Application of spliced isoform of spag9 as target in treatment of tumor

Abstract

The application belongs to the technical field of biological medicine, and relates to application of a cleaved isomer of SPAG9 as a target in treatment of tumors. It is found in the application that SPAG9 is abnormally spliced in tumors, especially ovarian cancer, and that a long cleaved isomer (SPAG9-L) and a short cleaved isomer (SPAG9-S) are generated by skipping of the 28th exon. An antisense oligonucleotide capable of changing selective splicing of SPAG9 is designed according to the splicing mode of SPAG9, the antisense oligonucleotide is combined with a sequence around SPAG9 Exon28, and SPAG9 Exon28 is promoted to skip, so that the ratio of the cleaved isomers SPAG9-L / S is reduced, the expression level of SPAG9 is not obviously changed, apoptosis of tumor cells is promoted, and an anti-tumor effect is achieved.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to the application of SPAG9 cleavage isomers as targets in the treatment of tumors. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Ovarian cancer is the leading cause of death from gynecological malignancies. Due to its insidious onset, most patients are diagnosed at an advanced stage, resulting in the highest mortality rate internationally. Targeted therapies, such as PARP inhibitors, have significantly improved the prognosis of patients with homologous recombination deficiency (HRD) (e.g., BRCA mutations), but approximately 50% of HRD-negative patients still benefit only slightly. Furthermore, primary or secondary resistance mechanisms (e.g., BRCA gene remutation) have become new clinical challenges. The efficacy of immune checkpoint inhibitors as monotherapy in ovarian cancer is unsatisfactory, with low response rates. This is mainly attributed to the "immunocold tumor" characteristics of the ovarian cancer tumor immune microenvironment, such as low tumor mutational burden (TMB), low PD-L1 expression, and insufficient immune cell infiltration. In addition, the insufficient prevalence and standardization of BRCA and HRD biomarker testing in clinical practice also hinders the comprehensive implementation of precision medicine strategies.

[0004] Alternative splicing is a dynamic regulatory process at the post-transcriptional level, in which exons of mRNA precursors assemble in various ways into different combinations, ultimately producing proteins with different or even opposite functions. Whole-exome sequencing and high-throughput transcriptome sequencing have demonstrated RNA splicing-specific dysregulation in various tumors, including splicing factor mutations, aberrant expression, and the expression of splice-regulated aberrant isoforms and neoantigens. These abnormalities affect tumor development, apoptosis, and the development of drug resistance. Specifically, aberrant expression of the METexon14Δ splice isoform drives the progression of lung adenocarcinoma, a subtype of lung adenocarcinoma that is specifically sensitive to MET inhibitors. The splicing factor SRSF3, by promoting CD19exon2 retention, affects T cell-specific recognition of tumor cells and inhibits their immune escape. Therefore, studying the aberrant splicing process in tumor cells and identifying key genes caused by aberrant splicing has significant diagnostic and therapeutic value.

[0005] Sperm-associated antigen 9 (SPAG9) has been reported to participate in the c-Jun N-terminal kinase (JNK) signaling module and function as a scaffold protein for JNK, thus playing an important role in cell survival, proliferation, apoptosis, and tumor development. JLP overexpression enhances the clonality and long-term survival potential of normal fallopian tube epithelial cells. JLP participates in lysophosphatidylcholine (LPA)-stimulated JNK pathway activation, promoting the proliferation and migration of ovarian cancer cells. Furthermore, SPAG9 is overexpressed in various human cancers, including renal cell carcinoma, breast cancer, thyroid cancer, cervical cancer, colon cancer, and lung cancer. Studies have found that siRNA knockdown of SPAG9 has been shown to inhibit tumor growth in cervical cancer. Importantly, SPAG9 expression has also been reported to be associated with circulating anti-SPAG9 antibodies in patients with early and low-grade breast cancer and cervical cancer, suggesting its potential application value in early disease detection.

[0006] It has been reported that disease-related proteins are encoded by only about 0.2% of the genome, and more than 80% of proteins cannot be targeted by currently available small molecule drugs and antibodies, thus necessitating the development of drugs that target RNA. Summary of the Invention

[0007] This invention discovered that SPAG9 undergoes aberrant splicing in tumors, particularly ovarian cancer, with its exon 28 skipping to produce a long splice isoform (SPAG9-L) and a short splice isoform (SPAG9-S). The presence of exon 28 is crucial for the survival of ovarian cancer cells. Therefore, a decrease in the ratio of the splice isoform SPAG9-L / SPAG9-S leads to reduced tumor cell proliferation and migration, thus affecting cancer prognosis. This invention designs an antisense oligonucleotide that alters the selective splicing of SPAG9, binding to the sequence surrounding SPAG9 Exon 28 to promote SPAG9 Exon 28 skipping, thereby decreasing the ratio of the splice isoform SPAG9-L / S without significantly altering SPAG9 expression levels. This promotes tumor cell apoptosis, achieving an anti-tumor effect.

