Schizochytrium transcription factor tf7668 and application thereof

Abstract

The application discloses a schizochytrium transcription factor TF7668 and application thereof. The TF7668 accelerates the accumulation of schizochytrium oil by promoting the de novo biosynthesis of fatty acids, enhancing the generation of reducing power NADPH and promoting the storage of ultra-long chain fatty acids in TAG. By overexpressing key transcription factors, various important metabolic pathways are regulated, and the method for rapidly obtaining schizochytrium strains with excellent traits is obtained.

Description

Technical Field

[0001] This invention belongs to the field of metabolic engineering technology, specifically relating to a Schizochytrium transcription factor TF7668 and its applications. Background Technology

[0002] Docosahexaenoic acid (DHA) is an essential fatty acid that the human body cannot synthesize, but which is highly beneficial to human health and has been a hot topic of scientific research in recent years. Clinical trials have shown that DHA is a major component for the growth and maintenance of nerve cells and an important component of the brain and retina. It accounts for up to 20% of the human cerebral cortex and approximately 50% of the retina. Therefore, DHA plays a vital role in the development of the nervous system and vision in infants and young children, and also has effects such as preventing cardiovascular disease and anti-inflammatory and anti-tumor properties. It has been reported that the Dutch company DSM sells at least 2,000 tons of DHA annually, with total sales of nearly $317 million. Therefore, DHA has a very broad application prospect.

[0003] The primary source of DHA is marine fish, but these fish accumulate large amounts of heavy metals and organic pollutants, which are unhealthy for humans. In recent years, researchers have done much work in finding sustainable, high-quality alternative sources of DHA. Among these efforts, heterotrophic fermentation of marine microalgae to produce DHA has been considered a major alternative method. *Schizochytrium* is a DHA-rich microalga and currently the most widely used algal strain in DHA fermentation production. The advantages of *Schizochytrium* in DHA production are: rapid growth rate, high final biomass, and relatively high DHA yield. Internationally reported highest yields are 200 g / L dry cell weight and 40-45 g / L DHA after 90-100 hours of cultivation. Currently, many domestic institutions have screened and obtained excellent *Schizochytrium* strains, completed high-density fermentation and pilot-scale expansion experiments, and promoted the rapid development of the entire industry.

[0004] Currently, the strains used in the fermentation production of Schizochytrium have problems with low oil and DHA content, and their characteristics are prone to degeneration during fermentation. Therefore, it is crucial to utilize effective technical means to modify Schizochytrium and obtain high-yielding and genetically stable superior strains to promote the sustainable development of the Schizochytrium DHA production industry.

[0005] Transcription factors (TFs) possess unique advantages in multi-point and dynamic regulation, enabling comprehensive, efficient, and specific control of target metabolic pathways, thus serving as powerful tools for modifying microbial metabolic pathways. Transcription factor-based engineering strategies have been widely applied and developed in the field of metabolic engineering, including utilizing global transcriptional mechanical engineering, implementing transcription factor-based biosensors, applying quantitative sensing systems for dynamic regulation, and constructing artificial transcription factors. In the field of microalgae, due to the relatively immature gene operating system and lack of understanding of transcriptional regulatory mechanisms, research on transcription factor-based engineering strategies has been limited to overexpressing or knocking out single regulatory factors, and has focused on two species: *Chlamydomonas reinhardtii* and *Microcystis aeruginosa*.

[0006] Transcription factor engineering can comprehensively regulate multiple genes across multiple pathways through single-gene manipulation, making it a highly promising approach to further enhance fatty acid synthesis in Schizochytrium. However, there is a lack of research on predicting the transcriptional regulatory network in Schizochytrium, and reports on the experimental characterization and identification of transcription factors and their regulatory mechanisms are relatively few. Therefore, discovering fatty acid synthesis-related transcription factors in Schizochytrium and applying them to enhance lipid production is of great significance. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a Schizochytrium transcription factor TF7668 and its applications. TF7668 accelerates lipid accumulation in Schizochytrium by promoting de novo fatty acid biosynthesis, enhancing the generation of reducing NADPH, and promoting the storage of very long-chain fatty acids in TAGs. A method for rapidly obtaining Schizochytrium strains with superior traits is also provided by overexpressing key transcription factors and regulating multiple important metabolic pathways.

[0008] This invention is achieved through the following technical solution:

[0009] This invention provides a Schizochytrium transcription factor TF7668, the amino acid sequence of which is shown in SEQ ID NO.1.

