Anti-magea1 t-cell receptors and uses thereof

Abstract

The application provides an anti-MageA1 T-cell receptor and application thereof. The T-cell receptor has the property of recognizing a MageA1 polypeptide epitope presented by an HLA class I molecule. The T-cell receptor recognizes an epitope with high specificity and without any cross-reaction. The engineered cell expressing the T-cell receptor can specifically recognize and effectively kill target cells and different tumor cell lines, and has a wide application prospect in tumor treatment and prevention.

Description

Technical Field

[0001] This invention relates to the field of T-cell receptor technology, and more particularly to an anti-MageA1 T-cell receptor and its applications. Background Technology

[0002] CAR-T cell therapy, through gene modification, expresses a synthetic chimeric antigen receptor (CAR) on normal T cells. This CAR recognizes and binds to cell membrane surface antigens, activating T-cell killing and immune memory functions. It has achieved clinical success in the treatment of B-cell malignancies, opening a new field in T-cell tumor therapy. However, because CAR-T cells can only recognize antigens expressed extracellularly, suitable targets are very limited, restricting its application in solid tumors. T-cell receptors (TCRs) recognize processed peptide epitopes presented by human histocompatibility antigens (HLA). Whether the antigen protein is located intracellularly or extracellularly, it can be processed and loaded onto HLA molecules for presentation on the cell surface; therefore, TCRs have a broad antigen recognition range.

[0003] Cancer / Testis antigens (CT antigens) are a large class of tumor-associated antigens highly expressed in various tumor cells but not expressed in normal cells except for embryonic and male germ cells, making them ideal targets for immunocellular therapy. MageA1 was the first CT antigen discovered, belonging to the Melanoma-Associated Antigen Family A (MAGE-A). The MageA1 gene is located in the q28 region of the human X chromosome, near the telomere, and adjacent to other genes in the MAGE-A family. The MageA1 protein is 309 amino acids long. The MageA1 protein has very high sequence similarity to other proteins in the MAGE-A family, with 75% and 67% sequence identity to MageA4 and MageA3, respectively. The MageA1 protein carries a conserved MAGE homology domain (MHD) of approximately 170 amino acids, common to all MAGE-A family proteins. Structural analysis shows that the MHD is a tandem-winged helix motif involved in protein-protein interactions. Immunohistochemical and large-scale RNA-seq analyses revealed that MageA1 is highly expressed in human spermatogonia cells, moderately expressed in spermatids, and not expressed in any other normal tissues. MageA1 is highly expressed in a variety of tumors, including lung cancer, melanoma, liver cancer, head and neck tumors, multiple myeloma, and esophageal cancer. Due to its unique tissue expression characteristics, MageA1 has become an ideal target for TCR-T cell therapy.

[0004] The selection strategies and materials used for TCR screening play a decisive role in the clinical safety and efficacy of TCR-T cell therapy. Most existing TCR screening methods utilize known epitopes, limiting them to previously accumulated knowledge of tumor immunology. This prevents the discovery of the most effective TCR clones in anti-tumor T-cell immune responses, as well as new anti-tumor epitopes and matching HLA molecules. Furthermore, using transgenic mice to obtain TCRs carries off-target risks in clinical use, with severe off-target effects potentially leading to subject death. Similarly, obtaining TCRs by enhancing affinity also carries off-target risks. TCRs screened from transgenic mouse models, having not undergone the in vivo T-cell development process, have a very high probability of non-specific cross-recognition. TCRs screened using this method may recognize antigens expressed in other normal tissues and cells outside the target, leading to serious adverse events such as off-target effects. Using T-cells derived from healthy volunteer PBMCs involves multiple rounds of peptide stimulation based on known antigenic epitopes to induce the proliferation of peptide epitope-specific T-cell clones. However, this in vitro stimulation method results in TCRs with poor affinity and killing performance due to the lack of in vivo immune response, making it difficult to achieve the expected clinical efficacy. The remedy for this TCR is to increase its affinity through in vitro mutation, but this also introduces the problem of non-specific TCR recognition. One TCR targeting MageA3, screened in HLA-A*0201 transgenic mice through peptide-immunostimulation, and then further mutated to obtain a higher affinity mutant strain, showed in clinical trials that this TCR-T cell not only recognized MageA3 but also cross-recognized MAGE-A12 expressed in human brain tissue, leading to neurotoxicity and death in two subjects. Another HLA-A*01-restricted TCR, also targeting MageA3, initially had low affinity and poor killing effect, so affinity mutation screening was conducted. This resulted in a TCR with increased affinity. Although this TCR passed various in vitro cross-recognition tests, in clinical trials, this high-affinity TCR-modified T-cell caused cardiotoxicity deaths in two subjects. Later analysis revealed that this was due to the increased affinity TCR off-target recognition of the cardiomyocyte protein Tintin. Another method for screening clinically viable TCRs is to obtain tumor-derived T cells, namely tumor-infiltrating lymphocytes (TILs). TILs have already undergone the human body's developmental process, eliminating the risk of recognizing antigens from normal human tissues and cells. Furthermore, TILs are rich in tumor-specific cytotoxic T-cell clones. TILs are isolated from the patient's tumor tissue, expanded and cultured in vitro, and then reinfused into the patient—a process known as adoptive cell therapy. This therapy has shown clinical efficacy in various types of tumors, including melanoma, cervical cancer, lung cancer, HPV-associated squamous cell carcinoma, and breast cancer.This demonstrates that TIL cells are not only clinically safe but also contain T-cell clones with clinical therapeutic efficacy. Therefore, TCRs obtained from TIL cell screening are not only safe for clinical use but also achieve effective tumor cell killing without in vitro mutation. Similarly, TCRs targeting MageA3 obtained from TIL cell screening are clinically very safe, and four patients with different types of tumors achieved partial responses (PR). TCRs selected from TIL cells can also discover novel, previously unknown antigenic epitopes and matching HLA alleles. Mathematical models can be constructed based on data from known peptide epitopes and HLA class 1 molecule binding assays to predict unknown antigenic epitopes. However, the algorithms produce large numbers of results, have a high false positive rate, and may also produce false negatives. Furthermore, the predicted results differ significantly from those obtained through immunological assays. Therefore, the algorithm still needs optimization and improvement and cannot yet be used to guide practical work.