[0008] Based on the above research findings, the purpose of this invention is to provide the application of SPAG9 cleavage isomers as targets in tumor treatment. To achieve this purpose, the technical solution of this invention is as follows: Firstly, the application of SPAG9 splice isomers as targets in screening drugs for treating tumors. The splice isomers of SPAG9 are the long splice isomer (SPAG9-L) and the short splice isomer (SPAG9-S) generated by the skipping of exon 28 of SPAG9. The nucleotide sequence of exon 28 of SPAG9 is shown in SEQ ID NO: 10.

[0009] Specifically, without altering SPAG9 expression levels, increasing the ratio of long-splicing isomers to short-splicing isomers promotes tumor cell proliferation; decreasing the ratio of long-splicing isomers to short-splicing isomers inhibits tumor cell proliferation, thereby screening for drugs to treat tumors.

[0010] The gene ID of SPAG9 described in this invention is ENSG00000008294, the Transcript ID of the long cleavage isomer (SPAG9-L) is ENST00000510283.5, and the Transcript ID of the short cleavage isomer (SPAG9-S) is ENST00000262013.12.

[0011] Secondly, an antisense oligonucleotide having any of the nucleotide sequences of SEQ ID NO:3-8; or having a nucleotide sequence that is at least 50% sequence identical to any of the nucleotide sequences of SEQ ID NO:3-8.

[0012] Thirdly, the application of the antisense oligonucleotide described in the second aspect of the present invention in the preparation of a tumor-treating drug.

[0013] The beneficial effects of this invention are as follows: This invention is based on SPAG9, a key oncogenic gene involved in aberrant splicing in tumors (including ovarian cancer), and the fact that its core transcript differs from SPAG9 in that it skips exon 28, resulting in long transcripts (SPAG9-L) and short transcripts (SPAG9-S). Furthermore, a classic GU splicing site was discovered at the junction of exon 28 and intron 28. Based on this, an effective sequence capable of regulating the splicing pattern of SPAG9 was designed and verified, providing a direction for the preparation of drugs that can induce tumor cell apoptosis, inhibit cell proliferation, and treat tumors. Attached Figure Description

[0014] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0015] Figure 1The diagram below illustrates the effects of antisense oligonucleotides in the junctional site region between the variable exon 28 and intron 28 of SPAG9 on exon 28 skipping and the expression of different SPAG9 transcripts, as shown in Example 1. A represents a schematic diagram of the specific design sites of the six antisense oligonucleotides; B is a diagram of semi-quantitative PCR verification of the regulation of the alternative splicing pattern of SPAG9 gene RNA by the six antisense oligonucleotides; C is a diagram using the ovarian cancer cell line HEY to verify the effect of different concentrations of the antisense oligonucleotide AS05 on exon skipping; and D shows the changes in mRNA levels in the HEY cell line after exposure to different concentrations of ASO-5 for 48 hours.

[0016] Figure 2 The images show the staining results of antisense oligonucleotide-induced apoptosis and migration inhibition of ovarian cancer cells in Example 2. A is a pseudocolor image of HEY ovarian cancer cell apoptosis induced by flow cytometry using antisense oligonucleotide AS05; B is a graph showing the proportion of HEY ovarian cancer cell apoptosis induced by flow cytometry using antisense oligonucleotide AS05; C shows the effect of ASO5 on the migration ability of the HEY ovarian cancer cell line as detected by transwell assay. Statistical results confirm that ASO5 promotes apoptosis and inhibits migration in HEY cells.

[0017] Figure 3 The diagram below shows the inhibition of ovarian cancer cell proliferation by antisense oligonucleotides in Example 3. A represents the effect of different antisense oligonucleotide concentrations on the activity of the HEY ovarian cancer cell line as detected by the CCK-8 assay; B represents the determination of the IC50 of different antisense oligonucleotides on ovarian cancer cells; C and D are schematic diagrams illustrating the inhibition of ovarian cancer growth by antisense oligonucleotide ASO5 using a nude mouse tumorigenesis model in the in vivo experiment of Example 3. After intratumoral injection of antisense oligonucleotide ASO5, tumor volume decreased, and ovarian cancer growth was inhibited; E represents the effect of antisense oligonucleotide 5 on the long-term proliferation activity of the HEY ovarian cancer cell line as shown by the CCK-8 assay.

