically released under the action of colon flora. When the substitution degree is 0.37, the colon IAA concentration reaches 581.5 micromoles / kg, which is significantly better than that of free drugs. In a colonitis model, the conjugate significantly inhibits body weight loss, reduces a disease activity index, and restores colon length, and the effect is much better than that of free IAA. The mechanism includes: optimizing intestinal flora (reducing F / B ratio), up-regulating anti-inflammatory factors, down-regulating pro-inflammatory factors, and repairing intestinal barrier. In addition, the carrier hydroxyethyl starch can be fermented to produce short-chain fatty acids as resistant starch, thereby realizing double synergistic regulation. The synthesis process of the application is mild, and the biocompatibility is good, thereby providing an efficient and safe treatment scheme for colonitis.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a hydroxyethyl starch-indole-3-acetic acid conjugate, its preparation method, and its application. Background Technology

[0002] Indole-3-acetic acid (IAA), a key microbial metabolite of tryptophan, exerts anti-inflammatory and immunomodulatory effects by activating aryl hydrocarbon receptors (AhR) and regulating intestinal immune homeostasis, thus possessing potential therapeutic value for colitis. However, orally administered free IAA (such as sodium IAA) is readily absorbed rapidly by the upper gastrointestinal tract before reaching the colon, resulting in low local bioavailability in the colon and limiting its therapeutic efficacy.

[0003] Existing colon-targeted delivery systems, such as hydrogels, enteric-coated capsules, and non-covalent physical mixtures, suffer from problems such as drug burst release, low drug loading, and insufficient targeting specificity. Previous articles have shown that natural starch-indoleacetic acid conjugates have insufficient targeting, with premature release still occurring in the stomach and small intestine (Gong Qian. Research on the Influence of Starch Structure on Colon-Targeted Delivery Performance and Efficacy of Indoleacetic Acid in the Prevention and Treatment of Colitis [D]. Jinan: Qilu University of Technology, 2025).

[0004] Hydroxyethyl starch (HES), as a biocompatible polymer, has the potential for colon-targeting, but there are no reports on its covalent bonding with IAA and the systematic study of the effect of its degree of substitution on colon-targeting delivery efficiency. Summary of the Invention

[0005] This invention provides a hydroxyethyl starch-indole-3-acetic acid conjugate (HESIAA), its preparation method, and its application in the treatment of colitis, aiming to solve the problem of low colon-targeted delivery efficiency of IAA.

[0006] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a hydroxyethyl starch-indole-3-acetic acid conjugate, wherein the degree of substitution of the hydroxyethyl starch-indole-3-acetic acid conjugate is 0.30-0.70.

[0007] In specific embodiments of the present invention, the degree of substitution is 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, or any value between these values.

[0008] Preferably, the degree of substitution is 0.35-0.66. More preferably, the degree of substitution is 0.37, 0.53, or 0.66. Most preferably, the degree of substitution is 0.37.

[0009] Furthermore, in the hydroxyethyl starch-indole-3-acetic acid coupling compound, hydroxyethyl starch and indole-3-acetic acid are linked by chemical bonds, preferably by ester bonds.

[0010] In a second aspect, the present invention provides a composition comprising the aforementioned hydroxyethyl starch-indole-3-acetic acid conjugate, and a pharmaceutically acceptable carrier or excipient.

[0011] Furthermore, the pharmaceutical composition is an oral formulation.

[0012] In a third aspect, the present invention provides a method for preparing the hydroxyethyl starch-indole-3-acetic acid coupling compound, the method comprising the following steps: dissolving hydroxyethyl starch in a solvent, adding indole-3-acetic acid, a base and a condensing agent, stirring the reaction at room temperature, and after the reaction is completed, adding the reaction solution to ethanol to precipitate, separating, washing and drying to obtain the product.

[0013] Furthermore, the molar ratio of indole-3-acetic acid to the dehydrated glucose unit in hydroxyethyl starch is (0.05-2.0):1.

[0014] Optionally, the molar ratio of indole-3-acetic acid to dehydrated glucose units in hydroxyethyl starch is 0.05:1, 0.06:1, 0.07:1, 0.08:1, 0.09:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1.0:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2.0:1, or any ratio between these values.

[0015] Furthermore, the solvent includes at least one of DMSO, ionic liquid, and water; And / or, the condensing agent comprises at least one of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), N,N'-dicyclohexylcarbodiimide (DCC), and 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (HATU); And / or, the base includes at least one of 1-methylimidazole, amines, sodium bicarbonate, and sodium carbonate.

[0016] Further, the molar ratio of the condensing agent to indole-3-acetic acid is (1-2):1; and / or, the molar ratio of the base to indole-3-acetic acid is (1-4):1.

[0017] Optionally, the molar ratio of the condensing agent to indole-3-acetic acid is 1.0:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2.0:1, or any ratio therebetween.

[0018] Optionally, the molar ratio of the base to indole-3-acetic acid is 1.0:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2.0:1, 2.1:1, 2.2:1, 2.3:1, 2.4:1, 2.5:1, 2.6:1, 2.7:1, 2.8:1, 2.9:1, 3.0:1, 3.1:1, 3.2:1, 3.3:1, 3.4:1, 3.5:1, 3.6:1, 3.7:1, 3.8:1, 3.9:1, 4.0:1, or any ratio between these.

[0019] In a specific embodiment of the present invention, the method for preparing the hydroxyethyl starch-indole-3-acetic acid conjugate is as follows: hydroxyethyl starch is dissolved in dimethyl sulfoxide, and indole-3-acetic acid, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride and 1-methylimidazole are added. The mixture is stirred and reacted at room temperature. After the reaction is completed, the reaction solution is added to ethanol to precipitate the product. The product is then separated, washed, and dried to obtain the final product.

[0020] Furthermore, the molar ratio of EDCI to indole-3-acetic acid is 1.2:1.

[0021] Furthermore, the molar ratio of 1-methylimidazole to indole-3-acetic acid is 2:1.

[0022] Furthermore, the reaction time is 20-28 hours, preferably 24 hours.

[0023] In a fourth aspect, the present invention provides the use of the hydroxyethyl starch-indole-3-acetic acid conjugate or the composition thereof in any of the following aspects: A1. Application in the preparation of products for colon-targeted delivery of indole-3-acetic acid; A2. Applications in the preparation of products for regulating gastrointestinal flora; A3. Application in the preparation of products for repairing intestinal mucosa; A4. Applications in the preparation of products for inflammatory diseases, autoimmune diseases and metabolic diseases; A5. Use in the preparation of products for the prevention and / or treatment of colitis; A6. Applications in regulating metabolism and immunity.

[0024] Furthermore, the products include pharmaceuticals, health foods, foods for special medical purposes, or ordinary foods.

[0025] Furthermore, the inflammatory disease is colitis, and more specifically, ulcerative colitis.

[0026] Furthermore, the drug exerts its effect through one or more of the following mechanisms: (a) Increases the concentration of IAA in colonic contents; (b) Regulate the gut microbiota, for example, by increasing the abundance of beneficial bacteria (such as S24-7 and Bacteroidetes) and reducing the Firmicutes / Bacteroidetes (F / B) ratio; (c) Inhibit the inflammatory response, for example, by upregulating the anti-inflammatory cytokines IL-10 and IL-22 and downregulating the pro-inflammatory cytokines IL-1β, IL-6 and IFN-γ; (d) Enhance intestinal barrier function, such as by upregulating the expression of tight junction proteins Claudin-1 and ZO-1.

