A simple method for purifying human heavy chain ferritin

Abstract

The application discloses a simple method for purifying human heavy chain ferritin, which comprises the following steps: collecting bacterial bodies after recombinant engineering bacteria containing human heavy chain ferritin gene are induced to express; lysing the bacterial bodies by using a lysis buffer containing 3-5M urea; removing heat-unstable impurities by heating the lysis supernatant at 70-85 DEG C for 5-15 minutes; performing nickel column affinity chromatography on the supernatant after the heating treatment, eluting and collecting elution components containing human heavy chain ferritin by using a gradient concentration imidazole buffer containing urea; and obtaining human heavy chain ferritin monomers by performing sucrose density gradient ultracentrifugation on the elution components after ultrafiltration replacement. By introducing urea into the lysis buffer and cooperating with an optimized heating treatment temperature, the gel chromatography step in the prior art is omitted, the purification process is simplified, the cost is reduced, and 6mL of human heavy chain ferritin solution with a protein concentration of 1.65mg / mL can be obtained by single purification, and the product is high in purity and good in uniformity.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to a method for purifying nanomedicine carrier proteins, specifically a method for expressing human heavy chain ferritin using recombinant engineered bacteria and then performing simple purification. Background Technology

[0002] Ferritin is a class of iron storage proteins widely found in organisms, whose core function is to maintain the homeostasis of iron metabolism in the body (Chakraborti S, Chakrabarti P. Self-Assembly of Ferritin: Structure, Biological Function and Potential Applications in Nanotechnology. In: Biological and Bio-inspired Nanomaterials. Springer, 2019: 313-329). Ferritin is a hollow cage-like structure formed by the self-assembly of 24 subunits. The protein cage has an outer diameter of about 12 nm and an inner diameter of about 8 nm, and its surface has 8 hydrophilic channels and 6 hydrophobic channels (Guo M, et al. Bacterioferritin nanocage: Structure, biological function, catalytic mechanism, self-assembly and potential applications. Biotechnology Advances, 2022, 61: 108057). Ferritin possesses excellent water solubility and stability (Maity B, et al. Recent progresses in the accumulation of metalions into the apo-ferritin cage. Polyhedron, 2019, 172: 104-111). This unique hollow cage-like structure endows ferritin with excellent drug-carrying potential. Human heavy chain ferritin (HFn), as an important member of the ferritin family, has its natural receptor as transferrin receptor 1 (TfR1).TfR1 is highly expressed on the surface of highly metabolic cells such as tumor cells, enabling HFn to intrinsically target tumor tissues without additional modification. Furthermore, HFn can cross the blood-brain barrier through its interaction with TfR1 (Cosottini L, et al. Ferritin-assisted biomineralization and drug delivery. Journal of Inorganic Biochemistry, 2026, 274: 113090; Zhang J, et al. Cargo loading within ferritin nanoocages in preparation for tumor-targeted delivery. Nature Protocols, 2021,16: 4878-4896). In summary, the unique structure of ferritin makes it an ideal tumor-targeting nanocarrier.

[0003] The ongoing research into ferritin as a nanocarrier has made the efficient acquisition of high-purity, high-yield recombinant HFn protein a key technological bottleneck restricting its clinical application. From a technological development perspective, the preparation and purification techniques of ferritin have evolved from natural extraction to recombinant expression. Early studies mostly extracted ferritin from natural tissues (such as the liver). For example, Cham et al. reported a method for purifying liver ferritin using methanol treatment combined with heating at 75°C (Analytical Biochemistry, 1985, 151(2): 561-565). This method utilizes the heat-resistant properties of ferritin to remove impurities, providing a framework for subsequent heat treatment purification of ferritin. However, the natural extraction route is limited by the availability of raw materials and batch consistency, making it difficult to meet the needs of large-scale preparation.