[0018] Figure 4The following graphs show the results of the inhibition of ovarian cancer cell proliferation and migration by exon 28 skipping in Example 4. A is a schematic diagram of exon 24 skipping induced by CRISPR-CAS9 technology in SPAG9; B shows the exon 28 knockout status of the two ovarian cancer cell lines SPAG9 identified by RT-PCR and agarose gel electrophoresis; C and D show cell growth curves detected by the CCK8 assay, revealing that exon 28 skipping inhibits cell proliferation; E and F show the cell colony-forming ability detected by the plate colony assay, and G is a statistical graph of the number of colonies, further verifying that exon 28 skipping inhibits cell proliferation; H and I show the cell migration ability detected by the transwell assay, and J is a statistical graph of the number of successfully migrated cells, showing that exon 28 knockout significantly inhibits the migration of ovarian cancer cell lines compared to the control group. Detailed Implementation

[0019] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0020] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0021] The term "oligonucleotide" refers to oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or their analogues. Oligonucleotides can include natural and / or modified monomers or bonded linear or cyclic oligomers, such as deoxyribonucleosides, ribonucleosides, their substituted forms and α-anomeric forms, peptide nucleic acids (PNA), locked nucleic acids (LNA), phosphate thioesters, methyl thiocyanate, and their analogues. Oligonucleotides are capable of pairing with complementary sequences via Watson-Crick type bases.

[0022] Antisense oligonucleotides recognize and hybridize with "target nucleic acids." "Target nucleic acids" encompass DNA, RNA transcribed from such DNA (including precursor mRNA and nucleotides), cDNA derived from such RNA, coding sequences, non-coding sequences, and sense or antisense polynucleotides. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This regulation of the target nucleic acid's function by a compound that specifically hybridizes with it is generally referred to as "antisense." DNA functions to be interfered with include, for example, replication and transcription. The overall effect of this interference with the target nucleic acid's function is to regulate the expression of the encoded product or oligonucleotide. For example, if it is an RNA oligonucleotide, it binds to another RNA target via RNA-RNA interactions and alters the activity of the target RNA. Antisense oligonucleotides can upregulate or downregulate the expression and / or function of specific polynucleotides. Such molecules include, for example, antisense RNA or DNA molecules, interfering RNA (RNAi), microRNAs, bait RNA molecules, siRNAs, enzymatic RNAs, therapeutic editing RNAs, antisense oligomers, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternative splice variants, and other oligomers that hybridize with at least a portion of the target nucleic acid. These compounds can exist in the form of single-stranded, double-stranded, partially single-stranded, or cyclic oligomers.

[0023] Given that there are currently no effective drugs targeting SPAG9 alternative splicing, there is a need in the art to develop drugs that control the occurrence and development of related diseases by regulating SPAG9 alternative splicing. Therefore, this invention proposes the application of the splice isomer of SPAG9 as a target in the treatment of tumors.

[0024] In one typical embodiment of the present invention, the application of the splice isomers of SPAG9 as targets in screening drugs for the treatment of tumors is provided. The splice isomers of SPAG9 are the long splice isomer (SPAG9-L) and the short splice isomer (SPAG9-S) generated by the skipping of exon 28 of SPAG9. The nucleotide sequence of exon 28 of SPAG9 is shown in SEQ ID NO: 10.

[0025] In some embodiments, without altering the SPAG9 expression level, increasing the ratio of long-splicing isomers to short-splicing isomers promotes tumor cell proliferation; decreasing the ratio of long-splicing isomers to short-splicing isomers inhibits tumor cell proliferation, thereby screening for drugs to treat tumors.

[0026] The gene ID of SPAG9 described in this invention is ENSG00000008294, the Transcript ID of the long cleavage isomer (SPAG9-L) is ENST00000510283.5, and the Transcript ID of the short cleavage isomer (SPAG9-S) is ENST00000262013.12.

[0027] Another embodiment of the present invention provides an antisense oligonucleotide having a nucleotide sequence as shown in SEQ ID NO:X, where X is 3 to 8; or having a nucleotide sequence having at least 50% sequence identity with the nucleotide sequence shown in SEQ ID NO:X.

[0028] The antisense oligonucleotide provided by this invention has at least 50% sequence identity with the reverse complementary sequence of the natural antisense sequence of the polynucleotide fragment at the junction of exon 28 and intron 28 of the SPAG9 polynucleotide.

[0029] Introns are the portions of eukaryotic DNA located between two coding regions, namely exons. The RNA transcribed from introns and exons is called "primary transcript, mRNA precursor (or pre-mRNA)." Introns are removed from pre-mRNA to produce native proteins encoded by exons (native proteins are those that are naturally occurring, wild-type, or functional). During splicing, introns are removed from pre-mRNA, and exons are joined together. Splicing is a series of reactions on RNA mediated by splicing factors, occurring after transcription but before translation. Therefore, pre-mRNA is RNA containing both introns and exons. mRNA is RNA in which introns have been removed, exons are sequentially linked, and it can be transcribed into proteins by ribosomes.