[0027] The beneficial effects of the present invention include, but are not limited to: 1. Precise colon-targeting and controlled-release properties significantly improve the colonic bioavailability of IAA. This invention utilizes the unique etherification structure and anti-enzymatic properties of hydroxyethyl starch (HES) to construct a novel colon-targeted delivery system by precisely controlling the degree of substitution (DS=0.30-0.70, with DS=0.37 being optimal). In vitro simulated gastrointestinal release experiments showed that the release of IAA from the three different degrees of substitution in the gastric phase (containing pepsin, pH 1.2) and intestinal phase (containing trypsin, pH 6.8) was extremely low (below 0.5 mg), demonstrating that the conjugate can effectively resist degradation by digestive enzymes in the upper gastrointestinal tract. Upon entering the colonic phase (containing rat fecal microbiota, pH 7.4), the HESIAA with DS=0.37 showed the fastest release, with a cumulative release rate of 86.58% after 48 hours, while the cumulative release rates of samples with DS=0.53 and 0.66 were 69.35% and 70.70%, respectively. This indicates that the degree of substitution has a significant impact on colonic release characteristics, with DS=0.37 being the optimal choice. In vivo targeted delivery experiments further validated the above results: the IAA concentration in the colonic contents of mice in the HESIAA group with DS=0.37 reached as high as 581.5 μmol / kg, significantly higher than that in the DS=0.53 group (182.8 μmol / kg), the DS=0.66 group (274.7 μmol / kg), and the free IAANa group (P<0.001). These results demonstrate that this invention, by optimizing the carrier structure and degree of substitution, achieves precise enrichment and efficient utilization of IAA in the colon, overcoming the technical challenge of low colonic bioavailability of orally administered free IAA.

[0028] 2. Superior therapeutic effect in treating colitis, significantly better than free drugs. In a DSS-induced acute colitis mouse model, under the same IAA dosage, the HESIAA (DS=0.37) intervention group of this invention exhibited a significantly superior therapeutic effect. Regarding weight loss, the DSS model group mice experienced a 13.23% weight loss on day 6, while the HESIAA group only experienced a 4.89% loss, and the free IAA group experienced a 10.49% loss, indicating that HESIAA can significantly inhibit weight loss induced by colitis. In terms of Disease Activity Index (DAI) scores, the DSS model group scored 8.83, the HESIAA group significantly decreased to 3.83, and the free IAA group scored 8.5, demonstrating that the improvement effect of HESIAA far exceeded that of the free drug. Regarding colon length, the DSS model group showed a 22% reduction in colon length, the HESIAA group only a 10% reduction (restoring colon length to 90% of the normal group), while the free IAA group showed a 28% reduction. Histopathological analysis showed that the colonic crypt structure of mice in the HESIAA group was relatively intact, the number of goblet cells significantly increased, and inflammatory cell infiltration was significantly reduced. The histopathological score was significantly lower than that of the DSS model group and the free IAANa group. These results consistently demonstrate that HESIAA of this invention is significantly superior to free IAANa in improving key clinical indicators of colitis, exhibiting excellent anti-colitis activity.

[0029] 3. Synergistically regulates gut microbiota, exerting a dual metabolic regulatory effect of "IAA-SCFA". The conjugate of this invention releases IAA in the colon, while the carrier hydroxyethyl starch itself, as resistant starch (RS), can be fermented by intestinal flora to produce short-chain fatty acids (SCFAs), thereby achieving a synergistic effect of "IAA-mediated AhR activation" and "SCFAs-mediated intestinal acidification and immune regulation". 16S rRNA gene sequencing results showed that, compared with the control group, the gut microbiota structure of the HESIAA (DS=0.37) group mice was significantly optimized: at the phylum level, the relative abundance of Firmicutes decreased, the relative abundance of Bacteroidetes increased, and the Firmicutes / Bacteroidetes (F / B) ratio decreased significantly from 15.88 in the control group to 4.02, while a low F / B ratio is generally considered a marker of healthy gut microbiota; at the genus level, the relative abundance of beneficial bacteria such as S24-7, Oscillospira (hailed as a candidate for next-generation probiotics, negatively correlated with inflammatory diseases), and Odoribacter (butyric acid-producing bacteria) increased significantly, while the abundance of inflammation-related pathogens such as Desulfovibrio (producing hydrogen sulfide that disrupts the intestinal barrier) and Peptostreptococcaceae decreased. These changes in gut microbiota not only promote the generation of SCFAs, but also activate the aryl hydrocarbon receptor (AhR) pathway through IAA, thus jointly maintaining gut immune homeostasis.

[0030] 4. Multiple anti-inflammatory and intestinal barrier repair mechanisms systematically improve the pathological state of colitis. The HESIAA of this invention exerts a systemic anti-inflammatory effect by upregulating anti-inflammatory cytokines and downregulating pro-inflammatory cytokines, while simultaneously repairing the damaged intestinal barrier. ELISA and qPCR results showed that, compared with the DSS model group, the levels of anti-inflammatory cytokines IL-10 and IL-22 in the colon tissue of mice treated with HESIAA were significantly increased (P<0.01), while the levels of pro-inflammatory cytokines IL-1β, IL-6, and IFN-γ were significantly decreased (P<0.001), with mRNA expression changes consistent with protein levels. These cytokine changes indicate that HESIAA can effectively inhibit the DSS-induced intestinal inflammatory cascade. Immunohistochemical analysis showed that the expression of tight junction proteins Claudin-1 and ZO-1 in colon tissue was significantly downregulated after DSS induction, while the expression levels of these two proteins were significantly restored after HESIAA intervention, indicating that this conjugate can repair the damaged intestinal epithelial barrier and prevent harmful substances in the intestine (such as bacteria and endotoxins) from crossing the intestinal mucosa and entering the systemic circulation. Through a dual mechanism of "inhibiting inflammation + repairing the barrier", the present invention HESIAA systematically improves the disease process of colitis from a pathophysiological level.

[0031] 5. Integrated structural and functional design, controllable manufacturing process, and high safety. This invention achieves a highly efficient esterification reaction of hydroxyethyl starch and indoleacetic acid (IAA) at room temperature using an EDCI / 1-methylimidazole catalytic system. The synthesis process is simple, mild, and allows for controllable substitution degree. Specifically, by controlling the molar ratio of IAA to the dehydrated glucose units in hydroxyethyl starch (0.5:1, 0.7:1, 1:1), HESIAA with substitution degrees of 0.37, 0.53, and 0.66 can be obtained, with yields as high as 87.3%-93.8%, demonstrating excellent yield and reproducibility. The product can be purified by ethanol precipitation, washing, and drying, eliminating the need for complex purification steps and making it suitable for industrial-scale production. Regarding safety, hydroxyethyl starch, as a commercially available plasma expander, has recognized biocompatibility and safety, and indoleacetic acid, as an endogenous tryptophan metabolite, also exhibits good safety characteristics. The two are structurally stable after covalent ester bonding, and no significant toxic side effects were observed in animal experiments. In summary, this invention provides a novel technical solution for the efficient, safe, processable, and multi-target synergistic treatment of colitis, which has significant prospects for clinical translation and industrialization. Attached Figure Description

[0032] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings: Figure 1 This is a schematic diagram of the synthesis route of HESIAA in an embodiment of the present invention.

[0033] Figure 2 These are HES and HESIAA with different DS values ​​in the embodiments of the present invention. 1 H nuclear magnetic resonance spectrum.

[0034] Figure 3 These are the FTIR spectra of HES and HESIAA under different DS values ​​in the embodiments of the present invention.

[0035] Figure 4 The TGA curves of HES and HESIAA in this embodiment of the invention are ( Figure 4 (a), DTG curve ( Figure 4 (b) and DSC curve ( Figure 4 (c)

[0036] Figure 5 These are SEM micrographs of HES and HESIAA at different DS values ​​in embodiments of the present invention. Figure 5 In the image, 'a' is an electron microscope image of HES; Figure 5 In the image, b is an electron micrograph of HESIAA with a DS value of 0.37; Figure 5 In the image, c is an electron microscope image of HESIAA with a DS value of 0.53; Figure 5 In the image, d is an electron microscope image of HESIAA with a DS value of 0.66.