[0004] The introduction of recombinant expression technology has opened up new pathways for the large-scale preparation of ferritin. Chinese patent document CN108434450B discloses a method using ferritin nanoparticles as vaccine carriers. Ferritin is fused with SpyCatcher and self-assembles into nanoparticles, which are then covalently linked to antigens via SpyCatcher-SpyTag interactions, enabling the engineering application of ferritin nanoparticles in the vaccine field. Building on this, Chinese patent document CN112076315B further discloses nanoantigen particles fused with the novel coronavirus S protein and ferritin subunits. Recombinant protein vaccines are expressed using both an E. coli prokaryotic expression system and an insect cell eukaryotic expression system, and the S protein is mutated and optimized to improve soluble expression levels and efficiency. Chinese patent document CN112876570B displays African swine fever virus structural proteins on the surface of a self-assembled ferritin cage structure and links various structural proteins with ubiquitin to enhance cellular immune responses. The aforementioned patents demonstrate the great potential of ferritin nanocages in the field of vaccine delivery, but their focus is on the engineered application of ferritin as a delivery carrier, with little emphasis on the purification methods of ferritin itself.

[0005] Regarding the purification methods of recombinant HFn, Liang M et al. (Proceedings of the National Academy of Sciences, 2014, 111(41): 14900-14905) established a classic preparation method for HFn nanocages, clearly documenting that HFn possesses heat-resistant properties and can be used to heat-treat E. coli lysates to remove heat-labile host proteins. This method has been widely cited in subsequent studies. Zhang J et al. (Nature Protocols, 2021, 16: 4878-4896) systematically documented the standard purification procedure for ferritin nanocages: after lysing ferritin-expressing E. coli, the mixture was heated to 60°C for 30 minutes to remove the heat-precipitated host proteins, and it was clearly pointed out that HFn and His-tagged HFn are sufficiently stable to withstand this heating condition. Wang Z et al. (ACSNano, 2016, 10(3): 3453-3460) further verified the thermal stability of ferritin, disclosed a method of heating the lysate supernatant to 60°C for 15 minutes, and mentioned that ferritin can withstand heating conditions up to 85°C.

[0006] Although the methods described above utilize the heat resistance of ferritin to some extent to simplify the purification process, existing HFn purification methods still generally rely on gel chromatography (also known as size exclusion chromatography) as an essential step. A typical purification route is: recombinant engineered bacteria lysis → heat treatment → ammonium sulfate precipitation → affinity chromatography → ion exchange chromatography → gel chromatography. Gel chromatography is not only cumbersome and time-consuming, but also places high demands on chromatographic equipment and column consumables. The throughput per batch is limited by the column volume, resulting in low yields of the target protein per batch. This technical bottleneck is particularly prominent in large-scale preparation scenarios.

[0007] Furthermore, the application of urea as a protein denaturant in ferritin research has provided insights for improving purification processes. Multiple studies have investigated the behavior of ferritin in urea: ferritin nanocages can be disassembled into subunit monomers in 8M urea and reassembled after urea removal. This property has been widely used for drug loading of ferritin nanocages (e.g., ACSNano, 2016; Theranostics, 2022; Nanomaterials, 2020; International Journal of Molecular Sciences, 2021). However, under 8M urea conditions, the 24-mer structure of ferritin is completely disintegrated, and heavy chain proteins are lost to varying degrees, resulting in reduced recovery rates. Therefore, current techniques typically limit urea strictly to the specific application of "disassembly-reassembly," and are cautious about introducing urea into conventional purification processes.

[0008] In summary, existing HFn purification methods still have the following shortcomings: First, gel chromatography, as an essential step in traditional purification routes, is cumbersome, time-consuming, and labor-intensive, becoming a major obstacle to simplifying the process and reducing costs. Second, although heat treatment purification has been utilized, existing methods typically use 60℃ treatment, leaving room for improvement in the removal efficiency of contaminating proteins. Third, the application of urea in the field of ferritin is limited to high-concentration (8M) disassembly scenarios, and its potential positive effects on ferritin purification at lower concentrations have not yet been recognized and utilized. Therefore, there is an urgent need for a new HFn purification method that can fully utilize the physicochemical properties of ferritin while effectively simplifying the purification steps and reducing preparation costs. Summary of the Invention

[0009] This invention utilizes the dual properties of human heavy chain ferritin—its resistance to denaturation and high temperature—by introducing urea into the lysis buffer to assist in bacterial lysis and maintain protein integrity. Combined with optimized heat denaturation treatment and a combined purification strategy, it solves the technical problems of cumbersome purification processes, high gel chromatography costs, and low yield per run in existing technologies. This results in simplified purification processes, reduced purification costs, and increased yield per run.