[0030] Introns typically contain one or more splicing elements. Splicing elements are relatively short, conserved segments of RNA that bind to various splicing factors that perform the splicing reaction. Generally, introns are defined by a 5-splicing site, a 3-splicing site, and a segment in between. Splicing elements are typically “blocked” when antisense oligonucleotides completely or partially overlap with the splicing element, or bind to pre-mRNA very close to the element, thereby disrupting the binding and function of splicing factors that mediate specific splicing reactions on the element.

[0031] The motif sequence containing the splicing site at the junction of exon 28 and intron 28 was analyzed using CLIP data to identify the target region for the binding of related splicing factors, located in the region of intron 28 near exon 28. Specifically, the motif sequence is shown in SEQ ID NO: 1~2.

[0032] Target segments may include DNA or RNA sequences comprising at least five consecutive nucleotides from the 5' end of one of the preferred target segments (the remaining nucleotides being a continuous extension of the DNA or RNA that begins immediately upstream of the 5' end of the target segment and continues until the DNA or RNA contains approximately 5 to approximately 30 nucleotides). Once one or more target regions, segments, or sites are identified, those skilled in the art can select antisense compounds that are sufficiently complementary to the target, i.e., hybridize sufficiently well and with adequate specificity to obtain the desired effect, according to known methods.

[0033] In some embodiments, the antisense oligonucleotide comprises one or more modifications selected from: at least one modified sugar moiety, at least one modified nucleoside internucleotide, at least one modified nucleotide, and combinations thereof. Specifically, the modified nucleoside internucleotide is one or more of thiophosphate, 2'-O-methoxyethyl (MOE), 2'-fluoro, alkyl phosphate, dithiophosphate, alkyl thiophosphonate, aminophosphate, carbamate, carbonate, triphosphate, glycine, and carboxymethyl ester. More specifically, the antisense oligonucleotide is a nucleotide including a methoxy-modified nucleotide. More specifically, each nucleotide in the antisense oligonucleotide is methoxy-modified.

[0034] A third embodiment of the present invention provides the application of the above-mentioned antisense oligonucleotide in the preparation of a tumor-treating drug.

[0035] In some embodiments, the tumor is ovarian cancer.

[0036] In some embodiments, the anti-tumor drug reduces the SPAG9-L / SPAG9-S ratio by regulating the SPAG9 transcript.

[0037] In some embodiments, the therapeutic tumor drug includes an expression vector for antisense oligonucleotide expression, comprising a promoter, a heterozygous promoter gene sequence, and possessing strong constitutive promoter activity, or promoter activity that can be induced as needed.

[0038] In some embodiments, the antitumor drug is a pharmaceutical composition comprising an active ingredient and pharmaceutical excipients, wherein the active ingredient is the antisense oligonucleotide. The antisense oligonucleotide provided by this invention can be used in pharmaceutical compositions by adding an effective amount of the compound to a suitable pharmaceutical excipient. For example, the antisense oligonucleotide of this invention is associated with a nanocarrier as a tumor receptor target, helping to improve drug absorption and utilization, prolong drug half-life, while the targeting molecule on the nanomaterial enables efficient targeted drug delivery and reduces harmful side effects on normal tissues.

[0039] Specifically, the pharmaceutical excipients include, but are not limited to, solvents (such as water for injection, physiological saline), buffer solutions (such as phosphate buffer), pH adjusters (such as hydrochloric acid / sodium hydroxide), osmotic adjusters (such as sodium chloride, mannitol, etc.), chelating agents (such as disodium edetate), stabilizers, lyophilization protectants (such as trehalose), antioxidants (such as sodium metabisulfite), lipids (such as cholesterol), and surfactants (such as Tween-80). The antitumor drug provided by this invention can be prepared into the desired formulation using conventional techniques well-known in the pharmaceutical industry. These techniques include steps of binding the active ingredient with pharmaceutical excipients. Generally, the formulation is prepared by uniformly and tightly binding the active ingredient with a liquid carrier or a finely fragmented solid carrier, or both, to form the product when needed.

[0040] The antitumor drugs described in this invention can be administered in several ways, depending on whether local or systemic treatment is required and the area to be treated. Administration can be local, pulmonary (e.g., by inhalation or blowing of powders or aerosols, including via nebulizers), intratracheal, intranasal, epidermal, and percutaneous, oral, or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial (e.g., intrathecal or intraventricular) administration. In some embodiments, the dosage form of the antitumor drugs is an injection, solution, suspension, tablet, capsule, granule, inhaler, or spray.

[0041] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments and comparative examples.