[0037] Figure 6 These are the cumulative drug release curves of HESIAA carriers with different degrees of substitution (DS=0.37, 0.53, and 0.66) in vitro in a simulated gastrointestinal fluid system, as described in this embodiment of the invention. Data are expressed as mean ± standard deviation (n=3).

[0038] Figure 7 This is a schematic diagram showing the effect of HESIAA on IAA targeted delivery in the mouse colon (n=6) in an embodiment of the present invention. Figure 7 Medium A shows the level of IAA in the colonic contents; Figure 7 Image b shows the IAA levels in the contents of the stomach, small intestine, and colon; results are expressed as mean ± standard error. p<0.001.

[0039] Figure 8This is a Venn diagram showing the α-diversity, β-diversity, and mouse fecal microbiota composition of the gut microbiota in the HES, HESIAA, and IAANa groups in the embodiments of the present invention. Figure 8 In this context, 'a' represents α-diversity. Figure 8 In this context, b represents β-diversity. Figure 8 c is a Venn diagram of the composition of mouse fecal microbiota.

[0040] Figure 9 This is a phylum-level classification, genus-level classification, and heatmap of the mouse fecal microbiota composition in this embodiment of the invention. Among them, Figure 9 In the figure, 'a' represents the phylum-level classification in the composition of mouse fecal microbiota; Figure 9 In the middle, b represents the genus-level classification; Figure 9 The middle 'c' represents a heatmap.

[0041] Figure 10 This is a schematic diagram illustrating the results of HESIAA improving DSS-induced colitis in mice in an embodiment of the present invention. Figure 10 In the diagram, 'a' represents a schematic diagram of an animal experiment design. Figure 10 b represents weight loss; Figure 10 In the middle, c represents the Large Intestinal Injury Assessment (DAI) score. Figure 10 In the middle, d represents the histopathological score; Figure 10 In the middle, 'e' represents the spleen weight ratio; Figure 10 f and g are photographs and statistical graphs of colon length; Figure 10 In the middle, h represents the histopathological changes in colon tissue. Results are expressed as mean ± standard error (n=6). p<0.05, p<0.01, p<0.001.

[0042] Figure 11 This is a schematic diagram illustrating the effects of HESIAA on cytokine levels and tight junction protein expression in a DSS-induced colitis model according to embodiments of the present invention. Figure 11 The values ​​in the middle (ae) represent the statistical results of the expression levels of IL-22, IL-10, IL-1β, IL-6, and IFN-γ in colon tissue, respectively. Figure 11 The image in Figure fh is a schematic diagram showing the results of qRT-PCR detection of mRNA expression of IL-10, IL-1β and IL-6 in colon tissue; Figure 11 In the figure, i represents the expression of Claudin1 and ZO-1 in colon tissue. Results are expressed as mean ± standard error (n=6). p<0.05, p<0.01, p<0.001. Detailed Implementation

[0043] The present invention is described in detail below with reference to the embodiments, but the present invention is not limited to these embodiments. Unless otherwise specified, the raw materials and catalysts in the embodiments of the present invention are all purchased through commercial channels.

[0044] Material: HES (130 / 0.4) was purchased from Wuhan Huazhong University of Science and Technology Life Science Technology Co., Ltd.

[0045] DSS: molecular weight 36–50 kDa, purchased from MP Biosciences.

[0046] Chemical reagents (including IAA, 1-methylimidazole, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) and dimethyl sulfoxide (DMSO)) were all purchased from Shanghai Bide Pharmaceutical Co., Ltd.

[0047] Trypsin (catalog number P7545), pepsin (catalog number P7000) and amylase (catalog number A7095) were purchased from Sigma-Aldrich Chemical Company (St. Louis, Missouri, USA).

[0048] The D-glucose assay kit (K-GLUC) was purchased from Megazyme International (Wicklow, Ireland).

[0049] All other reagents were of analytical grade and were purchased directly from commercial suppliers.

[0050] Female C57BL / 6 mice (approximately 8 weeks old, weighing 17-19 grams) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China).

[0051] All experiments were conducted in accordance with protocols approved by the Animal Ethics Committee of the Shandong Analysis and Testing Center. Throughout the study, mice were housed in a controlled environment with a 12-hour light-dark cycle and had free access to food and water. All animal experiments strictly adhered to the relevant regulations in the National Research Council's "Guidelines for the Care and Use of Laboratory Animals".

[0052] Example 1: Preparation of hydroxyethyl starch-indole-3-acetic acid couplings (HESIAA) with different degrees of substitution 100 g of hydroxyethyl starch (HES, approximately 0.56 mol of dehydrated glucose units) was dissolved in 1 L of DMSO and stirred continuously at 40 °C for 2 hours to obtain a clear, viscous solution. IAA was added at molar ratios of IAA to dehydrated glucose units of 0.5:1, 0.7:1, and 1:1, respectively, along with EDCI and 1-methylimidazole at a molar ratio of IAA:EDCI:1-methylimidazole = 1:1.2:2. The reaction was stirred at room temperature for 24 hours. After the reaction was complete, the reaction solution was slowly added to stirred ethanol to precipitate the solid. The solid was washed successively with ethanol and water, repeated three times, and dried under vacuum at 40 °C to obtain HESIAAs with different degrees of substitution (DS). The synthesis process is as follows. Figure 1 As shown, the results are presented in Table 1. The degree of substitution was determined by... 1 H NMR The determination and calculation formula is: DS = (C × 4) / (A × 5), where C is the signal area of ​​the 5 aromatic protons of the indole ring and A is the signal area of ​​the 4 hydrogens of the glucose ring.

[0053] Nuclear magnetic resonance (NMR) parameters: Starch sample (20 mg) was dissolved in DMSO-d6 (0.6 mL) at 50°C until a clear solution was obtained, then transferred to an NMR sample tube for later use. ¹H spectra were acquired using a Bruker AV III 400 MHz NMR spectrometer, with chemical shift values ​​expressed in ppm (δ). Experimental conditions were: temperature 30°C, pulse angle 30°, delay time 16 seconds, acquisition time 2 seconds, 16 scans per spectrum, and operating frequency 400.13 MHz. The chemical shift region from 4.00 to 5.50 ppm corresponds to the four hydrogen atoms in the anhydrous glucose unit; the five aromatic protons of the indole ring are located in the range of 6.80 to 7.60 ppm.

[0054] Table 1. Results of DS determination in synthesized HESIAA

[0055] Preparation of indole acetylated common corn starch (NMSIAA) 100 g of ordinary corn starch (NMS) was added to 1 L of dimethyl sulfoxide (DMSO) and stirred at room temperature until the solution became clear. Then, indoleacetic acid (IAA), EDCI, and 1-methylimidazole were added to the solution in a molar ratio of 1:1.2:2, and the mixture was stirred at room temperature for 24 hours. The reaction solution was washed four times with ethanol to obtain indole acetylated starch. The indole acetylated starch was then air-dried. The molar ratio of indoleacetic acid to starch was 0.55, and the DS of the prepared NMSIAA was 0.32, which was used as a control sample for subsequent experiments.

[0056] Figure 2The nuclear magnetic resonance spectra of HES and HESIAA at different DS values ​​are shown. 1 In the H NMR spectrum, the anomeric hydrogen signal on the C1 carbon of the anhydrous glucose unit and the hydroxyl (-OH) hydrogen signal both appear in the chemical shift range of 4.5–6.0 ppm; the characteristic peak of the hydroxymethyl proton is located at 4.56–5.10 ppm.