[0010] The technical solution of the present invention to solve the above-mentioned technical problems is:

[0011] A method for purifying human heavy chain ferritin includes: inducing expression of recombinant engineered bacteria containing the human heavy chain ferritin gene and collecting bacterial cells; lysing the bacterial cells to obtain a lysate supernatant; lysing the bacterial cells using a lysate buffer containing urea; heating the lysate supernatant obtained after lysation and collecting the supernatant after centrifugation; purifying the supernatant after heating by metal ion affinity chromatography; and performing density gradient centrifugation on the chromatographic product; wherein the concentration of urea in the lysate buffer is 3-5 M; the heating temperature is 70-85 °C and the treatment time is 5-15 minutes; the metal ion affinity chromatography is nickel column affinity chromatography, eluted with a gradient concentration of imidazole buffer containing urea, and the eluted fraction containing human heavy chain ferritin is collected; and the density gradient centrifugation is sucrose density gradient ultracentrifugation, and the target band is collected to obtain human heavy chain ferritin monomers.

[0012] Preferably, the concentration of the urea is 4M.

[0013] Preferably, the heating treatment temperature is 80°C and the treatment time is 10 minutes.

[0014] Furthermore, the lysis buffer also contains 50 mM Tris and 500 mM NaCl, with a pH of 7.5.

[0015] Further, the concentration gradient of imidazole in the gradient concentration imidazole buffer is 0 mM, 10 mM, 20 mM, 125 mM and 250 mM respectively, and the fraction eluted at the 250 mM imidazole concentration is collected as the eluted fraction containing human heavy chain ferritin.

[0016] Specifically, in the sucrose density gradient ultracentrifugation, the sucrose density gradient is 10%~40%, and the centrifugation is carried out at 30,000 rpm for 8 hours at 4°C.

[0017] Furthermore, prior to the density gradient centrifugation, the process further includes: ultrafiltration of the eluted fraction through an ultrafiltration membrane with a molecular weight cutoff of 100 kDa to a pretreatment buffer containing 5% sucrose.

[0018] Further, the induction expression of the recombinant engineered bacteria includes: inoculating engineered bacteria containing the human heavy chain ferritin gene into LB liquid medium containing 50 μg / mL kanamycin, shaking and culturing at 37°C and 200 rpm until the OD600nm is 0.6~0.8, adding IPTG to a final concentration of 1 mM, inducing culture at 37°C for 8 hours, and collecting the bacterial pellet by centrifugation.

[0019] Furthermore, the recombinant engineered bacteria were constructed by cloning the human heavy chain ferritin gene into the pET-28a expression vector and then transforming it into Escherichia coli (DE3).

[0020] Furthermore, the pyrolysis is performed using ultrasonic fragmentation with an ultrasonic power of 300W. Each ultrasonic treatment lasts for 5 seconds, with a 5-second interval between treatments, for a total ultrasonic treatment time of 50 minutes.