[0042] Example 1 The core transcript of SPAG9 differs in exon 28, and a splicing site was found at the junction of exon 28 and intron 28 surrounding SPAG9. In this embodiment, antisense oligonucleotides located at the junction region of exon 28 and intron 28 of SPAG9 were designed and prepared. The sequence at exon 28 of SPAG9 is shown in SEQ ID NO: 10, and the sequences of motif 1 and motif 2, where the splicing site is located, are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0043] Exon28: CCGTAATCCTCCACCAGGGACGTTTACTGGGGCTGAGGG(SEQ ID NO: 10); Motif 1: TAGCATGCTGTATCTCTTTTTTTCCAGCTTTGTCTTGAATTGGCATTGCCATCCTTGTTTTATCTCAACTGGCT(SEQ ID NO: 1); Motif 2: TACTTACTTGCCCATGGAATGGGGATGTTTTGTGAGTCTGGTCTTTTACAGT (SEQ ID NO: 2).

[0044] By inhibiting the splicing of immature precursor RNA of downstream target genes by complementary base pairing, SPAG9 splicing is interfered with and changes in the splicing pattern of exon 28 are caused.

[0045] The following antisense oligonucleotides were synthesized by Anhui General Biotechnology Co., Ltd.: ASO1: C A T C C C C A T T C C A T G G G C A A G (SEQ ID NO: 3); ASO2: C C A T T C C A T G G G C A A G T A A G (SEQ ID NO: 4); ASO3: C C C C A T T C C A T G G G C A A G T A (SEQ ID NO: 5); ASO4: T G G C A A T G C C A A T T C A A G A C (SEQ ID NO: 6); ASO5: G G A T G G C A A T G C C A A T T C A A G (SEQ ID NO: 7); ASO6: C A A G G A T G G C A A T G C C A A T T C (SEQ ID NO: 8); ASO-NC (negative control): C C T C T T A C C T C A G T T A C A A T T T A T A(SEQ ID NO: 9).

[0046] in, This represents methoxyl modification.

[0047] Figure 1 A shows the binding site for the antisense oligonucleotide ASO1 to ASO6. For example... Figure 1 As shown in Figure A, the sequences of ASO1 to ASO6 are inversely complementary to the introns downstream of exon 28 of the immature precursor of SPAG9, which is inversely complementary to the motif target region obtained from data analysis.

[0048] ASO transfection: 70 nM of the above antisense oligonucleotides were transiently transfected into the ovarian cancer cell line HEY using Rfect, and cellular RNA was collected after 48 h. Changes in RNA levels were verified using semi-quantitative PCR, and changes in total mRNA levels were verified using RT-qPCR.

[0049] Total RNA was extracted using a total RNA extraction kit [Albatross Biotechnology (Guangzhou) Co., Ltd.]. Reverse transcription was performed using SPARKscript II All-in-one RT Super Mix for qPCR (With gDNA Eraser) (Shandong Cisco Biotechnology Co., Ltd., AG0305-A) at 37℃ for 15 minutes and 85℃ for 5 seconds. A portion of the reversed cDNA was amplified using semi-quantitative PCR primers (as shown below) and 2×Taq Plus Master Mix (Dye Plus) (Nanjing Novizan Biotechnology Co., Ltd., P212-01). The product was subjected to 2.5% agarose gel electrophoresis at 110V for 30 minutes, and imaging was performed. The other portion was then used for qPCR experiments: cDNA was mixed with SYBR-Greenmix (Shandong Cisco Biotechnology Co., Ltd.) in the specified ratio and then placed in an Applied Biosystems QuantStudio 3 instrument for qPCR experiments.

[0050] The following primers were synthesized by Sangon Biotech Co., Ltd.

[0051] The primers for amplifying the SPAG9 gene in qRT-PCR are: SPAG9-F: AAGCACGCTGAGGAGAAATTCA (SEQ ID NO: 11); SPAG9-R: TTCGCTTTCAGCTCAAGTTGT (SEQ ID NO: 12); The primers for amplifying the SPAG9 gene in semi-quantitative PCR are: SPAG9-semi-F: 5'-GTGGGGACAGGAAATGGTGT-3' (SEQ ID NO: 13); SPAG9-semi-R: 5'-AAGCTGTGCATGTGCCATTG-3' (SEQ ID NO: 14).

[0052] In semi-quantitative PCR, the splicing pattern of SPAG9 RNA level was quantitatively calculated using the Percent Spliced ​​In (PSI) index. Image J was used to perform grayscale analysis on the agarose gel electrophoresis images: Spliced ​​In (PSI) = grayscale of exon-retained bands / (grayscale of exon-retained bands + grayscale of exon-skipped bands).

[0053] In RT-qPCR, 2 ΔΔCt The relative mRNA expression level of SPAG9 was calculated using this method.

[0054] The results are as follows Figure 1 As shown, transient transfection of ovarian cancer cell lines with ASO1-ASO6 altered the splicing pattern of SPAG9 exon28, promoting exon28 skipping. Figure 1 B), and shows a concentration-dependent trend ( Figure 1 C). However, the overall level of its mRNA did not change significantly.