[0057] After IAA acylation, several new peaks were observed in the NMR spectrum of indole acetylated starch compared with HES. These new peaks were attributed to the NH group (10.85 ppm) on the indole ring and its five aromatic hydrogen atoms (7.50, 7.34, 7.25, 7.07 and 6.98 ppm). Figure 2 The characteristic peak changes indicate that IAA has been successfully acylated onto the starch backbone.

[0058] Example 2: FTIR spectra of HES and HESIAA FTIR spectroscopy (Nicolet 710, Thermo Fisher Scientific, Waltham, Massachusetts, USA) was used for scanning analysis. Each starch sample was mixed with potassium bromide at a precise 1:100 mass ratio, thoroughly ground, and then pressed into sheet-like samples under 0.5 MPa pressure. Spectral data were acquired from 400 to 4000 cm⁻¹. - ¹.

[0059] The results are as follows Figure 3 As shown, the characteristic absorption peak in the FTIR spectrum of HES is assigned as follows: 3420 cm⁻¹ - ¹ Corresponds to O–H stretching vibration; 2940 cm - ¹ Corresponding to the C–H stretching vibration of the –CH2 group; 1649 cm⁻¹ - ¹ Corresponds to intramolecular hydrogen bond-related bending vibrations; while 900 to 1200 cm - The broad band between ¹ corresponds to the C–O–C stretching vibration. After IAA acylation, the hydroxyl group is partially replaced by an NH group, resulting in a band at 3420 cm⁻¹ in the FTIR spectrum. - A sharper peak appears at ¹, which is attributed to the N–H stretching vibration. In the HESIAA spectrum, it appears at 1729 cm⁻¹. - The new peak at ¹ (not seen in HES) originates from the carbonyl (C=O) stretching vibration of the introduced indole-3-acetyl group. HESIAA at 1729 cm⁻¹ - The absorption peak intensity at ¹ increases with increasing DS value. Furthermore, at 1459 cm⁻¹... - ¹ and 754 cm -The increased peak intensity at ¹ corresponds to the characteristic aromatic CH stretching vibration of the indole ring in IAA. These spectral changes collectively confirm the successful acylation reaction between IAA and starch.

[0060] Example 3 Thermal stability analysis (TGA) and differential scanning calorimetry (DSC) of HES and HESIAA The thermal stability of starch samples was determined using thermogravimetric analysis (TGA). 4.0 ± 0.1 mg of sample was accurately weighed using a microbalance and placed in a pre-cleaned alumina crucible, then automatically transferred to a sample holder for thermal analysis. The heating temperature range was 30 to 600 °C, with a heating rate of 10 °C per minute. The derivative thermogravimetric (DTG) curve was obtained by calculating the first derivative of the TGA curve.

[0061] HESIAA was analyzed using differential scanning calorimetry (DSC). The test conditions were set as follows: the initial temperature was 25°C, and the sample was heated to 250°C at a constant rate of 10°C / min throughout the heating process, without isothermal holding or cooling cycles.

[0062] Figure 4 The changes in the thermal properties of HES during heating after indole-3-ylacetylation treatment are shown. (TGA curves) Figure 4 Algebraic a) shows that HES exhibits two weight loss phases: the first phase (100–270°C) is related to the evaporation of bound water; the significant weight loss in the second phase (280–450°C) originates from starch decomposition. After acylation treatment, the maximum decomposition temperatures (T0) of the three groups of acylated starches were... max The temperatures were 315.94°C, 322.12°C, and 306.35°C, respectively. Figure 4 (b). Among them, the T values ​​of the HESIAA (DS=0.37) group and the HESIAA (DS=0.50) group were... max The value is slightly higher than that of the HES group (T) max =307.03°C).

[0063] DSC ( Figure 4c) The results showed that all samples exhibited a broad and gradual baseline shift within the 50–100°C range, corresponding to the glass transition process of the amorphous starch phase, which partially overlapped with the endothermic evaporation stage of residual moisture. As the DS value increased, the stepwise shift of the glass transition gradually weakened, indicating that indole acetylation modification restricted the mobility of starch molecular chains, increased the glass transition temperature, and made the transition process smoother. Furthermore, none of the DSC curves for any samples showed obvious sharp endothermic peaks, indicating that these samples had low overall crystallinity, were mainly composed of amorphous structures, and lacked significant melting behavior. The slow rise of the curves above 150°C reflected the pre-endothermic process before the thermal decomposition of the starch backbone; while the curve of the HESIAA sample showed a gentler upward trend, further confirming its excellent thermal stability.

[0064] Example 4: Scanning Electron Microscopy (SEM) Analysis of HES and HESIAA Before scanning electron microscopy (SEM) examination, a gold film with a thickness of approximately 10 nm was formed on the surface of the starch sample by sputter deposition under vacuum. Microstructure analysis was performed using a field emission scanning electron microscope (Supra 55, Zeiss) at an accelerating voltage of 10 kV, employing secondary electron detection technology.

[0065] The morphological characteristics of starch granules were observed using scanning electron microscopy (SEM). Figure 5 (ad). HES starch has a smooth, non-porous surface structure, with granules mainly spherical or irregularly polygonal. After acylation, HESIAA starch granules show varying degrees of breakage and loss of clear edges; HESIAA (DS=0.37) exhibits an irregular blocky structure, a smooth, non-porous surface, and a small specific surface area; while HESIAA (DS=0.53) and HESIAA (DS=0.66) starch have loose surfaces, abundant pores, and an increased specific surface area. The significant morphological changes in acylated starch can be attributed to the combined effects of the chemical modification effect of the acylation reaction and the destructive effect of DMSO solvent on the particle structure. DMSO can break hydrogen bonds, destroy the particle structure, and provide a homogeneous medium for the acylation reaction, ultimately leading to the loss of its native form. In addition, the dense structure and small specific surface area (DS=0.37) of HESIAA limit its contact area with upper digestive tract enzymes, thus avoiding enzymatic hydrolysis and possessing the potential to reach the colon in large quantities.

[0066] Example 5: In vitro digestion experiment of HES and HESIAA Accurately weigh 200 mg of pepsin (≥ 250 U / mg) and slowly add it to 20 mL of 0.05 mol / L hydrochloric acid solution. Stir at low speed for 15 minutes until completely dissolved to prepare a 10 mg / mL solution. Store at 4°C for later use, and restore to 37°C before use. Accurately weigh 4.5 g of pancreatin (≥ 8×USP) and disperse it in 15 mL of deionized water. Shake at 37°C and 150 r / min for 30 minutes to dissolve and activate the enzyme activity. Then centrifuge at 4°C and 5000 r / min for 10 minutes, collect the supernatant (300 mg / mL), and store on ice for later use. Take 10 mL of pancreatin supernatant (300 mg / mL) and slowly add 0.96 mL of glucosidase solution (≥ 260 U / mL). Mix thoroughly to prepare a mixed enzyme system (final pancreatin concentration 250 mg / mL, final glucosidase concentration 25 U / mL), and preheat at 37°C for later use.

[0067] In vitro simulated gastric digestion experiment: 100 mg of different starch samples were accurately weighed and placed in a 50 mL centrifuge tube. 2 mL of pepsin solution (pH 1.30) was added, and the mixture was shaken and incubated at 37°C and 120 r / min for 30 minutes to simulate the in vitro gastric digestion process.