[0010] In a second aspect, the present invention provides a gene encoding the transcription factor TF7668 described in the first aspect.

[0011] The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0012] Thirdly, the present invention provides an expression cassette or recombinant vector containing the gene described in the second aspect.

[0013] Fourthly, the present invention provides recombinant bacteria comprising the expression cassette or recombinant vector described in the third aspect.

[0014] The recombinant bacteria originating from *Schizochytrium* is preferred. *Schizochytrium* sp. ATCC 20888 is preferred.

[0015] Fifthly, the present invention provides a method for constructing the recombinant bacteria as follows: an expression cassette or recombinant vector encoding the transcription factor TF7668 is introduced into the starting bacteria to obtain the bacteria.

[0016] Preferably, the method for constructing the recombinant bacteria is as follows:

[0017] An expression cassette for transcription factor TF7668 was constructed. Using Schizochytrium ATCC 20888 as the starting strain, the constructed expression cassette for transcription factor TF7668 was transformed into the bacterial cells to obtain a recombinant strain.

[0018] Preferably, the expression cassette of the transcription factor TF7668 includes a TEF1 promoter, a gene sequence encoding the transcription factor TF7668 described in the first aspect, a CYC1 terminator, and a G418 resistance gene expression cassette.

[0019] Preferably, the G418 resistance gene expression cassette includes: a G418 resistance gene, with a CaMV 35S promoter ligated upstream and a CAMV poly(A) signal ligated downstream via overlap extension PCR. Both components are synthesized by a gene synthesis company to obtain the G418 resistance gene expression cassette.

[0020] In a sixth aspect, the present invention provides the application of the recombinant bacteria described in the fourth aspect in the fermentation production of fatty acids.

[0021] Preferably, the recombinant bacteria are used in the fermentation production of DHA.

[0022] In the above technical solution, the recombinant bacteria are inoculated into an enrichment culture medium for fermentation.

[0023] In the above technical solution, the enrichment culture medium is: glucose 40g / L, yeast extract 0.8g / L, Na2SO4 10g / L, (NH4)2SO4 0.8g / L, KH2PO4 4g / L, KCl 0.2g / L, MgSO4·7H2O 4.11g / L, sodium glutamate 20g / L, CaCl2·2H2O 0.13g / L, FeSO4 0.58mg / L, MnCl2 5.2mg / L, ZnSO4 5.2mg / L, CuSO4 0.8mg / L, NiSO4 0.8mg / L, CoCl2 0.066mg / L, vitamin B1 0.152mg / L, vitamin B12 0.24mg / L, calcium pantothenate 0.512mg / L, and NaMoO4 0.016mg / L.

[0024] The advantages and beneficial effects of this invention are as follows:

[0025] The inventors of this invention identified six potential target genes for TF7668 in Schizochytrium ATCC 20888 through endogenous transcription factor DAP-seq screening and qRT-PCR verification: genes encoding very long chain acyl-CoA synthase (VLACS), malonyl-CoA-acyltransferase (MAT), glucose-6-phosphate dehydrogenase (G6PD), acetyl-CoA acetyltransferase (ACAT), NAD kinase (NADK), and 3-ketoacyl-acyltransferase (KAS). Analysis of the biological functions of these potential target genes concluded that TF7668 accelerates lipid accumulation in Schizochytrium by promoting de novo fatty acid biosynthesis, enhancing the production of reducing NADPH, and promoting the storage of very long chain fatty acids in TAG.

[0026] This invention provides a method for rapidly obtaining Schizochytrium strains with superior traits by overexpressing key transcription factors and regulating multiple important metabolic pathways. The Schizochytrium mutant strain obtained using this method exhibits a 34% increase in the proportion of total fatty acids to cell dry weight and a 31% increase in the proportion of DHA to cell dry weight after 60 hours of shake-flask fermentation. Attached Figure Description

[0027] Figure 1 Images of the TF7668 expression cassette and transformants for verification; among which:

[0028] Figure 1 A is a schematic diagram of the expression cassette of the endogenous transcription factor TF7668 in Schizochytrium, where: 1: CaMV 35S promoter; 2: G418 resistance gene; 3: CAMV poly(A) signal; 4: TEF1 promoter; 5: gene sequence encoding transcription factor TF7668; 6: CYC1 terminator; P1: primer 1; P2: primer 2; P3: primer 3; P4: primer 4.