[0055] Example 2 The results of treating ovarian cancer cells with 70 nM antisense oligonucleotide ASO5 for 48 hours are used as an example.

[0056] Cell apoptosis was detected by flow cytometry. Results are as follows: Figure 2 As shown in Figure A, apoptosis is clearly evident.

[0057] The proportion of apoptosis was quantitatively determined using the Annexin V-PI / FITC apoptosis staining kit (ELABSCIENCE). Specific experimental procedures are as follows: 1. Cell collection: Collect 5 × 10⁶ cells. 5 For each adherent cell, digest the cells with trypsin without EDTA. After digestion is stopped, collect the cells, centrifuge at 1000 rpm and 4°C for 5 minutes, and discard the supernatant.

[0058] 2. Washing cells: Wash cells twice with pre-cooled PBS, centrifuging at 1000 rpm and 4°C for 5 minutes each time, and discard the supernatant.

[0059] 3. Resuspend cells: Add 100 μl of 1× Binding Buffer and gently mix until a single-cell suspension is formed.

[0060] 4. Cell staining: Add 2.5 μl Annexin V-PI and 2.5 μl FITC Staining Solution and mix well. Incubate at room temperature (20-25℃) for 10 minutes. Add 400 μl 1× Binding Buffer and mix well.

[0061] 5. Samples were analyzed by flow cytometry within 1 hour after staining: normal cells were double negative (Annexin V-PI / FITC); early apoptotic cells were single positive (Annexin V-PI). / FITC): Late apoptotic cells are double-positive for Annexin V-PI and FITC (Annexin V-PI / FITC).

[0062] Experimental results are as follows Figure 2 A and Figure 2 As shown in B, the antisense oligonucleotide ASO5 was found to induce an increase in the proportion of early apoptosis and late apoptosis, consistent with microscopic observations.

[0063] The cell migration ability was verified by transwell assay, and the results are as follows: Figure 2 As shown in Figure C, the cell migration ability is significantly reduced.

[0064] The main experimental steps of the Transwell method include: 1. Add 600 μl of conditioned medium containing 20% ​​FBS to each experimental group in a 24-well plate, and place the 8.0 μm pore size chamber (Corning, 3422) that is matched with the 24-well plate into the 24-well plate.

[0065] 2. Collect cells treated with ASO5 for 48 hours, digest them, and resuspend them in DMEM medium to prepare a cell suspension containing 10% FBS. After cell counting, seed 200 μl of the cell suspension into the upper chamber of a Transwell chamber, ensuring even distribution at 3 × 10⁻⁶ cells per chamber. 4 Each cell contains the same type of conditioned medium in both the upper and lower chambers of the Transwell.

[0066] 3. Subsequently, place the 24-well plate in a cell culture incubator and culture for 12-24 hours, depending on the cell type and migration ability, then terminate the culture. During the procedure, ensure that no air bubbles are generated between the polycarbonate membrane and the culture medium in the lower chamber, or in the cell suspension in the upper chamber.

[0067] 4. Cell fixation and staining: Rinse the chambers twice with 1×PBS buffer (for cells), then immerse the chambers in methanol at room temperature for 20 min to fix.

[0068] 5. After fixation, rinse the chambers twice with 1×PBS buffer (for cells), and then immerse the chambers in crystal violet staining solution at room temperature in the dark for 30 minutes.

[0069] 6. After staining, rinse the chamber twice with 1×PBS buffer (for cells). Then, gently wipe away any cells in the upper chamber that have not migrated to the lower chamber with a cotton swab. Take pictures, count, and perform statistical analysis on the cells that have migrated to the lower chamber under an optical microscope.

[0070] The results are as follows Figure 2 As shown in D, according to the statistical results, the migration ability of the HEY cell line was significantly reduced after ASO5 treatment.

[0071] Example 3 The results of treating ovarian cancer cells with 70 nM antisense oligonucleotide AS05 for 48 hours are used as an example.

[0072] The main steps of the cell IC50 assay (cck8 method) include: 1. Collect cells in the logarithmic growth phase, digest them with enzymes, centrifuge to collect the cells, prepare a single-cell suspension, count the cells under a microscope, and adjust the cell concentration: 2. Count the required number of cells and prepare the cell suspension according to the formula of 800 cells / 100u1 / well, with 5 replicates per group; 3. Add 100 μL of cell suspension to a 96-well plate, leaving the wells around the perimeter for adding PBS to reduce culture medium evaporation. Let stand for 30-40 minutes before incubating.

[0073] 4. After 24 hours, the corresponding antisense oligonucleotides were added to each well according to the final concentration gradient of 0, 25, 50, 100, and 200 nM. After 48 hours of treatment, obvious cell apoptosis was observed, and the next step of treatment was carried out. 5. Remove the 96-well plate, aspirate the original solution, add 100 μl of 10% CCK8 solution to each well, gently shake to mix, and then return to the incubator. Incubate at 37°C for 2 hours.