[0068] In vitro simulated intestinal digestion experiment: 200 μL of gastric fluid was transferred to a centrifuge tube pre-filled with 2 mL of anhydrous ethanol, vortexed for 10 seconds to terminate the enzymatic reaction, and stored at 4°C as the 0-minute sample (three biological replicates per group). The preheated (37°C) mixed enzyme solution was added to the remaining gastric fluid system and thoroughly mixed. This mixture was incubated at 37°C and 150 r / min with shaking to simulate the intestinal digestion process. 200 μL gastric fluid samples were collected at 20 and 120 minutes. The reaction was terminated and samples were collected using the same procedure as above, with three parallel replicates at each time point. All samples were centrifuged at 4°C and 3000 r / min for 5 minutes, and the supernatant was collected for subsequent analysis.

[0069] The absorbance of the supernatant was measured at 510 nm using the GOPOD glucose assay kit according to the Englyst in vitro starch digestion kinetics method. Glucose content was calculated strictly according to the kit instructions. Each sample was measured three times, and the average value was used as the final result to ensure the accuracy and reliability of the experimental data. The results are as follows:

[0070]

[0071]

[0072] Where FG represents the free glucose content; G 20 and G 120 These represent the glucose levels measured after 20 minutes and 120 minutes of reaction, respectively; TS refers to the total starch weight.

[0073] Based on the rate and extent of starch digestion, starch can be classified into rapidly digestible starch (RDS), slowly digestible starch (SDS), and resistant starch (RS). Table 3 shows the contents of RDS, SDS, and RS in HES and HESIAA samples: The RDS content in the HES sample was approximately 41.23%, while the SDS and RS contents were 3.82% and 43.56%, respectively. The RDS and SDS contents decreased in the three HESIAA samples with different degrees of substitution. The RS content was positively correlated with the DS value of HESIAA. Compared to HES, when the degree of gelatinization (DS) of HESIAA was 0.37, the resistant starch content increased by 15.40%; when the DS further increased to 0.66, the resistant starch content increased by 17.29%. That is, as the DS increased from 0.37 to 0.66 (an increase of 0.29%), the relative increase in RS content increased from 15.40% to 17.29%, equivalent to an increase of 1.89 percentage points. The introduction of hydrophobic indoleacetyl groups into HESIAA produces a significant steric hindrance effect, effectively shielding the catalytic binding sites of digestive enzymes and starch. This is the main reason for the significant increase in RS content. Furthermore, the RDS, SDS, and RS contents in the comparative NMSIAA differ greatly from those in HESIAA.

[0074] Resinous starch (RS) refers to starch that has not been digested or hydrolyzed in the small intestine and continues to enter the large intestine through intestinal peristalsis. The microbiota colonizing the large intestine then completely or partially degrades it into metabolites such as short-chain fatty acids. Therefore, RS content is a key factor affecting starch digestibility. Compared to the HES group, the RS content of all three HESIAA groups was increased, indicating a higher proportion of resistant starch in the acylated starch and stronger resistance to gastrointestinal digestion. These results demonstrate the potential of HESIAA in achieving targeted colonic delivery of IAA. It should be noted that RS content only reflects the ability of HESIAA to resist gastrointestinal digestion and can serve as a preliminary indicator of its arrival in the colon, but it cannot alone ensure selective ester bond cleavage by microorganisms or controlled IAA release in the colon. IAA release efficiency is also significantly affected by other factors, such as the steric hindrance effect caused by the modified starch chain structure and the accessibility of ester bonds by bacterial esterases.

[0075] Table 3. Digestible starch and resistant starch content in HES, HESIAA, and NMSIAA samples with different DS values.

[0076] Results are expressed as mean ± standard deviation (n = 3). Significant differences (p < 0.05) between means in the same row are indicated by different superscript letters.

[0077] Example 6: In vitro gastrointestinal simulation study of HESIAA Simulated gastric juice (SGF, pH 1.2): Dissolve 2.0 g sodium chloride in 800 mL purified water, add 3.2 g pepsin (stir gently to avoid foaming), adjust the pH to 1.2 ± 0.1 with 1 mol / L hydrochloric acid, dilute to 1000 mL, and prepare fresh before use or store at 4°C for no more than 24 hours. Simulated intestinal juice (SIF, pH 6.8): Dissolve 6.8 g KH₂PO₄ in 800 mL purified water, adjust the pH to 6.8 ± 0.1 with 0.1 mol / L sodium hydroxide, add 10.0 g trypsin (stir gently to avoid foaming), dilute to 1000 mL, and store under the same conditions as SGF. Simulated colonic fluid (SIF-like, pH 7.4): Add 0.2 g peptone, 0.1 g yeast extract, and 0.05 g cysteine ​​to 100 mL of purified water. Adjust the pH to 6.0 for sterilization. Add 10% filtered fecal bacterial suspension and rinse with nitrogen before use. Sample preparation: Mix 1 g starch / modified starch with 10 mL of purified water. Gastric digestion test: Mix 10 mL of sample suspension with 20 mL of SGF, adjust the pH to 3.0, and incubate with shaking at 37°C and 150 rpm for 2 hours. Intestinal digestion test: Add an equal volume of SIF, adjust the pH to 7.0 with dilute sodium hydroxide, incubate under the same conditions for 2 hours, and centrifuge at 8000 r / min for 10 minutes. The precipitate is the resistant starch residue. Colonic fermentation: Add colonic fermentation broth (solid-liquid ratio 1:10) to the residue, rinse with nitrogen for 5 minutes to remove oxygen, seal, and anaerobic incubate at 37°C for 24 / 48 hours. Samples are taken periodically for boiling sterilization and centrifugation analysis. The IAA release rate is calculated as follows:

[0078]

[0079] Where W1 is the total content of the sample, m1 represents the total release of IAA, C1 is the concentration of IAA, and V1 is the volume of the reaction solution added. 180 represents the molecular weight of hydroxyethyl starch; 175 is the molecular weight of hydroxyethyl; 157 is the molecular weight of hydroxyethyl minus one hydroxyl group; and 1 indicates the removal of one hydrogen atom.

[0080] Using a simulated gastrointestinal fluid system ( Figure 6The in vitro IAA release behavior and structural stability of HESIAA carriers with different drug loadings (DS) were systematically studied. The total IAA released by HESIAA (DS=0.37), HESIAA (DS=0.53) and HESIAA (DS=0.66) were 11.3 mg, 16.4 mg and 19.2 mg, respectively. Release curves showed that the initial drug release amounts of the three formulations in the stomach were 0.26±0.54 mg, 0.33±0.23 mg, and 0.24±0.05 mg, respectively, effectively inhibiting premature drug leakage in the acidic gastric environment. After entering the intestinal tract, all groups showed sustained drug release, and the release kinetics were correlated with the DS value: the formulation with a DS of 0.37 had the fastest release rate, with a final cumulative release rate of 86.58% (11.37±0.45 mg); while the formulations with DS of 0.53 and 0.66 achieved stable and controllable drug release, with final cumulative release rates of 70.70% and 69.35%, respectively.

[0081] This difference is attributed to the influence of substitution degree on the hydrophilic-lipophilic balance and enzyme sensitivity of the carrier matrix. Carriers with low substitution degrees are more prone to swelling and accelerated enzymatic hydrolysis, thus promoting drug release; while high substitution degrees enhance hydrophobic interactions, improve structural stability, limit drug diffusion, and delay the release process. Stability tests in simulated gastrointestinal fluids show that the HESIAA carrier maintains its intact structure in acidic gastric fluid, protecting the encapsulated drug from acid degradation and premature release; in a neutral intestinal environment, the carrier gradually swells and undergoes enzymatic degradation. The high substitution degree samples exhibit better structural integrity, consistent with their sustained-release properties.

[0082] In summary, HESIAA carriers exhibit excellent gastrointestinal stability and responsive release to pH and enzyme stimulation. They can protect drugs in the stomach and achieve controlled drug release in the intestine, thus showing great potential as targeted delivery carriers for the treatment of ulcerative colitis.