[0005] MageA1-targeted TCR-T cell therapy has shown promise in solid tumors, but most known MageA1-targeted TCRs are HLA-A*02:01 restricted, and most recognize the same epitope. 278-286 KVLEYVIKV. This epitope of MageA1, presented by HLA-A*0201, was identified by mass spectrometry and discovered in 2001. TSCAN Therapeutics has launched several anti-MageA1 TCRs, HLA-restricted including HLA-A*02:01, HLA-C*07:02, HLA-A*01:01, HLA-A*03:01, and HLA-B*07:02. Another one, also HLA A*02:01 restricted, targets MageA1. 278-286 In June 2024, the results of a Phase I clinical trial of TCR-T cell therapy targeting the KVLEYVIKV epitope were published. This TCR was obtained by peptide-stimulated PBMCs in healthy individuals, without point mutations to enhance affinity. Results showed that among 16 patients with different advanced types of cancer, including melanoma, squamous cell carcinoma, lung adenocarcinoma, and liver cancer, 11 achieved stable disease (SD) and 5 achieved progressive disease (PD) after receiving this TCR-T cell therapy. Five patients experienced tumor shrinkage after treatment, but did not meet the partial response (PR) criteria. Although this TCR-T cell therapy is very safe and has no off-target toxicity, the clinical efficacy is far from ideal. The reason is speculated to be that TCRs obtained by in vitro peptide-stimulated PBMCs have historically had poor therapeutic effects because they have not undergone in vivo selection by the innate immune process and are not the optimal tumor-specific TCR. Another German team also screened a TCR targeting MageA1 using transgenic mice, which also exhibits HLA-A*02:01 restriction, recognizing the MageA1 epitope. 278-286KVLEYVIKV. Xie Xingwang's team at Kerui Biotechnology in China reported a TCR targeting MageA1 at the 2024 ASCO Annual Meeting. It also recognizes the epitope presented by HLA-A*02:01. The abstract only states that this TCR has also undergone affinity enhancement screening, but the original source of this TCR is not clearly stated.

[0006] In summary, most existing TCRs targeting MageA1 target the known HLA-A*02:01 restriction epitopes and are obtained by stimulating healthy human PBMCs or transgenic mice with peptides. TCRs obtained by stimulating healthy volunteer PBMCs with peptides, however, exhibit poor killing efficacy and unsatisfactory clinical results because they lack in vivo immune response and selection. Unbiased selection using tumor-infiltrating lymphocytes (TILs) may yield TCRs targeting other HLA restriction epitopes, broadening the applicable population for TCR-T cell therapy. Summary of the Invention

[0007] In analyzing a subset of melanoma TIL cells, this invention revealed that these TIL cells effectively killed autologous tumor cells and induced CD137 expression, indicating that these TIL cells contained a tumor-specific cytotoxic T cell clone. Further experiments showed that the antigen recognized by these TIL cells was MageA1. Flow cytometry and single-cell sequencing were used to obtain a TCR clone recognizing MageA1. Immunological testing revealed that this TCR was HLA-B*15:01 restricted. Immunoprecipitation, mass spectrometry (MS) analysis, and peptide loading assays identified the antigenic epitope recognized by this TCR as MageA1. 160- 169 KEADPTGHSY. Antigen cross-recognition assays demonstrated that this TCR does not recognize other peptides with sequence similarity to MageA1, or that this protein cannot be processed intracellularly into peptides that can be presented by HLA-B*15:01. Multiple immunological tests showed that this TCR has good immunoreactivity and cytotoxic activity against various tumor cells expressing MageA1 and HLA-B*15:01, and has clinical application value.

[0008] This invention relates to an anti-MageA1 T-cell receptor, or a TCR-CD3 bispecific complex, suitable for MageA1-positive tumor patients carrying the HLA-B*15:01 allele, which can specifically recognize MageA1 presented by human HLA-B*15:01. 160-169KEADPTGHSY peptide epitopes are provided, along with associated peptide and protein sequences, corresponding DNA sequences, expression vectors, host cells, and drug combinations. Detection methods in tumors and applications for tumor treatment and prevention are also presented, expanding the diversity of HLA-targeting methods.

[0009] In one aspect, the present invention provides a T-cell receptor that has the ability to recognize the MageA1 polypeptide epitope presented by HLA class I molecules.

[0010] According to an embodiment of the present invention, the HLA class I molecule is HLA-B*15. In one embodiment of the present invention, the HLA-B*15 is preferably HLA-B*15:01 or HLA-B*15:05.

[0011] According to an embodiment of the present invention, the MageA1 polypeptide includes the sequence KEADPTGHSY (SEQ ID NO:137) or KEVDPTGHSF (SEQ ID NO:138).

[0012] According to an embodiment of the present invention, the MageA1 polypeptide is approximately 8-11 amino acids in length. Preferably, the MageA1 polypeptide is approximately 10 amino acids in length.

[0013] According to an embodiment of the present invention, the MageA1 polypeptide is composed of the sequence KEADPTGHSY (SEQ ID NO:137) or KEVDPTGHSF (SEQ ID NO:138).

[0014] According to an embodiment of the present invention, the MageA1 polypeptide epitope is generated by the intracellular degradation pathway of MageA1 protein, loaded onto the antigen-binding groove of the HLA-B*15 molecular polypeptide, and then transported to the cell membrane surface.

[0015] According to an embodiment of the present invention, the MageA1 polypeptide is composed of the sequence KEADPTGHSY (SEQ ID NO:137).

[0016] According to an embodiment of the present invention, the MageA1 polypeptide epitope presented by HLA-B*15 recognizes the T-cell receptor and activates the T-cell receptor.

[0017] According to an embodiment of the present invention, the T-cell receptor includes at least one complementarity-determining region 3 (CDR3) of a variable region, the complementarity-determining region 3 comprising an amino acid sequence selected from those shown in SEQ ID NO:130, SEQ ID NO:136 or a functional variant thereof.

[0018] According to an embodiment of the present invention, the T-cell receptor includes a variable region (Vα) of the TCRα chain and / or a variable region (Vβ) of the TCRβ chain; wherein, at least one of the variable regions of Vα and / or Vβ contains a complementation-determining region 3 (CDR3) comprising an amino acid sequence selected from those shown in SEQ ID NO:130, SEQ ID NO:136 or a functional variant thereof.

[0019] According to an embodiment of the present invention, the CDR1 and CDR2 of the Vα respectively comprise the amino acid sequences shown in SEQ ID NO:132 and SEQ ID NO:134 or their functional variants, and / or

[0020] The CDR1 and CDR2 of the Vβ respectively contain the amino acid sequences shown in SEQ ID NO:126 and SEQ ID NO:128 or their functional variants.

[0021] According to an embodiment of the present invention, the amino acid sequences of the Vα and Vβ variable regions are as shown in SEQ ID NO:58 and SEQ ID NO:56, respectively, or sequences having at least 90% identity with the amino acid sequences shown in SEQ ID NO:58 and SEQ ID NO:56.

[0022] According to an embodiment of the present invention, the amino acid sequence of the Vα variable region is shown in SEQ ID NO:58, and the amino acid sequence of the Vβ variable region is shown in SEQ ID NO:56.

[0023] According to an embodiment of the present invention, the α-chain and β-chain of the TCR further include constant regions (C-regions), the amino acid sequences of which may be derived from the constant regions of a suitable species' TCR or functional variants thereof, such as human or mouse.