[0074] 6. After 2 hours, remove the 96-well plate, measure the absorbance at 450 nm using a microplate reader, and calculate cell viability and IC50 using GraphPad 10.0. 50 value.

[0075] The results are as follows Figure 3 As shown. Figure 3 A represents the activity of ovarian cancer cells after the addition of different antisense oligonucleotides ASO1, ASO2, and ASO5, as well as the activity of ASO1, ASO2, and ASO5. Figure 3 B) Half-inhibition concentration IC 50 The results showed that the antisense oligonucleotide ASO5 had a significant inhibitory effect on the ovarian cancer cell line HEY, with a half-maximal inhibitory concentration (IC50) of [value missing]. 50 The value is 58.33 nM.

[0076] The short-term and long-term viability of cells after the addition of antisense oligonucleotides (ASO) was verified using the CCK8 assay, and the IC50 was calculated. 50 .

[0077] Cell proliferation assay (CCK-8 assay) experimental steps: 1. Collect HEY cells after ASO5 treatment for 48 hours, digest them, and resuspend them in DMEM medium to prepare a cell suspension containing 10% FBS. After cell counting, seed them into 96-well plates, ensuring that 800 cells are evenly distributed in each well. Set up 5 replicates for each group, and then place the 96-well plates in a cell culture incubator overnight.

[0078] 2. Cell proliferation capacity detection: After overnight cell culture, the cells in each experimental group were observed to be in good condition and evenly distributed. At the same time point on days 0, 1, 2, 3, 4 and 5, the culture medium was replaced with CCK-8 working solution. After incubating the 96-well plates in a cell culture incubator for 2 hours, the OD value was measured at a wavelength of 450 nm.

[0079] 3. Calculate the cell proliferation rate of each experimental group relative to day 0 based on the OD value and plot the cell proliferation curve. Note that the CCK-8 working solution should be prepared and used immediately, and the incubation time of the CCK-8 working solution should be 2 hours each day.

[0080] The results are as follows Figure 3 As shown in E. Figure 3 E represents the long-term proliferative activity of ovarian cancer cells HEY after the addition of the antisense oligonucleotide ASO5.

[0081] To verify whether AS0 also promotes tumor cell apoptosis in vivo, 4-8 week old BALB / cNude female mice were injected bilaterally into the axilla with 1×10⁶ HEY cells of ovarian cancer. 6 For each subcutaneous tumor, when the diameter is about 3-5 mm, six nude mice of similar size on both sides are selected and injected intratumorally with antisense oligonucleotide ASO5.

[0082] Each nude mouse was injected with 5 nmol of antisense oligonucleotide at each site, diluted with 25 μl of Opti-MEM and mixed with 3 μl of ipo2000. The injection was repeated every three days, and the tumor size was observed and recorded. The nude mice were anesthetized and euthanized after 2-3 weeks.

[0083] Figure 3 C and Figure 3 Images D show subcutaneous tumor formation in nude mice. The tumor volume was statistically analyzed after intratumoral injection of antisense oligonucleotide ASO5 and its corresponding control. Results showed that antisense oligonucleotide ASO5 inhibited tumor growth. This experiment demonstrates that antisense oligonucleotide ASO5 can inhibit the growth of ovarian cancer cells in vivo.

[0084] Example 4 The association between SPAG9 exon 28 and ovarian cancer The core transcript difference of SPAG9 lies in exon 28, such as Figure 4 As shown in Figure A, the HEY ovarian cancer cell line was transfected with a transient transfection technique using a plasmid containing crispr-CAS9 and sgRNA. Single clones were selected 48 hours after transfection and amplified to a certain number of cells. DNA was then extracted for PCR and agarose gel electrophoresis to verify the knockout effect of the cell line.

[0085] The transient transfection process mainly includes: (1) Cell plating: Cells that have been passaged twice and are in good condition are plated for transfection. Trypsin digestion – resuspend cells in culture medium – cell counting – seeding density. When transfecting plasmids, the cell density should be controlled at 60%-80%.

[0086] (2) Preparation of transfection complex: DNA transfection method: Mix 2 μl of plasmid with 200 μl of jetPRIME Buffer and add it to a 1.5 ml EP tube. Vortex for 10 seconds, add 4 μl of jetPRIME, vortex again for 10 seconds and centrifuge. Incubate at room temperature for 10 min.

[0087] (3) Add the above transfection mixture to the 6-well plate that has been inoculated with cells. Add 200 μL of the above mixture to each well with 2 ml of culture medium. Mix well and then place in a cell culture incubator.

[0088] (4) 48 hours after transfection, puro was added for selection. Single clones were picked, amplified, and their DNA was extracted and verified by PCR. Figure 4 B).