[0029] Figure 1 B represents PCR verification using primers 1 and 2, where: M: 1kb marker; 2: TF7668 overexpressing strain 7668-2; 7: TF7668 overexpressing strain 7668-7; 8: TF7668 overexpressing strain 7668-8; P: positive control; WT: starting strain Schizochytrium ATCC 20888; N: negative control.

[0030] Figure 1 C represents the use of primers 3 and 4 to perform RT-PCR to verify the relative expression levels of transcription factor TF7668 in the three transformants, where: 7668-2: TF7668 overexpressing strain 7668-2; 7668-7: TF7668 overexpressing strain 7668-7; 7668-8: TF7668 overexpressing strain 7668-8; WT: originating strain Schizochytrium ATCC 20888.

[0031] Figure 2 Fermentation evaluation of the starting strain Schizochytrium ATCC 20888 and the transcription factor TF7668 overexpressing strain 7668-8; (a) total fatty acid content analysis, (b) DHA content analysis; where: 7668-7: TF7668 overexpressing strain 7668-7; 7668-8: TF7668 overexpressing strain 7668-8; WT: starting strain Schizochytrium ATCC 20888.

[0032] For those skilled in the art, other related figures can be obtained from the above figures without any creative effort. Detailed Implementation

[0033] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be further described below with reference to specific embodiments.

[0034] Example 1

[0035] Preparation process of recombinant Schizochytrium strains overexpressing transcription factor TF7668

[0036] 1. The gene encoding transcription factor TF7668 (SEQ ID NO. 2) was amplified from the genome of Schizochytrium ATCC 20888. The TEF1 promoter and CYC1 terminator were amplified from the pPICZαA plasmid. After forming an expression cassette, it was fused with the G418 resistance gene expression cassette to form the expression cassette of transcription factor TF7668. The specific structure is shown in the appendix. Figure 1 A.

[0037] The preparation process of the G418 resistance gene expression cassette is as follows: The G418 resistance gene, CaMV 35S promoter, and CAMVpoly(A) signal were directly synthesized by a gene synthesis company. In the laboratory, the CaMV 35S promoter was ligated upstream of the G418 resistance gene and the CAMVpoly(A) signal was ligated downstream using overlap extension PCR to obtain the G418 resistance gene expression cassette. The G418 resistance gene sequence has been published in multiple sequences in GenBank, for example: GenBank Sequence ID: KT992772.1, 9048~9845.

[0038] 2. Using *Schizochytrium* sp. ATCC 20888 (purchased from the American Type Culture Collection (ATCC)) as the starting strain, cells were cultured for two generations in enrichment medium. Seed cells in the logarithmic growth phase were selected and treated with 15 g / L sea salt and 5% PEG 8000, respectively. Cells were washed with 50 mM sucrose solution. An expression cassette containing approximately 3–5 μg of transcription factor TF7668 was added to 100 μL of cells resuspended in 50 mM sucrose solution. DNA was then transferred into the cells via electroporation under the following conditions: 2000 V field strength, 25 μF capacitor, and 200 Ω resistance. After electroporation, 1 mL of enrichment medium was added to the cells, and the cells were cultured at 28°C and 180 rpm for 12 hours. 50 μL of cells were plated on basal medium plates containing 200 μg / ml G418 and cultured at 30°C for 4 days. Resistant transformants were screened in G418 basal medium and transferred again to plates containing 200 μg / ml G418 basal medium, and cultured for 4 days. Three related Schizochytrium recombinant strains were obtained (denoted as TF7668-2, TF7668-7, and TF7668-8 overexpressing strains). PCR confirmation was performed using primers 1 (ATGGGGATTGAACAAGATGGATTG) and 2 (TCAGAAGAACTCGTCAAGAAGGC), and RT-PCR confirmation was performed using primers 3 (TACCCACGCATCTTGGACAC) and 4 (CCAAAGCCATTGACGCGAAA) (see [link to relevant documentation]). Figure 1 B and Figure 1 C).

[0039] Figure 1 In section B, the positive control refers to the amplification of the expression cassette of transcription factor TF7668, indicating that the amplification conditions were correct; the negative control refers to the direct amplification of water without template, indicating that there was no contamination. Figure 1The genome of the starting strain B could not amplify the G418 resistance gene (798 bp in length), while the genomes of the three recombinant bacteria could amplify the G418 resistance gene, indicating that the expression cassette of transcription factor TF7668 was successfully transformed and integrated into its genome. Figure 1 In C, the transcription levels of TF7668 in the recombinant bacteria after 24 h and 36 h of shake-flask culture were 1.72-2.25 times and 1.96-4.33 times that of the starting strain under the same conditions, respectively, indicating that TF7668 was overexpressed in all three strains.