[0083] Example 7: HESIAA In Vivo Colon-Targeted Delivery Experiment To assess the effect of DS on the efficiency of HESIAA-mediated colonic-targeted delivery of IAA, mice were randomly divided into five groups (n=6 per group) after one week of environmental acclimatization: the HES group, HESIAA groups with different DS values ​​(fed with diets supplemented with 1.0% (w / w) HESIAA and DS values ​​of 0.37, 0.53, and 0.66, respectively), and the IAANa group (provided with 1.77 mg / mL IAANa in drinking water). The sample size of n=6 per group was determined based on existing literature on DSS-induced colitis mouse models. Multiple published studies have shown that n=6 per group is sufficient to detect clinically relevant differences in disease activity indices, histological scores, and inflammatory markers with acceptable statistical power. Dietary composition is detailed in Table 4. After seven days of continued feeding, fecal samples were aseptically collected for gut microbiota analysis; subsequently, mice were sacrificed, and colonic contents and portal vein blood samples were collected for IAA detection. The supernatant of the portal vein blood sample was collected by centrifugation at 4,000×g for 8 minutes at 4°C and stored at -20°C.

[0084] Table 4 shows the experimental feed formulation based on AIN-93G (g / kg feed).

[0085] IAA content was determined by ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS), following the method described in previous literature. The preparation steps for the required reagents were as follows: For serum analysis, 100 μL of sample was taken and 12.5 μL of 20 ppm IAA-d5 internal standard solution was added; after incubation for 30 minutes, 900 μL of extraction buffer was added, and the mixture was thoroughly vortexed and sonicated for 15 minutes; the reaction solution was then centrifuged at 10,000 rpm for 10 minutes at 4°C, and the supernatant was carefully collected for subsequent analysis. For fecal analysis, 50 mg of sample was accurately weighed and mixed with 12.5 μL of the same internal standard mixture, followed by incubation for 30 minutes. Then, 500 μL of extraction buffer was added, and the mixture was transferred to a homogenizing tube and homogenized using a tissue homogenizer for 1 minute. After homogenization, the sample was sonicated for 10 minutes and centrifuged at 10,000 rpm for 10 minutes at 4°C. The supernatant was collected. The entire fecal extraction process was repeated twice, and all supernatants were combined for subsequent analysis.

[0086] The sample was purified by activating an Oasis HLB solid-phase extraction column with 4 mL of methanol and 4 mL of water. The resulting 600 μL extract was further purified and enriched using an activated Oasis HLB (3 cc / 60 mg) solid-phase extraction column. The column was then washed with 4 mL of water and dried. A 15 mL conical centrifuge tube was placed under the column, and 3 mL of eluent was collected for elution. The eluent was collected, thoroughly mixed, filtered through a 0.22 μm sterile membrane filter, and then analyzed by UPLC-MS / MS. The filtered analytes were separated chromatographically using an acuity UPLC® BEH C18 reversed-phase column (2.1 × 50 mm, 1.7 μm). Data were acquired by UPLC-MS / MS in positive ion scan (ESI+) mode and quantified using isotope internal standard method.

[0087] HESIAA degree of substitution (DS) has a dual regulatory effect on resistant starch (RS) content and colonic IAA release efficiency, with significant quantitative correlations among groups. Experimental mice were fed diets containing 1.0% HESIAA with different DS values ​​(Table 3), and colonic IAA levels were measured by UPLC-MS / MS. As shown in Table 1, acylation treatment significantly increased the RS content in natural HES from 43.56% to 60.85%, confirming that chemical modification effectively enhances its tolerance to upper gastrointestinal digestion. RS content increased slightly with increasing DS and then stabilized, rising slightly from 58.96% HESIAA (DS=0.37) to 60.85% HESIAA (DS=0.66). In contrast, colonic IAA concentration showed a completely opposite trend. Figure 7 (a) The HESIAA group (DS=0.37) achieved the maximum accumulation of IAA in the colon at 581.5 μmol / kg; while the higher DS groups (0.53 and 0.66), despite having slightly higher RS ​​content, showed significantly lower IAA release levels of 182.8 μmol / kg and 274.7 μmol / kg, respectively.

[0088] To ensure the validity of pharmacokinetic and biological comparisons, both the HESIAA group (DS=0.37) and the free IAANa group used strictly equivalent IAA doses. Under the same IAA administration conditions, the colonic IAA concentration in the IAANa group was significantly lower than that in the HESIAA group (DS=0.37). HESIAA effectively resists digestion in the upper gastrointestinal tract and targets the colon; here, gut microbiota-mediated fermentation cleaves the carrier and releases IAA. In contrast, orally administered IAANa is mainly absorbed in the upper gastrointestinal tract, resulting in negligible colonic accumulation and low local bioavailability. The IAA content in the colon is significantly higher than that in the stomach and small intestine. Figure 7(b) further confirms HESIAA's excellent colon-targeting ability.

[0089] These findings indicate that steric retardation (RS) is a necessary but not sufficient condition for efficient colonic IAA delivery. Colonic targeting performance and drug release efficiency are both regulated by steric retardation (DS) – DS balances the gastrointestinal stability, enzymatic accessibility, and steric hindrance caused by substituents resulting from RS. At a DS value of 0.37, HESIAA exhibits optimal RS content, preventing premature drug degradation in the upper gastrointestinal tract; its moderate indoleacetyl grafting density minimizes steric hindrance, allowing the drug to fully bind to colonic microbial esterases and achieve efficient ester bond hydrolysis, thereby maximizing local IAA release. The released IAA can penetrate the colonic mucosa and enter the portal circulation, thus giving HESIAA excellent colonic targeting performance and bioavailability.

[0090] Although high-DS HESIAA formulations (0.53 and 0.66) deliver more carrier to the colon due to their higher RS ​​content, the densely grafted indoleacetyl groups induce significant steric hindrance. This not only inhibits substrate-enzyme interaction but also significantly reduces the hydrolysis and release efficiency of IAA. Therefore, despite higher carrier retention in the colon, the colonic IAA concentration and bioavailability of the high-DS formulations are far lower than those of the DS=0.37 group. In conclusion, DS=0.37 has been proven to be the optimal substitution degree for achieving a perfect balance between gastrointestinal stability and microbiota-responsive colonic drug release of HESIAA.

[0091] Example 8: Effects of HESIAA on the gut microbiota Microbial community DNA was purified using the EZNA® Soil DNA Kit (Omega Bio-tek, GA, USA) according to the manufacturer's instructions. DNA quality was confirmed by 1% agarose gel electrophoresis and a NanoDrop 2000 quantification system. The V3-V4 region of the bacterial 16S rRNA gene was amplified using primers 338F / 806R under the following PCR conditions: 95°C pre-denaturation for 3 min; 27 cycles (95°C 30 s, 55°C 30 s, 72°C 45 s); and a final extension at 72°C for 10 min. Equimolar amounts of amplicon libraries were constructed after purification and sequenced on an Illumina MiSeq PE300 platform from Shanghai Hongsen Biotechnology Co., Ltd. Bioinformatics processing included: using Vsearch v2.22.1 software to cluster sequences into operational taxonomic units (OTUs) with a similarity of ≥97%, comparing them with the SILVA138 database using the RDP classifier (confidence ≥0.7), and performing dilution correction on the OTU table to meet the needs of subsequent comparative analysis.