[0089] After obtaining the desired KO cell line, the cell proliferation and migration abilities were detected using the aforementioned CCK 8 and transwell methods, as well as the plate colony method described below. The experimental results are as follows: Figure 4 As shown in CJ, knocking out exon 28 significantly reduced the cell's proliferation and migration abilities.

[0090] The specific steps for plate cloning are as follows: 1. Preparation of single-cell suspension Collect cells at 80%–90% confluence, discard the culture medium, and wash once with PBS. Add trypsin (approximately 0.5 mL per well in a 6-well plate) and digest for 1 min (observe under a microscope that the cells become rounded and the gaps between them increase). Add twice the volume of complete culture medium to stop digestion and gently pipette.

[0091] Counting: Cell density was calculated using a cell counter for 20 μL suspension.

[0092] 2. Serial dilution and inoculation (6-well plate as an example) First, add 2 mL of complete culture medium to each well. Depending on the cell growth rate, seed 700-1000 cells per well, and slowly add the calculated cell suspension along the well wall. Shake the well 10 times in a cross shape to ensure even cell distribution, avoiding air bubbles.

[0093] 3. Culture and medium change Place in a 37℃, 5% CO2 incubator and incubate statically. Avoid moving or observing the cells for the first 3 days. Change the medium every 3-4 days: aspirate the old medium along the well wall and add 2 mL of fresh complete medium along the wall. Culture until most clones have a cell count >50 (white dots visible to the naked eye or under low magnification).

[0094] 4. Fixation and staining Termination of culture: Discard the culture medium and gently wash twice with PBS (1 mL per well).

[0095] Fixation: Add 1 mL of methanol to each well (pre-cooling to -20℃ is better), and fix at room temperature for 15 min. Discard the fixative and air dry for 5 min (this step can be omitted if methanol is used). Staining: Add 1 mL of 0.1% crystal violet to each well and stain at room temperature for 20-30 min. Elution: Rinse slowly with running water until the background is colorless, then invert and air dry.

[0096] 5. Counting and taking photos Invert the 6-hole board, place a white board underneath, and take a picture (resolution ≥300 dpi) to record the image. ImageJ will then automatically count the images (e.g., ...). Figure 4 EJ).

[0097] Experiments have shown that exon 28 knockout can alter splicing events and inhibit the growth of ovarian cancer cells in vitro.

[0098] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of SPAG9 splice isomers as targets in screening drugs for the treatment of tumors. The splice isomers of SPAG9 are the long splice isomer and the short splice isomer generated by the skipping of exon 28 of SPAG9. The nucleotide sequence of exon 28 of SPAG9 is shown in SEQ ID NO:

10.

2. The application as described in claim 1, characterized in that, in Without altering SPAG9 expression levels, increasing the ratio of long-splicing isomers to short-splicing isomers promotes tumor cell proliferation; decreasing the ratio inhibits tumor cell proliferation, thereby screening for drugs to treat tumors.

3. The application as described in claim 1, characterized in that, The gene ID of SPAG9 is ENSG00000008294; Alternatively, the Transcript ID for the long shear isomer is ENST00000510283.5; Alternatively, the Transcript ID for the short shear isomer is ENST00000262013.

12.

4. An antisense oligonucleotide, characterized in that, Having a nucleotide sequence as shown in SEQ ID NO:X, where X is 3 to 8; or having a nucleotide sequence that is at least 50% sequence identical to the nucleotide sequence shown in SEQ ID NO:X.

5. The antisense oligonucleotide as described in claim 4, characterized in that, The antisense oligonucleotide contains one or more modifications selected from the following: at least one modified sugar moiety, at least one modified nucleoside internucleotide, at least one modified nucleotide, and combinations thereof.

6. The antisense oligonucleotide as described in claim 4, characterized in that, The antisense oligonucleotide is a nucleotide including a methoxy group modified with nucleotides; Alternatively, each nucleotide in the antisense oligonucleotide is modified with a methoxy group.

7. The use of any one of the antisense oligonucleotides according to claims 4 to 7 in the preparation of a tumor-treating drug.

8. The application as described in claim 7, characterized in that, The tumor is ovarian cancer; Alternatively, the tumor-treating drug may reduce the SPAG9-L / SPAG9-S ratio by regulating the SPAG9 transcript.

9. The application as described in claim 7, characterized in that, The tumor treatment drug is a pharmaceutical composition comprising an active ingredient and pharmaceutical excipients, wherein the active ingredient is the antisense oligonucleotide; Alternatively, the pharmaceutical excipients may include solvents, buffer solutions, pH adjusters, osmotic adjusters, chelating agents, stabilizers, lyophilization protectants, antioxidants, lipids, or surfactants.

10. The application as described in claim 7, characterized in that, The dosage forms of the tumor treatment drugs are injections, solutions, suspensions, tablets, capsules, granules, inhalers, or sprays.

Images