[0024] According to an embodiment of the present invention, the amino acid sequence of the α-chain constant region of the TCR is selected from any of the following sequences, such as SEQ ID NO:84, SEQ ID NO:90, SEQ ID NO:100, and SEQ ID NO:209.

[0025] According to an embodiment of the present invention, the amino acid sequence of the β-chain constant region of the TCR is selected from any of the following sequences, such as SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:211, and SEQ ID NO:213.

[0026] According to an embodiment of the present invention, the TCR can be a chimeric TCR. In one embodiment of the present invention, the TCR can be composed of a variable region from a human TCR and a constant region from a mouse TCR. Using the mouse constant region can avoid mismatch between the exogenously expressed TCR α-chain and β-chain and the endogenously expressed TCR of T cells, resulting in non-specific recognition. The chimeric TCR constructed from the mouse constant region still maintains the HLA-dependent antigenic epitope-specific recognition and activation of the TCR very well. According to an embodiment of the present invention, the TCR can also be composed of a variable region from a human TCR and a human constant region.

[0027] According to an embodiment of the present invention, the TCR may be a single-chain TCR (scTCR) or a chimeric TCR dimer.

[0028] According to an embodiment of the present invention, the amino acid sequence of the TCR is as shown in any one of SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, and SEQ ID NO:146.

[0029] According to an embodiment of the present invention, the TCR may be an antigen-binding fragment of a TCR or a chimeric antigen receptor (CAR), wherein the antigen-binding fragment of the TCR may be selectively linked to a transmembrane or intracellular signal transduction domain.

[0030] According to an embodiment of the present invention, the T-cell receptor is at least one soluble TCR.

[0031] According to an embodiment of the present invention, the T-cell receptor can be modified. In one embodiment of the present invention, the T-cell receptor can undergo post-translational modifications such as glycosylation, phosphorylation, acetylation, and disulfide bond engineering.

[0032] According to an embodiment of the present invention, the T-cell receptor may be fused with a functional domain, such as the CD28 co-stimulatory domain.

[0033] According to embodiments of the present invention, the T-cell receptor may bind to a detectable marker, a therapeutic agent, or be PEGylated. In one embodiment of the present invention, the T-cell receptor may form a TCR engager with an anti-CD3 antibody. The TCR portion of this complex specifically recognizes and binds to the MageA1160-169KEADPTGHSY polypeptide epitope presented by the HLA-B*15:01 molecule on the surface of tumor cells, while the anti-CD3 antibody portion binds to T-cells, causing the T-cells to direct to the tumor cells and kill them.

[0034] According to an embodiment of the present invention, the T-cell receptor is highly specific, specifically recognizing the MageA1 polypeptide epitope (SEQ ID NO:137) without any cross-reactivity.

[0035] According to embodiments of the present invention, the binding or response of the T-cell receptor to the MageA1 polypeptide epitope (SEQ ID NO: 137) is concentration-dependent. In one embodiment of the present invention, the concentration of MageA1 exhibits a significant dose-response effect at concentrations ranging from 10 μg / ml to 1 ng / ml.

[0036] According to an embodiment of the present invention, the T-cell receptor binds to the MageA1 polypeptide epitope (SEQ ID NO: 137) presented by HLA-B*15 to activate or enhance the immune response.

[0037] According to an embodiment of the present invention, the binding of the T-cell receptor to the MageA1 polypeptide epitope (SEQ ID NO: 137) presented by HLA-B*15 promotes or induces effector cells to express cytokines such as CD107a, IFN-γ, TNF-α (tumor necrosis factor), and IL-2. Furthermore, these cytokines can enhance the immune response and promote the proliferation and function of T cells.

[0038] According to an embodiment of the present invention, the IFN-γ secretion induced by the binding of the T-cell receptor to the MageA1 polypeptide epitope (SEQ ID NO: 137) presented by HLA-B*15 can exceed 500 pg / ml, for example, exceeding 1000 pg / ml, exceeding 2000 pg / ml, more preferably exceeding 4000 pg / ml, and most preferably even exceeding 5000 pg / ml. This is in contrast to unrelated peptides presented by HLA-B*15 (e.g., MageA1). 162-169 Compared to binding with HLA-B*15, binding with the MageA1 peptide epitope (SEQ ID NO:137) presented by HLA-B*15 can increase IFN-γ secretion by at least 4 times.

[0039] According to an embodiment of the present invention, the T-cell receptor binds to the MageA1 polypeptide epitope (SEQ ID NO: 137) presented by HLA-B*15 to induce effector cells to express CD137.

[0040] According to an embodiment of the present invention, the binding of the T-cell receptor to the MageA1 polypeptide epitope (SEQ ID NO: 137) presented by HLA-B*15 can enhance the killing activity of effector cells against target cells.

[0041] According to embodiments of the present invention, the effector cells may be peripheral blood lymphocytes (PBLs) or peripheral blood mononuclear cells (PBMCs). Typically, the effector cells are immune effector cells, especially T cells.

[0042] According to an embodiment of the present invention, the target cells are tumor cells expressing MageA1. In one embodiment of the present invention, the target cells include not only tumor cells endogenously expressing MageA1, but also tumor cells exogenously expressing MageA1.

[0043] According to embodiments of the present invention, the tumor cells include, but are not limited to, lung cancer cells, melanoma cells, small cell lung cancer cells, and non-small cell lung cancer cells.

[0044] In a second aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence or its complementary sequence encoding a TCR that recognizes the MageA1 polypeptide epitope presented by HLA-B15:01 as described in the first aspect.

[0045] According to an embodiment of the present invention, the nucleic acid is obtained by gene rearrangement of the TRAV-gene and TRAJ-gene, or the TRBV-gene and TRBJ-gene. In one embodiment of the present invention, the TRAV-gene, TRAJ-gene, TRBV-gene, and TRBJ-gene are selected from the corresponding TRAV, TRAJ, TRBV, and TRBJ nucleic acid sequences of TCR clone N5.3 in Table 3 of the specification, or have at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with them.

[0046] According to an embodiment of the present invention, the α chain of the T-cell receptor comprises a variable region encoded by the following genes:

[0047] The amino acid sequence encoded by the rearrangement of the TRAV1-2 and TRAJ27 genes, or having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown therein.

[0048] According to an embodiment of the present invention, the β chain of the T-cell receptor contains a variable region encoded by the following genes:

[0049] The amino acid sequence encoded by the rearrangement of the TRBV4-3 and TRBJ1-5 genes; or having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence shown therein.

[0050] According to an embodiment of the present invention, the constant region TRA C-gene and TRB C-gene are selected from human or mouse genes or their mutants. In one embodiment of the present invention, the mutation is a point mutation, used to enhance the effective pairing of the co-expressed TCR β and α chains, and to avoid non-specific recognition caused by mismatch with the original T-cell TCR.