[0092] Comparative analysis of 16S rRNA sequencing results showed that the microbial composition of the HESIAA group differed significantly from that of the HES group. Researchers assessed the α- and β-diversity of the gut microbiota in the HES, HESIAA, and IAANa groups. Figure 8 (a) and (b). α-diversity was measured using the Chao1, Ace, Shannon, and Simpson indices: the Chao1 and Ace indices assessed species richness (reflecting the total number of different species in the sample), while the Shannon and Simpson indices more sensitively reflected the species homogeneity of the gut microbiota. Results showed that the Chao1 and Ace indices of the HESIAA group were higher than those of the HES and IAANa groups, indicating that this group had the richest microbial diversity and the highest community richness. The Shannon and Simpson indices of the HESIAA group were slightly lower than the other two groups, indicating that while its species richness was high, its homogeneity was lower. This may be related to the higher IAA intake in the HESIAA group, leading to IAA's relative dominance in the gut and affecting the evenness of the microbial community. β-diversity analysis showed significant mixing between the IAANa and HES groups, and slight overlap between the HESIAA and HES groups. Overall, acylated HESIAA had a significant impact on the mouse gut microbiota.

[0093] To gain a deeper understanding of the consistency or differences in species composition among different sample groups, Venn diagrams were used. Figure 8 (c) Visually displays the corresponding counts of common and unique OTUs in the gut microbiota of each group of mice. The results indicate that increased IAA concentration in the colon alters the richness and diversity of the gut microbiota.

[0094] Previous studies have indicated that Firmicutes and Bacteroidetes are the dominant microbial phyla in fecal microbiota transplantation preparations. Bacteroidetes can respond to inflammatory stimuli through multiple mechanisms, assisting the host in responding to immune responses and maintaining the balance of the body's immune system.

[0095] At the gate level ( Figure 9In the HESIAA group (a), compared with the HES group, the relative abundance of Firmicutes was decreased, while the relative abundance of Bacteroidetes and Proteobacteria was increased. Bacteroidetes play a crucial role in gut health through various key functions. They specifically utilize multiple enzymes to break down complex carbohydrates and dietary fiber, thereby producing short-chain fatty acids (SCFAs) such as acetic acid and propionic acid. These SCFAs help regulate immune function, strengthen the intestinal barrier, and modulate host metabolism. The results indicate that HESIAA treatment can regulate the relative abundance of several major bacterial phyla in the mouse gut microbiota, thereby effectively restoring microbial homeostasis and promoting host health. At the genus level (a) Figure 9 In group b), compared to the HES group, HESIAA treatment increased the abundance of S24-7 while decreasing the abundance of Peptostreptococci, Clostridium, and Bacteroidetes. In summary, HESIAA treatment increased the abundance of beneficial bacteria (including S24-7 and Bacteroidetes) while inhibiting inflammation-associated pathogens (such as Peptostreptococci and Clostridium). In contrast, NMSIAA treatment had different effects on the gut microbiota. Bifidobacterium, Adlerklutz, Spirulina, Prevotella, Odorobacterium, and Christensenella were all beneficial gut bacteria, with significantly increased abundance, while Kestrel and Staphylococcus, known pathogens, showed decreased abundance.

[0096] This regulatory mechanism may help maintain gut antimicrobial immune function and alleviate microbiome-related immune dysfunction. Researchers used clustering heatmaps (…) Figure 9c) analyzed the 50 bacteria with the highest relative abundance at the genus level. The relative abundance of some bacteria varied between different groups. For example, beneficial colonic microbiota such as Bifidobacterium, Adlercreutzia, Spirulina oscillationis, and Odorobacterium play important roles in gut health. Notably, the study found a significantly higher abundance of Bifidobacterium—a microbiota known for improving gut integrity, enhancing immunity, and producing short-chain fatty acids (SCFAs). The abundance of Adlercreutzia, which specifically metabolizes dietary phytoestrogens (such as soy isoflavones), was also significantly increased. Furthermore, the number of genera associated with the production of beneficial SCFA butyrate (such as Oscillospira and Odoribacter, which are crucial for colonic health and metabolic homeostasis) was significantly increased. These changes in microbial community structure collectively suggest that HESIAA intervention may create a gut environment conducive to promoting SCFA production, improving metabolic health, and enhancing host immunity. Compared to the HES group, the relative abundance of these bacterial species was significantly increased in the HESIAA group; while the numbers of pathogenic bacteria such as Bifidobacterium, Kaisobacter, and Staphylococcus were reduced to varying degrees in the acylated starch group. Metabolites such as IAA and short-chain fatty acids produced through slow fermentation can exert beneficial anti-inflammatory and mucosal repair effects on the intestinal environment.

[0097] Example 9: The effect of HESIAA on improving DSS-induced colitis in mice. To evaluate the potential of HESIAA in the treatment of ulcerative colitis (UC), mice were randomly divided into four groups (n=6 per group) based on their pre-intervention body weight: control group, DSS group, HESIAA group, and IAANa group. The HESIAA group was fed a diet supplemented with 1.0% (w / w) HESIAA (DS=0.37), while the IAANa group received IAANa (1.77 mg / mL) via drinking water to match the continuous IAA administration in the HESIAA group. Mice in the DSS, HESIAA, and IAANa groups drank drinking water containing 2.0% (w / v) DSS for six consecutive days. Figure 10 (a) Body weight changes were monitored daily during the experiment. At the end of the experiment, colon length, disease activity index (DAI), spleen coefficient, and pathological changes in colonic tissue were assessed. Based on our institution's animal care guidelines and previous studies of DSS-related colitis, the following humanitarian endpoints were pre-defined: weight loss exceeding 20% ​​of initial body weight, severe rectal bleeding or prolapse, or a near-death state. Any mouse reaching any of these endpoints was immediately euthanized and excluded from the analysis. No animals meeting these criteria were found during the study.

[0098] After confirming that HESIAA can significantly improve microbial diversity, we further evaluated its therapeutic effect in a DSS-induced mouse colitis model. Figure 10 In the specific experiment, mice were pretreated with either HESIAA or IAANa for 7 days before being given drinking water containing 2% (weight / volume) DSS to induce colitis. Figure 10 (a). The establishment of a DSS-induced ulcerative colitis model was confirmed by changes in body weight: the HESIAA group significantly alleviated DSS-induced weight loss, while the IAANa group receiving continuous IAANa showed no significant improvement. Figure 10 (b); The Disease Activity Index (DAI) score of the DSS group was significantly higher than that of the HES group ( Figure 10 (c). Notably, HESIAA treatment significantly improved this pathological condition, with DAI scores far lower than the DSS-induced group. Histopathological scores were also significantly reduced in the HESIAA treatment group ( Figure 11 (d). In addition, the spleen ratio in the HESIAA group ( Figure 10 The colon length (e) was also significantly lower than that in the DSS and IAANa groups. To assess the severity of colitis, we measured the colon length: as shown in Figure 1. Figure 10 As shown in f and g, the colon length of mice in the DSS-induced group was significantly shorter than that in the HES group; while the colon length in the HESIAA-treated group was significantly restored.

[0099] Figure 10 The results of histopathological analysis of colon tissue using H&E staining are presented in Figure h. The HES group showed a normal colonic structure, characterized by intact mucosal epithelium, tightly connected epithelial cells, well-defined and orderly arranged crypts, abundant goblet cells, and no significant pathological changes. In contrast, the DSS model group showed severe mucosal damage, manifested as epithelial structure destruction, crypt structure disappearance, significantly reduced goblet cell number, accompanied by obvious inflammatory cell infiltration and submucosal edema. The HESIAA group showed significant improvement in colitis pathology, with reduced mucosal defects, restored epithelial integrity, enhanced goblet cell secretory function, mild crypt damage, and reduced inflammatory cell infiltration. The IAANa group showed moderate improvement, manifested as partial mucosal interruption, mild crypt destruction, and limited inflammatory cell infiltration and edema.