[0021] Compared with existing technologies, this invention has the following advantages: By introducing urea at a specific concentration into the lysis buffer, this invention creatively utilizes the differential characteristics of human heavy chain ferritin (HFn)—its structural stability under low urea concentrations while the destruction of other proteins and bacterial structures by urea—achieving a dual technical effect of assisting lysis and maintaining protein integrity. Furthermore, by using an optimized heat denaturation temperature (70-85°C), the removal efficiency of other proteins is effectively improved. After initial purification via nickel column affinity chromatography combined with multi-gradient imidazole washing and elution, further purification is achieved by sucrose density gradient ultracentrifugation. This successfully eliminates the gel chromatography step required in existing technologies while obtaining high-purity human heavy chain ferritin monomers. A single purification yields approximately 6 mL of HFn solution with a protein concentration of approximately 1.65 mg / mL, and approximately 9.9 mg of HFn protein can be extracted per liter of bacterial culture. Malvern particle size analysis shows a polydispersity index (PDI) < 0.2, and bioelectron microscopy confirms that HFn possesses a complete cage-like structure and good homogeneity. The simplified overall process not only reduces reliance on gel chromatography equipment and consumables, lowering the cost per purification step, but also achieves higher protein yield per preparation step by reducing protein loss during multi-step purification, which is beneficial for large-scale preparation. Furthermore, this invention systematically compares the effects of different urea concentrations (0M, 2M, 4M, 6M, 8M) on purification efficiency, determining that 4M urea is the optimal concentration that balances purification efficiency and protein integrity. The urea concentration can be substituted within the range of 3-5M, and the heating temperature can be substituted within the range of 70-85℃. This overcomes the technical bias in existing technologies that avoid introducing urea into purification due to protein loss caused by high-concentration urea (8M). Attached Figure Description

[0022] Figure 1 The image shows SDS-PAGE images of bacterial cell lysates of the recombinant plasmid of the present invention in the expression vector at different induction times under 37°C and 1mM IPTG conditions, where M is the marker and h is the number of hours.

[0023] Figure 2This is an SDS-PAGE image of purified human heavy chain ferritin according to the present invention. M is the marker, cleavage is the lysis buffer, 80℃ is the supernatant after centrifugation of the lysis buffer at 80℃, effluent is the effluent after passing through a nickel column, W10-1 is the effluent from the first column volume of 10mM imidazole, W10-5 is the effluent from the fifth column volume of 10mM imidazole, W20-1 is the effluent from the first column volume of 20mM imidazole, W20-5 is the effluent from the fifth column volume of 20mM imidazole, W125-1 is the effluent from the first column volume of 125mM imidazole, and W125-5 is the effluent from the fifth column volume of 125mM imidazole.

[0024] Figure 3 This is an SDS-PAGE image of purified human heavy chain ferritin according to the present invention, where M is the marker and E1-E9 are 2 mL of 250 mM imidazole elution buffer each.

[0025] Figure 4 The images show the SDS-PAGE and Native-PAGE images of the ultrafiltrate of purified human heavy chain ferritin obtained in this invention.

[0026] Figure 5 SDS-PAGE comparison of human heavy chain ferritin purified by nickel column without urea in the lysis buffer.

[0027] Figure 6 Comparison of SDS-PAGE images of human heavy chain ferritin purified by nickel column chromatography with 2M urea added to the lysis buffer.

[0028] Figure 7 Comparison of SDS-PAGE images of human heavy chain ferritin purified by nickel column chromatography with 4M urea added to the lysis buffer.

[0029] Figure 8 Comparison of SDS-PAGE images of human heavy chain ferritin purified by nickel column chromatography with 6M urea added to the lysis buffer.

[0030] Figure 9 Comparison of SDS-PAGE images of human heavy chain ferritin purified by nickel column chromatography with 8M urea added to the lysis buffer.

[0031] Figure 10 The SDS-PAGE images of cell lysate supernatants treated at different temperatures show the effect of temperature on the removal of contaminating proteins.

[0032] Figure 11 Results of centrifugation sampling with a 10-40% sucrose density gradient

[0033] Figures 12-14 This is an electron micrograph of the purified human heavy chain ferritin of this invention.

[0034] Figure 15This is a particle size distribution diagram of the purified human heavy chain ferritin under an electron microscope.

[0035] Figure 16 This is a Malvern particle size distribution diagram of the purified human heavy chain ferritin of this invention.

[0036] Figure 17 This is a process flow diagram of the purification process of human heavy chain ferritin according to the present invention.