[0051] According to an embodiment of the present invention, the nucleic acid sequence encoding the TCRβ-chain variable region is shown in SEQ ID NO:55, and the nucleic acid sequence encoding the TCRα-chain variable region is shown in SEQ ID NO:57.

[0052] According to embodiments of the present invention, the nucleic acid sequences encoding the TCRβ-chain constant region are shown in SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:210, and SEQ ID NO:212, and the nucleic acid sequences encoding the TCRα-chain constant region are shown in SEQ ID NO:83, SEQ ID NO:89, SEQ ID NO:99, and SEQ ID NO:208.

[0053] According to embodiments of the present invention, the nucleic acid sequences encoding TCR are such as SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, and SEQ ID NO:145.

[0054] In a third aspect, the present invention provides an expression vector comprising the above-described nucleic acid molecule or expressing the T-cell receptor.

[0055] According to an embodiment of the present invention, the expression vector includes a viral vector or a non-viral vector.

[0056] According to an embodiment of the present invention, the viral vector is a retroviral vector, a lentiviral vector, or an adenovirus.

[0057] In a fourth aspect, the present invention provides an engineered cell comprising any cell suitable for expressing the above-described TCR and activating an immune response.

[0058] According to an embodiment of the present invention, the engineered cells contain at least one anti-MageA1 T-cell receptor, wherein MageA1 is HLA-B restricted, and wherein MageA1 is MageA1 160-169 Antigenic epitopes composed of KEADPTGHSYSEQ.

[0059] According to an embodiment of the present invention, the HLA-B is the HLA-B*15:01 subtype.

[0060] According to an embodiment of the present invention, the engineered cell is a stem cell or a T cell.

[0061] According to an embodiment of the present invention, the engineered cells comprise the aforementioned nucleic acid molecules or expression vectors.

[0062] According to an embodiment of the present invention, a T cell receptor (TCR) is introduced into a T cell for clonal modification to obtain engineered T cells. When the T cell receptor binds to the MageA1 polypeptide epitope, the engineered T cells can be activated.

[0063] According to an embodiment of the present invention, the binding of the T cell receptor to the MageA1 polypeptide epitope is concentration-dependent, and the concentration of MageA1 is from 10 μg / ml to 1 ng / ml.

[0064] According to an embodiment of the present invention, the activated engineered T cells express the CD137 receptor.

[0065] According to an embodiment of the present invention, the activated engineered T cells can release cytokines, such as CD107a, interferon-gamma, TNF-α (tumor necrosis factor), IL-2, etc. Furthermore, these cytokines can enhance the immune response and promote the proliferation and function of T cells.

[0066] According to an embodiment of the present invention, the activated engineered T cells have degranulation function and cytotoxicity, and have the ability to kill target cells.

[0067] According to an embodiment of the present invention, the target cells include tumor cells and K562 cells. In one embodiment of the present invention, the tumor cells are melanoma cells or lung cancer cells.

[0068] According to an embodiment of the present invention, a CRISPR-Cas system can be used, or the RNA can be transcribed in vitro into mRNA and then introduced into the cells via electroporation.

[0069] In a fifth aspect, the present invention provides a pharmaceutical composition comprising any of the above-described TCRs, any of the above-described nucleic acid molecules, any of the above-described carriers, or any of the above-described cells as active ingredients.

[0070] According to embodiments of the present invention, the pharmaceutical composition further includes other immunomodulatory factors, forming a pharmaceutical combination with therapeutic effects. Preferably, the active ingredient has a synergistic effect with other immunomodulatory factors.

[0071] In a sixth aspect, the present invention provides a tumor detection method using the aforementioned anti-MageA1 T-cell receptor.

[0072] According to an embodiment of the present invention, the expression of the MageA1 polypeptide epitope presented by HLA-B*15:01 was detected using the anti-MageA1 T-cell receptor.

[0073] In a seventh aspect, the present invention provides the use of the above-mentioned T-cell receptor, nucleic acid molecule, expression vector, host cell or pharmaceutical composition in the preparation of a medicament for treating and preventing tumors.

[0074] According to an embodiment of the present invention, the drug can improve therapeutic efficacy and reduce side effects.

[0075] According to embodiments of the present invention, the tumors include acute lymphoblastic carcinoma, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer, breast cancer, anal cancer, anal canal or anorectal cancer, intrahepatic bile duct cancer, joint cancer, neck, gallbladder or pleural cancer, nasal cavity or middle ear cancer, oral cancer, vulvar cancer, chronic lymphocytic leukemia, chronic myeloid carcinoma, colon cancer, esophageal cancer, cervical cancer, gastrointestinal carcinoids, Hodgkin's lymphoma, hypopharyngeal cancer, kidney cancer, laryngeal cancer, liver cancer, lung cancer, malignant mesothelioma, melanoma, multiple myeloma, nasopharyngeal carcinoma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, peritoneal, omental and mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, kidney cancer (e.g., renal cell carcinoma (RCC)), small bowel cancer, soft tissue cancer, gastric cancer, testicular cancer, thyroid cancer, ureteral cancer and bladder cancer. Preferably, the cancer is melanoma.

[0076] An eighth aspect of the present invention provides a method for preparing at least one MageA1 epitope-responsive exogenous T cell receptor, the method comprising:

[0077] (a) Isolating tumor tissue from at least one melanoma individual and sorting at least one MageA1 from the tumor tissue. 160-169 Epitope-responsive CD8+ T cells, wherein the epitope is composed of the amino acid KEADPTGHSYSEQ;

[0078] (b) at least one MageA1 sorted by step (a) 160-169 Epitope-reactive CD8+ T cell clones encode at least one polynucleotide of at least one α chain of at least one T cell receptor and at least one polynucleotide of at least one β chain of at least one T cell receptor;

[0079] (c) Delivering the polynucleotide from step (b) to at least one cell; and

[0080] (d) Expressing MageA1 in cells suitable for the expression of the MageA1160-169 Cells produced in (c) under the condition of epitope-reactive exogenous T cell receptors.

[0081] In a ninth aspect, the present invention provides an isolated HLA-peptide target, the HLA-peptide target comprising an HLA class I molecule and a restriction peptide, the restriction peptide comprising the sequence KEADPTGHSYSEQ, and the HLA class I molecule being an HLA subtype B*15:01.

[0082] Compared with the prior art, the present invention has the following beneficial effects:

[0083] This invention isolates an HLA-B*15:01-restricted TCR, N5.3 targeting MageA1 from tumor tissue-derived T-cell cultures. Through immunoprecipitation and MS analysis, and subsequent immunological assays, we determined that the peptide epitope recognized by N5.3 is MageA1. 160-169 KEADPTGHSY. N5.3 recognizes highly specific epitopes with no cross-reactivity. N5.3 TCR-T cells exhibit specific recognition and effective killing of target cells and different tumor cell lines, demonstrating their promising application in tumor treatment and prevention.