[0040] The basal culture medium in the above scheme is: glucose 5g / L, yeast extract 1g / L, peptone 1g / L, sea salt 15g / L, and agar powder 15g / L.

[0041] The enrichment medium consisted of: glucose 40 g / L, yeast extract 0.8 g / L, Na₂SO₄ 10 g / L, (NH₄)₂SO₄ 0.8 g / L, KH₂PO₄ 4 g / L, KCl 0.2 g / L, MgSO₄·7H₂O 4.11 g / L, monosodium glutamate 20 g / L, CaCl₂·2H₂O 0.13 g / L, FeSO₄ 0.58 mg / L, MnCl₂ 5.2 mg / L, ZnSO₄ 5.2 mg / L, CuSO₄ 0.8 mg / L, NiSO₄ 0.8 mg / L, CoCl₂ 0.066 mg / L, vitamin B1 0.152 mg / L, vitamin B12 0.24 mg / L, calcium pantothenate 0.512 mg / L, and NaMoO₄ 0.016 mg / L.

[0042] Example 2

[0043] Growth, lipid and DHA content analysis of recombinant strains of Schizochytrium:

[0044] The recombinant Schizochytrium strains obtained in Example 1 (TF7668 overexpression strains 7668-7 and 7668-8) and the originating strain Schizochytrium ATCC 20888 were cultured for two generations in enrichment medium. Seed cells in the logarithmic growth phase were inoculated into 20 mL of fresh enrichment medium with an initial OD 660nm value of 0.5. The cells were cultured in shake flasks at 180 rpm and 28°C. Three replicates were performed for each group, and cells were analyzed for lipid and DHA content after 60 hours.

[0045] Oil and fat analysis method: Cells were collected by centrifugation at 7800g for 10 minutes, washed once with deionized water, and lyophilized for 1 day. 2 mL of esterification solution (containing 3% concentrated sulfuric acid, 0.5 mg / mL methyl nonadecanoate in methanol) and 2 mL of chloroform were added to 20 mg of bacterial powder, and the mixture was dried in a 97℃ oven. 3 mL of deionized water was added, and the mixture was shaken and centrifuged at 7800g for 10 minutes. Total oil and fat content were determined using a GC / MS instrument. GC / MS instrument model: 7890A / 5975C. Column model: HP-5MS capillary column (30 m × 250 mmid). Helium was used as the carrier gas, and the flow rate was set to 1 mL / min. Mass spectrometry analysis was performed in positive ion mode, with ionization mode set to electrical impact ionization and an ionization voltage set to 70 eV; the scan mode was set to full scan, and the scan range was set to 35-650 m / z. The peak positions of various fatty acids in the sample were determined by using retention time data stored in the mass spectrometry database and the retention times of various fatty acid standards under the above GC-MS detection conditions. Then, the content of various fatty acids in the sample was quantitatively calculated using the internal standard method; in this embodiment, methyl nonadecanoate was selected as the internal standard.

[0046] Ultimately, the mutant strain of Schizochytrium obtained by the method of this invention showed the greatest difference between the transformed strain 7668-8 and the original strain after 60 hours of shake-flask fermentation, with a 34% increase in total fatty acid content and a 31% increase in DHA content.

[0047] A comparison of lipid and DHA content between the recombinant strain of Schizochytrium and the original strain Schizochytrium ATCC 20888 is shown in [link to original text]. Figure 2 As shown in the figure, the measured total fatty acid or DHA content was divided by the weighed dry cell weight, with the ratio of the total fatty acid or DHA content of the starting strain (WT) to the weighed dry cell weight being 1. After 60 hours of shake-flask fermentation, the TF7668 overexpression strain 7668-7 showed a 30% increase in total fatty acid content and a 14% increase in DHA content compared to the starting strain. The TF7668 overexpression strain 7668-8 showed the greatest difference from the starting strain, with a 34% increase in total fatty acid content and a 31% increase in DHA content.