[0037] In the figure, M-marker, lysis buffer, supernatant after centrifugation of lysis buffer treated at 80℃, effluent - effluent through nickel column, W10-1 - first column volume effluent of 10mM imidazole, W10-5 - fifth column volume effluent of 10mM imidazole, W20-1 - first column volume effluent of 20mM imidazole, W20-5 - fifth column volume effluent of 20mM imidazole, W125-1 - first column volume effluent of 125mM imidazole, W125-5 - fifth column volume effluent of 125mM imidazole, E1-E9 - 2 mL each of 250mM imidazole elution buffer, supernatant - supernatant after bacterial sonication, SDS-PAGE - sodium dodecyl sulfate polyacrylamide gel electrophoresis, Native-PAGE - non-denaturing polyacrylamide gel electrophoresis, HFn - human heavy chain ferritin. Detailed Implementation

[0038] The present invention will now be further described in conjunction with the accompanying drawings and specific embodiments. It should be noted that, without conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments.

[0039] In the description of this invention, it should be noted that directional terms such as "center," "lateral," "longitudinal," "length," "width," "thickness," "upper," "lower," "front," "rear," "left," "right," "vertical," "horizontal," "top," "bottom," "inner," "outer," "clockwise," and "counterclockwise" indicate the orientation and positional relationship based on the orientation or positional relationship shown in the accompanying drawings. These terms are used only for the convenience of describing this invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. They should not be construed as limiting the specific protection scope of this invention.

[0040] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features. Thus, the use of "first" and "second" to define a feature may explicitly or implicitly include one or more of that feature, and in the description of this invention, "a number" means two or more, unless otherwise explicitly specified.

[0041] In this invention, unless otherwise explicitly specified and limited, terms such as "set" and "install" should be interpreted broadly. For example, they can refer to a fixed connection, a detachable connection, or an integral connection; they can also refer to a mechanical connection; they can refer to a direct connection or a connection through an intermediate medium; or they can refer to the internal connection of two components. Those skilled in the art can understand the specific meaning of the above terms in this invention according to the specific circumstances.

[0042] Example 1

[0043] This embodiment provides a method for purifying human heavy chain ferritin. The experimental materials used include: HFn / pET-28a recombinant plasmid, E. coli (DE3) engineered bacteria, LB liquid medium containing 50 μg / mL kanamycin, 1M IPTG, SDS-PAGE electrophoresis buffer and electrophoresis apparatus, lysis buffer (50mM Tris, 500mM NaCl, 4M urea, pH 7.5), protease inhibitor mixture, sonicator, low-temperature high-speed centrifuge, histidine-tagged protein purification nickel column, imidazole elution buffers of different concentrations containing 4M urea (0mM, 10mM, 20mM, 125mM, 250mM), ultrafiltration membrane with a molecular weight cutoff of 100kDa, sucrose buffer, ultracentrifuge, SDS-PAGE gel, and native gel. The specific steps are as follows.

[0044] 1. Construction and Induced Expression of Engineered Bacteria

[0045] The human heavy chain ferritin gene sequence was obtained from the NCBI database, sequence number NM_002032.3. The target sequence is as follows:

[0046] CCATGCACCACCACCACCACCACACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACT TTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGA CTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTA CCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAACTCGAG

[0047] The target vector was pET-28a, and the prokaryotic expression vector was E. coli (DE3).

[0048] The correctly sequenced engineered bacterial strain was inoculated into 250 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking at 200 rpm until the OD600 nm reached 0.6–0.8. IPTG was then added to a final concentration of 1 mM, and the culture was induced at 37°C for 8 hours. The bacterial pellet was collected by centrifugation, and SDS-PAGE electrophoresis was performed to detect the expression of the target protein. The results are shown below. Figure 1 As shown, HFn protein was significantly expressed after 8 hours of induction.

[0049] 2. Bacterial cell lysis

[0050] Add 10 mL of lysis buffer (50 mM Tris, 500 mM NaCl, 4 M urea, pH 7.5) to the successfully induced bacterial pellet to fully resuspend the cells. Add an appropriate amount of protease inhibitor mixture before sonication. Sonicate the bacteria on ice at 300 W for 5 seconds each time, with a 5-second interval between each sonication, for a total of 50 minutes. Centrifuge at 12000 rpm for 30 minutes at 4°C, collect the bacterial lysate supernatant, and place it in an ice-water bath or on ice.