[0084] The N5.3 TCR of this invention is HLA-B*15:01 restricted. According to the Allele Frequency Net Database, the proportion of HLA-B*15:01 carriers in Caucasians is about 10%, while the proportion of carriers of this allele is even higher in Chinese people. This indicates that N5.3 TCR has significant clinical application prospects in HLA-B*15:01 high-frequency regions such as China, and can provide more precise and effective immunotherapy for more patients.

[0085] Most existing TCRs targeting MageA1 are HLA-A*02:01 restricted. This TCR recognizes a peptide epitope that has been discovered for the first time. This epitope can be effectively presented in tumor tissue and stimulate anti-tumor T-cell responses, indicating that it possesses anti-tumor immunological activity. This epitope could be used to develop anti-tumor peptide vaccines or to construct mRNA vaccines encoded by mRNA for tumor prevention and treatment.

[0086] This invention is the first to isolate and identify a TCR targeting the MageA1160-169KEADPTGHSY peptide epitope presented by the HLA-B*15:01 molecule. This is the world's first discovery that MageA1 can be presented by the HLA-B*15:01 molecule and effectively stimulate T-cells with anti-tumor activity. This newly discovered TCR can be used to construct TCR expression lentiviral vectors and modify T-cells through vector-mediated gene delivery to prepare TCR-T cells for the treatment of tumor patients carrying the HLA-B*15:01 allele and expressing MageA1. Currently, most existing and clinically tested MageA1-targeting TCRs target epitopes presented by the HLA-A*02:01 molecule and are only applicable to patients carrying the HLA-A*02:01 allele.

[0087] Furthermore, this TCR was isolated from tumor-derived T cells, which possess good tumor cell killing activity. A series of immunological analyses demonstrated that this TCR has good immunological and target cell killing activity, and exhibits excellent target specificity. This TCR can only recognize the epitope of MageA1 that has been naturally processed and loaded into HLA-B*15:01 within cells. Although the amino acid sequence of this epitope in the MageA1 protein has very high sequence similarity to the same position in other members of the MAGE family, this TCR does not recognize other similar sequences, or the peptides presented after intracellular processing of these proteins. This indicates that this TCR has very good antigen recognition specificity and will not cause off-target effects or other adverse events (AEs) due to nonspecific cross-recognition during clinical trials.

[0088] Tumor tissues are rich in T-cell clones with cytotoxic activity against autologous tumor cells, and tumor cells continuously stimulate and select for the clonal proliferation of T-cells with immune activity against autologous tumor cells. Therefore, using tumor tissue-derived T-cells to screen and isolate T-cell clones with cytotoxic activity against tumor cells, and identifying their recognized antigens, epitopes, and matching HLA molecules, can not only discover new anti-tumor active epitopes but also represent a truly unbiased screening process. TCRs screened using this method exhibit good anti-tumor immunological activity and excellent safety, without off-target risks. Attached Figure Description

[0089] Figure 1A The results of co-culturing T cells and tumor cells;

[0090] Figure 1B The results show the detection of CD137, an activation marker, after co-culture of T cells and tumor cells.

[0091] Figure 1CThe results of RT-PCR analysis of tumor-associated antigen expression in this tumor tissue were obtained.

[0092] Figure 1D The results of targeted antigen detection in tumor tissue-derived T cell cultures;

[0093] Figure 1E Flow cytometry plot of CD137 expression in CD3+CD8+ cytotoxic T-cell subsets;

[0094] Figure 2A Results of in-depth quantitative analysis of the total T cell TCR library in tumor tissue;

[0095] Figure 2B Results of in-depth quantitative analysis of the total T cell TCR library in tumor tissue;

[0096] Figure 2C This is a schematic diagram of the structure of a lentiviral vector for TCR expression;

[0097] Figure 2D Flow cytometry bar chart of CD137, a T cell activation marker modified by different TCR clones;

[0098] Figure 2E Raw flow cytometry plot of CD137, a T cell activation marker modified by different TCR clones;

[0099] Figure 3A Flow cytometry plot of CD137, a T cell activation marker, after co-culturing N5.3 TCR-T cells with K562 cells;

[0100] Figure 3B Flow cytometry plot of CD137, a T cell activation marker, after co-culturing N5.3 TCR-T cells with HMy2.CIR cells;

[0101] Figure 3C The raw flow cytometry image of CD137, a T cell activation marker, after co-culturing N5.3 TCR-T cells with K562 cells;

[0102] Figure 3D The raw flow cytometry image of CD137, a T cell activation marker, after co-culturing N5.3 TCR-T cells with HMy2.CIR cells;

[0103] Figure 3E Flow cytometry plot of CD137, a T cell activation marker, after co-culturing N5.3 TCR-T cells with K562 cells expressing different restriction peptides;

[0104] Figure 3F Flow cytometry plot of CD137, a T cell activation marker, after co-culturing N5.3 TCR-T cells with HMy2.CIR cells expressing different restriction peptides;

[0105] Figure 3G The raw flow cytometry image of CD137, a T cell activation marker, after co-culturing N5.3 TCR-T cells with K562 cells expressing different restriction peptides;

[0106] Figure 3H The raw flow cytometry image of CD137, a T cell activation marker, after co-culturing N5.3 TCR-T cells with HMy2.CIR cells expressing different restriction peptides;

[0107] Figure 4A The image shows the CD137 expression results of N5.3 TCR-T cells after co-culturing with cells loaded with different predicted peptides;

[0108] Figure 4B The image shows the CD137 expression results after co-culturing N5.3 TCR-T cells with HMy2.CIR cells loaded with different predictive peptides;

[0109] Figure 4C The image shows the CD137 expression results after co-culturing N5.3 TCR-T cells with autoantigen-presenting cells loaded with different predictive peptides.

[0110] Figure 4D The results of CD137 expression in CD8+ cytotoxic TCR-T cells were analyzed by flow cytometry using N5.3 TCR-T cells and HMy2 cells loaded with different predictive peptides.

[0111] Figure 4E Results of IFN-γ concentration detection by HMy2.CIR ELISA in N5.3 TCR-T cells with different predicted peptides;

[0112] Figure 4F The original flow cytometry plot of CD137 expression after co-culturing N5.3 TCR-T cells with HMy2.CIR cells loaded with different predicted peptides;

[0113] Figure 4G The original flow cytometry plot of CD137 expression after co-culturing N5.3 TCR-T cells with HMy2.CIR blank cells loaded with different predicted peptides;

[0114] Figure 4H This is a secondary mass spectrum of the peptide MageA1160-169 KEADPTGHSY.

[0115] Figure 5A The sequence is a full-length protein sequence with similarity to the given sequence.