[0100] Example 10: HESIAA alleviates DSS-induced colitis in mice by inhibiting inflammation and enhancing the intestinal barrier. A suitable amount of colon tissue was placed in pre-chilled PBS (0.01 M, pH = 7.4) buffer to remove blood and feces. After washing and weighing, PBS (w / v ratio 1:30) was added, and the tissue was homogenized using an automated sample homogenizer. The sample was then centrifuged at 4°C, 10,000 rpm for 15 minutes. The collected supernatant was used to determine the concentrations of IL-10, IL-22, IL-6, and IL-1β using ELISA, following the procedures provided in the kit. All samples were analyzed for each cytokine in three independent wells. Quantitative analysis was performed using the mean optical density (OD) value. The coefficient of variation (CV) between replicates was consistently below 10%, indicating good intra-assay precision.

[0101] Total RNA was isolated from colon tissue using the SparkJade RNA extraction kit. The isolated RNA was reverse transcribed into cDNA using SparkJade cDNA first-strand synthesis premix, followed by quantitative PCR amplification using SYBR Green qPCR mixture (SparkJade). Gene expression levels were determined by the ΔΔCt method, with GAPDH as an internal control

[45] . The primer sequences for actin, IL-10, IL-1β, and IL-6 are shown above; the primer sequences for the mouse genes (5′ to 3′ directions) are as follows: β-actin: forward gtgacgttgacatccgtaaaga, reverse gccggactcatcgtactcc; IL-1β: forward gaaatgccaccttttgacagtg, reverse tggatgctctcatcaggacag; IL-6: forward ctgcaagagacttccatccag, reverse agtggtatagacaggtctgttgg; IL-10: forward cttactgactggcatgaggatca, reverse gcagctctaggagcatgtgg.

[0102] Data are expressed as mean ± standard deviation (SD). The data are normally distributed according to the Shapiro-Wilk and Kolmogorov-Smirnov tests. For comparisons involving three or more groups, one-way ANOVA was used, with a p-value < 0.05 considered statistically significant; for comparisons between only two groups, an independent samples two-tailed Student's t-test was used, with significance levels denoted as p < 0.05, p < 0.05, and p < 0.05, respectively. P<0.01 P < 0.001. All statistical analyses were performed using GraphPad Prism software.

[0103] like Figure 11 As shown in the figure, compared with the DSS group, HESIAA treatment significantly increased the levels of anti-inflammatory cytokines IL-10 and IL-22 in colonic tissue, while decreasing the levels of pro-inflammatory cytokines IL-1β, IL-6, and IFN-γ. At the mRNA level ( Figure 11 In the DSS group, the mRNA expression of pro-inflammatory cytokines IL-1β and IL-6 was significantly upregulated, while the mRNA expression of anti-inflammatory cytokine IL-10 was significantly downregulated. HESIAA treatment effectively reversed these changes, showing superior efficacy compared to IAANa. These results collectively indicate that HESIAA possesses potent anti-inflammatory activity: it can effectively inhibit the expression of pro-inflammatory mediators and promote the expression of anti-inflammatory cytokines, thereby alleviating the DSS-induced inflammatory response in mouse colon tissue.

[0104] Tight junctions, primarily composed of the ZO family, Claudin family, and junctional adhesion molecule families, constitute the main intercellular connections between intestinal epithelial cells. These structures play a crucial role in preventing the invasion of external pathogens and are essential for maintaining the physiological function of epithelial cells. Figure 11 As shown in Figure i, the expression of Claudin1 and ZO-1 proteins was significantly reduced in the DSS group. This decrease indicates structural disruption of the tight junction complex, leading to impaired intestinal barrier function, secondary immune damage, and exacerbation of colitis. In contrast, the expression of both Claudin1 and ZO-1 was upregulated in the HESIAA group, suggesting a protective effect on the intestinal mucosal barrier; while no significant improvement was observed in the IAANa group.

[0105] The dosage of IAANa was calculated based on the IAA content in HESIAA to ensure that the daily IAA intake per mouse was completely consistent in both treatment groups. While HESIAA enables sustained colonic release of IAA, IAANa promotes rapid systemic absorption. This design allows for a biologically meaningful comparison of the effects of targeted colonic delivery versus systemic IAA delivery at the same IAA dosage. Traditional IAA administration methods (such as adding IAANa to drinking water) have limited effectiveness in improving colitis due to low colonic targeting efficiency and poor bioavailability. In contrast, HESIAA, through targeted colonic release of IAA, significantly alleviated DSS-induced colitis symptoms in mice: it promoted the production of anti-inflammatory cytokines and enhanced intestinal barrier function; it also modulated the gut microbiota by reducing the fecal / blood ratio, increasing the number of beneficial bacteria, and inhibiting pathogenic strains. Furthermore, the tolerant starch component in HESIAA undergoes a slow fermentation process, stimulating the growth of SCFA-producing bacteria (such as *Helicobacter pylori* and *Odorobacter olfels*). The resulting short-chain fatty acids (especially butyrate) can work synergistically with IAA to maintain intestinal ecological balance and immune homeostasis.

[0106] The above description is merely an embodiment of the present invention, and the scope of protection of the present invention is not limited to these specific embodiments, but is determined by the claims of the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the technical concept and principle of the present invention should be included within the scope of protection of the present invention.

Claims

1. A hydroxyethyl starch-indole-3-acetic acid coupling compound, characterized in that, The degree of substitution of the hydroxyethyl starch-indole-3-acetic acid coupling compound is 0.05-0.

70.

2. The hydroxyethyl starch-indole-3-acetic acid coupling compound according to claim 1, characterized in that, In the hydroxyethyl starch-indole-3-acetic acid coupling compound, hydroxyethyl starch and indole-3-acetic acid are linked by chemical bonds, preferably by ester bonds.

3. A composition, characterized in that, The composition comprises the hydroxyethyl starch-indole-3-acetic acid conjugate of claim 1 or 2, and a pharmaceutically acceptable carrier or excipient.

4. A method for preparing the hydroxyethyl starch-indole-3-acetic acid coupling compound according to claim 1 or 2, characterized in that, The method includes the following steps: dissolving hydroxyethyl starch in a solvent, adding indole-3-acetic acid, a base and a condensing agent, stirring the reaction at room temperature, and after the reaction is completed, adding the reaction solution to ethanol to precipitate, separating, washing and drying to obtain the final product.

5. The method according to claim 4, characterized in that, The molar ratio of indole-3-acetic acid to dehydrated glucose units in hydroxyethyl starch is (0.05-2.0):

1.

6. The method according to claim 4, characterized in that, The solvent includes at least one of DMSO, ionic liquid, and water; And / or, the condensing agent comprises at least one of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), N,N'-dicyclohexylcarbodiimide (DCC), and 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (HATU); And / or, the base includes at least one of 1-methylimidazole, amines, sodium bicarbonate, and sodium carbonate.

7. The method according to claim 4, characterized in that, The molar ratio of the condensing agent to indole-3-acetic acid is (1-2):1; and / or, the molar ratio of the base to indole-3-acetic acid is (1-4):

1.

8. The use of the hydroxyethyl starch-indole-3-acetic acid coupling of claim 1 or 2 or the composition of claim 3 in any of the following aspects: A1. Application in the preparation of products for colon-targeted delivery of indole-3-acetic acid; A2. Applications in the preparation of products that regulate gut microbiota; A3. Application in the preparation of products for repairing intestinal mucosa; A4. Applications in the preparation of products for inflammatory diseases, autoimmune diseases, and metabolic diseases; A5. Applications in the preparation of products for the prevention and / or treatment of colitis; A6. Applications in regulating inflammation, metabolism, and immunity in the body.

9. The application according to claim 8, characterized in that, The products include pharmaceuticals, health foods, foods for special medical purposes, or ordinary foods.

10. The application according to claim 8, characterized in that, The inflammatory disease is colitis, and more specifically, ulcerative colitis.

Images