[0051] 3. Heat denaturation treatment

[0052] The cell lysate supernatant was placed in an 80°C water bath for 10 minutes. After centrifugation at 12,000 rpm for 30 minutes at 4°C, the heat-denatured supernatant was collected and placed in an ice-water bath or on ice.

[0053] 4. Nickel column affinity chromatography

[0054] Nickel columns were purified using a gravity-based histidine-tagged protein purification method. Before purification, the column was equilibrated with twice the column volume of lysis buffer. The heat-treated supernatant was mixed with the nickel column and incubated on a rotating shaker for 1 hour. The following buffers were used for washing and elution sequentially: approximately 100 mL of lysis buffer (0 mM imidazole) was washed with approximately 100 mL of wash buffer containing 10 mM imidazole; approximately 100 mL of wash buffer containing 20 mM imidazole was washed with approximately 100 mL of wash buffer containing 125 mM imidazole; and finally, approximately 6 mL of elution buffer containing 250 mM imidazole was used to elute the nickel column, collecting the elution fraction containing human heavy chain ferritin. SDS-PAGE monitoring results during the purification process are shown below. Figure 2 and Figure 3 As shown. By Figure 2 As can be seen, after washing with a gradient of imidazole concentrations, impurities were gradually removed; from Figure 3 It is evident that all components (E1~E9) of the 250mM imidazole eluent contain high-purity HFn protein.

[0055] 5. Ultrafiltration replacement

[0056] The purified HFn sample was ultrafiltered using an ultrafiltration membrane with a molecular weight cutoff of 100 kDa, and then completely replaced with a pretreatment buffer containing 5% sucrose. The SDS-PAGE and Native-PAGE results of the ultrafiltrate are shown below. Figure 4 As shown.

[0057] 6. Sucrose density gradient ultracentrifugation

[0058] Slowly add 40% sucrose solution to the bottom of the centrifuge tube using a pipette; take an equal volume of 10% sucrose solution and add it very slowly along the tube wall to the top layer of the 40% solution, forming a clear interface. Place the centrifuge tube in a 4°C freezer and let it stand overnight to allow the gradient to diffuse naturally. Gently spread the ultrafiltered HFn protein on the top layer of the gradient. Centrifuge at 30,000 rpm for 8 hours at 4°C. After centrifugation, collect the target band and perform SDS-PAGE and Native-PAGE purity verification.

[0059] 7. Characterization of purification results

[0060] Following the above purification process, approximately 6 mL of HFn solution with a protein concentration of approximately 1.65 mg / mL was obtained from a single purification step, meaning approximately 9.9 mg of HFn protein could be extracted per liter of bacterial culture. Native-PAGE results showed that the purified product existed in a 24-mer assembly form, indicating high purity. The purified HFn sample was observed using a bioelectron microscope, and the electron microscope image is shown below. Figure 12 , such as 13, Figure 14 The electron microscope images of HFn show that they possess a complete cage-like structure and good uniformity; particle size measurements were performed on the electron microscope images using ImageJ, and the particle size distribution is as follows: Figure 15 As shown. Further particle size analysis of the purified HFn sample was performed using a Malvern particle size analyzer, and the particle size distribution is shown in the figure. Figure 16 As shown, the polydispersity index (PDI) is less than 0.2, indicating that the purified HFn has high purity and good homogeneity. The purification process described above is as follows: Figure 17 As shown.

[0061] Example 2

[0062] This example investigated the effect of urea concentration in the lysis buffer on the purification effect. The following control groups were set up; except for the urea concentration, each group underwent nickel column purification according to the steps in Example 1 (the control groups did not undergo heat denaturation treatment, while the experimental groups underwent heating treatment at 80°C):