[0116] Figure 5BThe image shows the CD137 expression results after co-culturing N5.3 TCR-T cells with HMy2.CIR cells loaded with MageA1-like sequences.

[0117] Figure 5C The results of IFN-γ concentration detection in N5.3 TCR-T cells using HMy2.CIR ELISA with a sequence similar to MageA1 were obtained.

[0118] Figure 5D The original flow cytometry plot of CD137 expression after co-culturing N5.3 TCR-T cells with HMy2.CIR cells loaded with MageA1-like sequences;

[0119] Figure 5E The image shows the CD137 expression results of N5.3 TCR-T cells co-cultured with HMy2.CIR cells loaded with HLA-B*15:01 and MageA1 similar sequences or AY1206 cells;

[0120] Figure 5F The original flow cytometry plot of CD137 expression in N5.3 TCR-T cells after co-culturing with AY1206 cells loaded with HLA-B*15:01 and MageA1 similar sequences;

[0121] Figure 5G The original flow cytometry plot of CD137 expression after co-culturing N5.3 TCR-T cells with HMy2.CIR cells loaded with similar sequences of HLA-B*15:01 and MageA1;

[0122] Figure 6 N5.3 TCR-T cells were loaded with different concentrations of MageA1. 160-169 Original flow cytometry plot of CD137 expression of KEADPTGHSY peptide after co-culturing HMy2.CIR cells;

[0123] Figure 7A The results of CD107a extravasation in CD8+ cytotoxic TCR-T cells after co-culturing N5.3 TCR-T cells with HMy2.CIR cells;

[0124] Figure 7B The image shows the expression of gamma interferon in CD8+ cytotoxic TCR-T cells after co-culturing N5.3 TCR-T cells and HMy2.CIR cells.

[0125] Figure 8A After co-culturing N5.3 TCR-T cells or T cells with K562 cells, the results of target cell killing were analyzed by flow cytometry.

[0126] Figure 8BAfter co-culturing N5.3 TCR-T cells or T cells with K562 cells, the results of target cell killing were analyzed by flow cytometry.

[0127] Figure 8C Immunoassay results of CD137 expression after co-culturing N5.3 TCR-T cells with human tumor cell lines;

[0128] Figure 8D Flow cytometry plot of CD137 expression in N5.3 TCR-T cells co-cultured with SHP77.

[0129] Figure 8E Flow cytometry plot of CD137 expression in N5.3 TCR-T cells co-cultured with H1299.

[0130] Figure 8F Flow cytometry plot of CD137 expression in N5.3 TCR-T cells co-cultured with AY1206. Detailed Implementation

[0131] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0132] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.

[0133] HMy2.CIR is a B lymphoblastic cell line that does not express HLA-A or HLA-B genes, but expresses a small amount of HLA-ACw4. It is a commonly used target cell line for immunoassays. RT-PCR detection shows that this cell line does not express MageA1. HMy2.CIR cells are easy to culture in vitro and have a high lentiviral infection rate, exceeding 90%. Through lentiviral vector-mediated gene delivery, HMy2.CIR cells are used to construct cells expressing different antigen genes and HLA alleles for various analyses and sequencing in TCR screening. All HMy2.CIR cell lines are purchased from the Cell Bank of the Chinese Academy of Sciences, Shanghai.

[0134] Artificial antigen-presenting cells (aAPCs)

[0135] aAPCs are genetically engineered cells that mimic natural antigen-presenting cells (such as dendritic cells) to activate T cells. aAPCs are commonly used in in vitro culture to help activate and expand tumor-specific T cells, particularly in cancer immunotherapy. aAPCs can initiate an immune response against tumors by carrying specific tumor antigens (such as MAGE-A1). These artificial cells not only carry antigens but also provide co-stimulatory signals (such as CD80, CD86, etc.) to promote T cell activation and proliferation.

[0136] Complementarity Determining Region 3 (CDR3) is the most critical region for TCR antigen recognition, located in the V(D)J rearrangement region of the TCR α and β chains. Its sequence is the core component determining TCR specificity. The diversity of CDR3 sequences determines the TCR's antigen recognition specificity. Each T cell clone has a unique CDR3 sequence, used to characterize the clone's specificity. In experiments, by analyzing CDR3 sequences, the antigen specificity of each TCR clone can be determined and correlated with the immune response to tumor or MageA1 antigen.

[0137] TRAV1-2 are variable region genes of the α chain, responsible for antigen recognition diversity. TRAJ27 is a linker gene of the α chain, connecting with the TRAV and TRAC genes to further increase TCR diversity. TRAC is a constant gene of the α chain, providing structural stability and signal transduction functions. These three genes collectively determine the structure and function of the TCR α chain, with the diversity of TRAV and TRAJ being a key source of TCR-specific antigen recognition.

[0138] The term “identical” or “identity” percentage refers to two or more sequences or subsequences that are identical or have (i.e., at least) a specific percentage of amino acid residues or nucleotides that are identical by means of sequence comparison algorithms or by manual alignment and visual inspection (i.e., in a specified region, when comparisons and alignments are performed on a comparison window or specified region to obtain maximum correspondence, preferably in the full-length sequence, having or at least about 90% identity, preferably having or at least 91%, 92%, 93% or 94% identity, more preferably having or at least about 95%, 96%, 97%, 98%, 99% or higher identity) (see, for example, the NCBI website). In some implementations, for example, when comparing the protein or nucleic acid sequence of the T-cell receptor of the present invention with another protein / gene, the percentage of identity can be determined via a Blast search supported by Human Olfactory Data Explorer (e.g., https: / / genome.weizmann.ac.il / cgi-bin / horde / blastHorde.pl); particularly for determining amino acid identity, a BLASTP 2.2.28+ search with the following parameters is used: matrix: BLOSUM62; void penalty: presence: 11, expansion: 1; adjacent word threshold: 11; multiple hit window: 40.

[0139] The term "comprising" in any embodiment of the invention should be understood to include, in some preferred embodiments, a more stringent description of the same features of the invention as being "consistent" or "substantially constituted" by the same features of the invention.

[0140] In some implementations, the TCR can be divided into αβTCR and γδTCR. 95% of T cells are αβTCR, and only 5% are γδTCR. αβTCR consists of an α-chain (TCRa) and a β-chain (TCRb), both of which are transmembrane proteins linked by disulfide bonds to form a heterodimer. The extramembrane portions of both the α-chain and β-chain each contain two Ig-like domains: a constant region (C-domain) near the membrane and a variable region (V-domain) distal to the membrane. The V-domains of both the α-chain and β-chain together constitute the antigen-binding portion of the TCR. The variable regions of both the α-chain and β-chain consist of three complementarity-determining regions, CDR1, CDR2, and CDR3. CDR1 and CDR2 are encoded by the V gene, and these two regions are involved in binding to MHC molecules. CDR3 is encoded by the linker region between V and J or D and J. CDR3 exhibits the greatest variability and participates in binding to the MHC-peptide complex, serving as a key sequence determining the antigen specificity of the TCR. The high sequence diversity of CDR3 is a key factor in the diversity of antigens recognized by the TCR. CDR1 and CDR2 sequences can be selected from the CDR sequences of human variable strand alleles.