[0048] SEQ ID NO.1

[0049] ERGAAERSRRGRAGRAQPRRGADEQAGAALEARRDSAGSRGKRGVEACINQSTTRMTTRGTKMRRTRTRSRTQTTTAIVALEKDEVLAFVDAKGLARLAATCRALCKVVDAAVTRRLASGKLQSRPRKGSRASTRLLAQREAIEESRRPAGTRNLAAGVHHAVFVSQNPAPNTPDYLRGMGDGICGRLGEDNAEDNSWVPLWHPTPILPSIRPSHVRQISCGAYHTAILEWDGSIHIFGVIGAEALAAQRASVLISSSIWGTPSRPRVEYIPTHLGHEPVQISSGTNTLAWTDVRGRVFVQDSRGLFRVNGFGEDADLGHAIQVSCGDCHFAVVTASGQLYTWGGGGHGRLGHGDTQDRHVPTQVRVPDSLETKNERVRVVACEASYRHTVVVTSDGDLLLFGEGSHGQLGQTTLSEHLRPVRCTVGVLASTRVVQVACGETFTAALTEIGQVIVLGSLATQNAVARAQHTAYRLTAGPCDCAAVQIAAGKTSLLMRLDNGVVETCGRGRCGQLGQGASVTLALHAGAPHLRPFSSFWYQLATGKEFRFAADLGHAFARGIILVLNALGGHTLAAVFSTAVKVNKFSSGVHGPHHVPKGENQPSIVPARFISATWLVALFVLRVVKVVFAQLAPKFELTRLASQSALFLNKLLSPALWQS

[0050] SEQ ID NO.2

[0051]

[0052] The present invention has been described above by way of example. It should be noted that any simple modifications, alterations or other equivalent substitutions that can be made by those skilled in the art without creative effort without departing from the core of the present invention fall within the protection scope of the present invention.

Claims

1. A Schizochytrium transcription factor TF7668, characterized in that, The amino acid sequence of the transcription factor TF7668 is shown in SEQ ID NO.

1.

2. A gene encoding the transcription factor TF7668 as described in claim 1.

3. A gene according to claim 2, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

4. An expression cassette or recombinant vector containing the gene as described in claim 2 or 3.

5. A recombinant bacterium comprising the expression cassette or recombinant vector as described in claim 4.

6. A recombinant bacterium as described in claim 5, characterized in that, The recombinant bacteria originated from Schizochytrium; preferably Schizochytrium sp. ATCC 20888.

7. A method for constructing recombinant bacteria as described in claim 5 or 6, characterized in that, The construction method is as follows: an expression cassette or recombinant vector encoding the transcription factor TF7668 is introduced into the starting bacteria to obtain the product.

8. A method for constructing recombinant bacteria as described in claim 7, characterized in that, The method for constructing the recombinant bacteria is as follows: An expression cassette for transcription factor TF7668 was constructed. Using Schizochytrium ATCC 20888 as the starting strain, the constructed expression cassette for transcription factor TF7668 was transformed into the bacterial cells to obtain a recombinant strain.

9. A method for constructing recombinant bacteria as described in claim 8, characterized in that, The expression cassette of the transcription factor TF7668 includes a TEF1 promoter, a gene sequence encoding the transcription factor TF7668, a CYC1 terminator, and a G418 resistance gene expression cassette. Preferably, the G418 resistance gene expression cassette includes the G418 resistance gene and is linked upstream to the CaMV 35S promoter and downstream to the CAMVpoly(A) signal via overlap extension PCR.

10. The application of the recombinant bacteria as described in claim 5 or 6 in the fermentation production of fatty acids; Preferably, the recombinant bacteria are used in the fermentation production of DHA; Preferably, the recombinant bacteria are inoculated into an enrichment medium for fermentation culture; Preferably, the enrichment culture medium comprises: glucose 40 g / L, yeast extract 0.8 g / L, Na₂SO₄ 10 g / L, (NH₄)₂SO₄ 0.8 g / L, KH₂PO₄ 4 g / L, KCl 0.2 g / L, MgSO₄·7H₂O 4.11 g / L, monosodium glutamate 20 g / L, CaCl₂·2H₂O 0.13 g / L, FeSO₄ 0.58 mg / L, MnCl₂ 5.2 mg / L, ZnSO₄ 5.2 mg / L, CuSO₄ 0.8 mg / L, NiSO₄ 0.8 mg / L, CoCl₂ 0.066 mg / L, vitamin B1 0.152 mg / L, vitamin B12 0.24 mg / L, calcium pantothenate 0.512 mg / L, and NaMoO₄ 0.016 mg / L.

Images