[0063] Control group A: Liquefaction buffer without urea was used for nickel column purification, and the results were as follows. Figure 5 As shown, almost no protein was found in the eluent, while most protein was present in the effluent and wash buffer, indicating that HFn hardly binds to the nickel column in the absence of urea. Control group B: 2M urea was added to the lysis buffer, and nickel column purification was performed; the results are shown below. Figure 6 As shown, the eluent contained a large amount of contaminating proteins, while the target protein was almost invisible, indicating that the 2M urea concentration was too low and the purification effect was poor. Control group C: 4M urea was added to the lysis buffer, and nickel column purification was performed, with the following results: Figure 7As shown, compared to the 2M urea group, the amount of impurities in the eluent was significantly reduced, and the target protein band was visible, indicating that 4M urea significantly improved the purification effect; Control group D: 6M urea was added to the lysis buffer, and nickel column purification was performed, with the following results. Figure 8 As shown, the eluent contained a large amount of contaminating proteins, while the target protein was almost invisible, similar to the 2M urea group. This indicates that the 6M urea concentration was too high, resulting in decreased purification efficiency. Control group E: 8M urea was added to the lysis buffer, and nickel column purification was performed, with the following results: Figure 9 As shown, the total protein in the eluent was very low, with visible impurities, while the target protein was not visible, indicating that 8M urea caused a large loss of protein. Experimental group (same as Example 1): 4M urea was added to the lysis buffer, and after heating at 80°C for 10 minutes, nickel column purification was performed to obtain high-purity HFn protein.

[0064] Figures 5-9 In each figure, M is the marker, the supernatant is the supernatant after bacterial sonication, the effluent is the effluent after the supernatant binds with the nickel column, W1~W5 are washing effluents with different imidazole concentrations, and E1~E3 are elution effluents with 250mM imidazole.

[0065] Figures 5-9 The comprehensive comparative results showed that HFn hardly bound to the nickel column without urea; 2M urea was insufficient for purification; high concentrations of 6M and 8M urea led to the loss of the target protein and deteriorated the purification effect; 4M urea resulted in the best nickel column purification effect. Combined with 80℃ heating denaturation treatment, heat-labile contaminating proteins were further removed, yielding high-purity HFn. Therefore, 4M urea is the optimized concentration for achieving efficient nickel column purification of HFn while maintaining protein integrity.

[0066] Example 3

[0067] This example investigated the effect of heating denaturation temperature on the removal of contaminating proteins and the recovery rate of HFn. The lysis supernatant (containing 4M urea) obtained in Example 1 was treated at different temperatures for 10 minutes. After centrifugation, the supernatant was collected and the protein distribution in the supernatant after each temperature treatment was analyzed by SDS-PAGE electrophoresis. The results are as follows: Figure 10 As shown.

[0068] The results showed that when the treatment temperature was above 70℃, heat-sensitive proteins could be effectively removed. As the treatment temperature increased from 70℃ to 85℃, the protein bands gradually decreased, while HFn proteins were retained due to their heat resistance. The target protein was best retained at 85℃. Considering both the protein removal efficiency and HFn recovery rate, 70–85℃ was the preferred heating temperature range, and the 80℃ treatment group achieved the best balance between protein removal rate and HFn recovery rate.

[0069] Example 4

[0070] This embodiment verifies the effectiveness of sucrose density gradient ultracentrifugation in separating HFn monomers and the structural integrity and uniformity of the final product.

[0071] The HFn sample, purified by nickel column chromatography and ultrafiltration, was subjected to a 10%–40% sucrose density gradient ultracentrifugation at 4°C, 30,000 rpm, and for 8 hours. After centrifugation, a clear target band was visible. Each gradient band was collected and analyzed by SDS-PAGE and Native-PAGE. SDS-PAGE results (…) Figure 11 The results showed that the target band was a single subunit band, and the Native-PAGE results showed that the target band was a 24-mer assembly, indicating that high-purity HFn monomeric protein was successfully separated after ultracentrifugation with sucrose density gradient.

[0072] The purified HFn sample was observed using a bioelectron microscope. (Electron microscopy image) Figure 12 , Figure 13 , Figure 14 The electron microscope images show that HFn possesses a complete cage-like structure and good uniformity. The particle size of the HFn particles in the electron microscope images was measured using ImageJ software, and the particle size distribution is as follows: Figure 15 As shown. Further analysis of the purified HFn sample using a Malvern particle size analyzer was performed, and the results are shown below. Figure 16 As shown, the polydispersity index (PDI) is less than 0.2, indicating that the purified HFn has high purity and good uniformity. Figures 12-16 Together, they proved that HFn purified by the method of this invention has high purity and uniformity.