[0141] In some implementations, the natural α-β heterodimer TCR has an α chain and a β chain. Each chain includes variable, linking, and constant regions, and the β chain typically also includes a short, diverse region between the variable and linking regions, but this diverse region is often considered part of the linking region. Each variable region includes three CDRs (complementarity-determining regions) embedded in the frame sequence, one of which is a highly variable region called CDR3. Several types of α-chain variable (Vα) regions and several types of β-chain variable (Vβ) regions exist, distinguished by their frame, CDR1 and CDR2 sequences, and partially defined CDR3 sequences. Vα types are referred to by TRAV numbers (e.g., the corresponding TRAV1-2, TRAJ27, and TRAC for TCR clonotype N5.3 in Table 3 of the specification), and Vβ types are referred to by TRBV numbers (e.g., the corresponding TRBV4-3, TRBC1, and TRBJ1-5 for TCR clonotype N5.3 in Table 3 of the specification). For more information on the TCR gene, see the International Immunogenetic Information Lefranc MP et al. (Nucleic Acids Res. 2015 Jan; 43 (Database issue): D413-22; and http: / / www.imgt.org /

[0142] In some embodiments, the TCR of the present invention may be a single-chain α or β, or γ and δ molecule, or a double-chain construct consisting of both α and β chains or γ and δ chains. The TCR of the present invention may comprise a TCRα or γ chain; and / or a TCRβ or δ chain; wherein the TCRα or γ chain comprises a CDR3 having at least 90%, 95%, 98%, 99%, or 100% sequence identity with an amino acid sequence selected from SEQ ID NO. 2, and / or wherein the TCRβ or δ chain comprises a CDR3 having at least 90%, 95%, 98%, 99%, or 100% sequence identity with an amino acid sequence selected from SEQ ID NO. 3. In some embodiments, the TCR may be a functional variable region portion of a T-cell receptor that specifically binds to an antigen. In some embodiments, the TCR may be of the single-chain type, wherein the TCRα chain and the TCRβ chain are linked by a linker sequence. Linker sequences include, but are not limited to, hydrophilic polymers and peptide linkers. The most commonly used hydrophilic polymers are polyethylene glycol (PEG), polypropylene glycol, and copolymers of ethylene glycol and propylene glycol. Peptide linkers contain amino acid chains.

[0143] In some embodiments, the TCR of the present invention may further include a constant region derived from any suitable species, such as any mammal, for example: human, rat, monkey, rabbit, donkey, or mouse. In one embodiment of the present invention, the TCR of the present invention further includes a human constant region. In some preferred embodiments, the constant region of the TCR of the present invention may be slightly modified, for example, by introducing a heterologous sequence, preferably a mouse sequence, which may increase the expression and stability of the TCR.

[0144] In some embodiments, the amino acid sequence of the TCR is modified to include a detectable label, a therapeutic agent, or a pharmacokinetic modification moiety. Non-limiting examples of detectable labels include radiolabels, fluorescent labels, nucleic acid probes, enzymes, and contrast agents. Therapeutic agents that can associate with the TCR include radioactive compounds, immunomodulators, enzymes, or chemotherapeutic agents. The therapeutic agent can be encapsulated by a liposome linked to the TCR, allowing for slow release of the compound at the target site. The pharmacokinetic modification moiety can be, for example, at least one polyethylene glycol repeating unit, at least one glycol group, at least one sialic acid group, or a combination thereof.

[0145] In some embodiments, the term "soluble TCR" refers to a TCR in a soluble form (i.e., without transmembrane or cytoplasmic domains), for example, as a targeting agent for delivering therapeutic agents to antigen-presenting cells. For stability, soluble αβ heterodimer TCRs preferably have introduced disulfide bonds between residues of their respective constant domains, as described, for example, in WO 03 / 020763. One or two constant domains present in the αβ heterodimer of the present invention may be truncated at one or both C-termini, for example, by up to 15, 10, 8, or fewer amino acids. The TCR may contain disulfide bonds corresponding to those found in nature between the respective α and β constant domains; additionally or alternatively, non-natural disulfide bonds may be present.

[0146] As used in this article, “nucleic acid” includes “polynucleotides,” “oligonucleotides,” and “nucleic acid molecules,” which generally refer to polymers of DNA or RNA that can be single-stranded or double-stranded, synthetic or derived from natural sources (e.g., isolated and / or purified), that can contain natural, non-natural, or modified nucleotides, and that can contain natural, non-natural, or modified internucleotide linkages, such as phosphoamidate linkages or thiophosphate linkages.

[0147] The term "vector" is any molecule or composition capable of carrying a nucleic acid sequence into a suitable host cell, in which the synthesis of the encoded polypeptide can occur. Typically and preferably, a vector is a nucleic acid that has been engineered using recombinant DNA techniques known in the art to introduce a desired nucleic acid sequence (e.g., the nucleic acid of the present invention). A vector may contain DNA or RNA and / or liposomes. A vector may be a plasmid, shuttle vector, phage particle, granule, expression vector, retroviral vector, lentiviral vector, adenoviral vector, or a particle and / or vector for gene therapy. A vector may include a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known to those skilled in the art. The vector is preferably an expression vector containing a nucleic acid according to the present invention, said nucleic acid being operatively linked to a sequence that allows said nucleic acid to be expressed.

[0148] The experimental methods used in the embodiments of this invention are as follows:

[0149] 1. Construction of a lentiviral vector expressing human MageA1

[0150] The human MageA1 gene sequence (Accession number: NM_004988.5) was obtained from GenBank, and the portion encoding the MageA1 protein sequence was extracted (MageA1 gene sequence as shown in SEQ ID NO:1, MageA1 protein sequence as shown in SEQ ID NO:2). The full-length human MageA1 gene DNA was synthesized by Nanjing GenScript and cloned into the multiple cloning site of a third-generation replicable defective lentiviral vector (pCDH-EF1α-MCS Cloning and Expression Lentivector, System Biosciences). One tube of 293T / 17 cells (purchased from the Cell Bank of the Chinese Academy of Sciences, Shanghai) was resuscitated from liquid nitrogen, washed once with 10 ml of DMEM (Hyclone, Cytiva) and 10% FBS (EcoSyne), centrifuged, resuspended in 10 ml of DMEM and 10% FBS, and seeded into a 100 mm cell culture dish (cornering). Cells were passaged every 2 days at a ratio of 1:3. After 3 passages, the cells were in good condition and growing vigorously. Take 293T / 17 cells that have been cultured for 2 days and are in good condition and are 100% fully spread in the culture dish. After digestion, transfer them to 100mm cell culture dishes at a ratio of 1:3. Add 10ml of DMEM and 10% FBS to each dish and place them in a CO2 incubator.