[0073] The above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. It should be understood that those skilled in the art can make appropriate modifications, adjustments, and combinations to the specific technical parameters, operating conditions, reagent concentrations and ratios, heating temperatures and times, imidazole elution concentration gradient settings, sucrose density gradient concentration ranges, and centrifugation parameters in the above embodiments according to actual needs, without departing from the technical principles and inventive concept of the present invention, and such modifications, adjustments, and combinations do not require creative effort. Although the present invention has been described in detail through the above preferred embodiments, the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements based on the inventive concept, as long as they do not depart from the spirit and scope of the technical solution of the present invention, should be included within the scope of protection of the claims of the present invention. Furthermore, the reagents, materials, instruments, and methods used in this specification and embodiments, unless otherwise specified, are all conventional reagents, materials, instruments, and methods in the art, and those skilled in the art can choose alternative solutions to implement the present invention according to experimental conditions.

Claims

1. A method for purifying human heavy chain ferritin, comprising: The bacterial cells were collected after inducing expression of recombinant engineered bacteria containing the human heavy chain ferritin gene; The bacterial cells are lysed to obtain lysate supernatant; characterized in that: the bacterial cells are lysed using a lysate buffer containing urea; the lysate supernatant obtained after lysation is heated, and the supernatant after heating is collected by centrifugation; the supernatant after heating is purified by metal ion affinity chromatography; the chromatographic product is subjected to density gradient centrifugation; wherein, the concentration of urea in the lysate buffer is 3-5M; the heating temperature is 70-85℃, and the treatment time is 5-15 minutes; the metal ion affinity chromatography is nickel column affinity chromatography, eluted with a gradient concentration of imidazole buffer containing urea, and the eluted fraction containing human heavy chain ferritin is collected; the density gradient centrifugation is sucrose density gradient ultracentrifugation, and the target band is collected by centrifugation to obtain human heavy chain ferritin monomer.

2. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: The concentration of the urea is 4M.

3. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: The heat treatment temperature is 80°C, and the treatment time is 10 minutes.

4. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: The lysis buffer also contains 50 mM Tris and 500 mM NaCl, with a pH of 7.

5.

5. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: The imidazole concentration gradient in the gradient concentration imidazole buffer is 0 mM, 10 mM, 20 mM, 125 mM and 250 mM respectively. The fraction eluted at the 250 mM imidazole concentration is collected as the eluted fraction containing human heavy chain ferritin.

6. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: In the sucrose density gradient ultracentrifugation, the sucrose density gradient was 10%~40%, and the mixture was centrifuged at 30,000 rpm for 8 hours at 4°C.

7. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: Before the density gradient centrifugation, the process further includes: ultrafiltration of the eluted fraction through an ultrafiltration membrane with a molecular weight cutoff of 100 kDa to a pretreatment buffer containing 5% sucrose.

8. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: The induction expression of the recombinant engineered bacteria includes: inoculating engineered bacteria containing the human heavy chain ferritin gene into LB liquid medium containing 50 μg / mL kanamycin, shaking and culturing at 37°C and 200 rpm until the OD600nm is 0.6~0.8, adding IPTG to a final concentration of 1 mM, inducing culture at 37°C for 8 hours, and collecting the bacterial pellet by centrifugation.

9. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: The recombinant engineered bacteria were constructed by cloning the human heavy chain ferritin gene into the pET-28a expression vector and then transforming it into Escherichia coli (DE3).

10. The method for purifying human heavy chain ferritin according to claim 1, characterized in that: The pyrolysis was performed using ultrasonic fracturing with an ultrasonic power of 300W. Each ultrasonic treatment lasted 5 seconds with a 5-second interval, and the total ultrasonic treatment time was 50 minutes.

Images