[0151] The next day, the lentivirus was packaged. Transfection reagents were prepared; the following is the preparation method for each tray of cells:

[0152] Take a 1.5ml EP tube, add 0.5ml of DMEM (Hyclone, Cytiva), and then add the following DNA:

[0153] Lentivector (lentiviral vector carrying the MageA1 gene): 5000 ng DNA

[0154] pMDLg-pRRE: 2500ng

[0155] pRSV-Rev: 1500ng

[0156] pMD2.G(NT03): 1000ng

[0157] Take another 1.5ml EP tube, add 0.5ml DMEM, add 30μl PEI solution (Polysciences), incubate at room temperature for 5 minutes, then add the PEI-added DMEM solution to the DMEM tube containing DNA, mix well, and incubate at room temperature for 20 minutes. During incubation, remove the 293T / 17 cells from the CO2 incubator, aspirate the old culture medium, and add 10ml fresh DMEM 10% FBS. After incubation, add the PEI-DNA DMEM infection reagent to the cell culture dish, and then return the cells to the CO2 incubator. On the second day after transfection, remove the cells from the CO2 incubator, aspirate the old culture medium, and add 10ml fresh DMEM 10% FBS. Harvest the virus at 48 hours and 72 hours post-transfection. When harvesting the virus, aspirate the culture supernatant with a pipette and place it in a 50ml centrifuge tube. Add 10ml fresh DMEM 10% FBS to the cell culture dish and return the cells to the CO2 incubator for further culture. The harvested viral supernatant was centrifuged at 3500 RPM for 20 minutes. After centrifugation, the viral supernatant was aliquoted into 1.5 ml EP tubes, with 1 ml of viral supernatant added to each EP tube. The virus was stored at -80°C.

[0158] 2. Preparation of autologous APC cells expressing MageA1

[0159] Autologous CD4 T-cells were obtained from cancer patients, and the cells were processed at a ratio of 1×102 6Cells / ml were resuspended in X VIVO-15 (Lonza) and IL-2 was added to a final concentration of 3000 IU / ml. A 12-well plate coated with OKT3 and anti-CD28 antibody (prepared with PBS: OKT3 (Biolegend) 100 ng / ml, anti-CD28 antibody (Biolegend) 100 ng / ml; add 1 ml of the coating solution to each well and place at 4°C for use the next day) was aspirated. Each well was washed once with 1 ml of PBS, and then the PBS was aspirated. Prepared CD4 T-cells were added to the washed wells, 1 ml / well. The cells were then incubated in a CO2 incubator. The next day, lentiviral vector carrying the MageA1 gene was added to the activated CD4 T-cells, 1 ml of virus to each well, followed by 2 μl of 8 mg / ml Polybrene (Sigma). The cells were then returned to the CO2 incubator for further incubation. On the second day after viral infection, virus-infected cells were collected into 50ml centrifuge tubes and centrifuged at 1200RPM for 8 minutes. After centrifugation, the supernatant was discarded, and the cells were resuspended in 6ml of XVIVO-15. The resuspended cells were then transferred to a T25 flask, and IL-2 was added to a final concentration of 3000 IU / ml. The T25 flask was placed in a CO2 incubator and cultured upright. IL-2 was supplemented every 2 days (to a final concentration of 3000 IU / ml), and fresh XVIVO-15 was added as needed based on cell growth. The cells were ready for co-culture experiments after the 8th day of culture.

[0160] 3. Sorting anti-MageA1 cytotoxic T cells

[0161] T cells derived from tumor tissue were resuspended in 10% FBS (Cytiva) and the cell concentration was adjusted to 1×10⁻⁶. 6 Add IL-2 to a concentration of 1000 IU / ml. Take the prepared autologous APC cells expressing MageA1 and untransfected autologous cells (blank control), centrifuge at 1200 RPM for 8 minutes, discard the supernatant, resuspend the cells in 1640 g of 10% FBS, and adjust the cell concentration to 1 × 10⁻⁶ cells / ml. 6cells / ml. Take a 24-well plate and add 0.5 ml of cell suspension to each well, along with target cells expressing MageA1 and blank control cells. Then add 0.5 ml of cell suspension to each well containing either the target cells or blank control cells. After adding the cells, incubate them in a CO2 incubator. On the morning of the second day of co-culture, collect the cells from the wells into sterile aliquots and transfer them to flow cytometry tubes (BD) for flow cytometry staining. Add the flow cytometry antibodies: CD3-FITC, CD4-PE, CD8-PerCPCY5.5, and CD137-APC, and stain at room temperature for 20 minutes. Use BD FACSMelody. TM Cell Sorter sorting and co-culture of autologous APC cells expressing MageA1 specifically activated cytotoxic T cells. Flow cytometry compensation was adjusted using a single-stain tube, and a negative boundary was established using cell samples co-cultured with blank control cells. CD3+ was then sorted by flow cytometry. + CD8 + CD137 + Cell subpopulation. Capture at least 20,000 cells. Take 16,000 captured CD3+ cells. + CD8 + CD137 + Cells were loaded with 10× Genomics Chromium, followed by single-cell TCR library and 5' transcriptome library construction and sequencing. Each 5' transcriptome library underwent 100Gb sequencing, and each TCR library underwent 10Gb sequencing. Raw single-cell high-throughput sequencing data was processed using 10× Genomics Chromium, then used for single-cell TCR library and 5' transcriptome library construction and sequencing. Cell Ranger software was used to obtain gene expression quantification, VDJ assembly, and TCR sequences.

[0162] 4. Tumor tissue bulk TCR repertoire sequencing

[0163] Fresh tumor tissue was processed into a single-cell suspension and directly lysed in TRIzol reagent (Thermo Fisher) and stored at -80°C. Total RNA preparation was performed according to the TRIzol reagent instructions, briefly described below: For RNA preparation, the TRIzol lysis buffer was removed from the -80°C freezer, thawed to room temperature, and 0.2 ml of Chroloform was added. The mixture was thoroughly mixed and then centrifuged at 12000 RPM at 4°C for 15 minutes. After centrifugation, the supernatant was transferred to a new 1.5 ml EP tube. 0.5 ml of Isopropanol was added to the RNA-containing aqueous phase, and the mixture was thoroughly mixed. The mixture was incubated at 4°C for 10 minutes, then centrifuged at 12000 RPM at 4°C for 10 minutes. After centrifugation, the supernatant was carefully aspirated, leaving a white RNA precipitate at the bottom of the tube. The tube was washed once with 1 ml of 75% Ethanol and centrifuged at 12000 RPM for 5 minutes. After centrifugation, the supernatant was aspirated. The EP tube was incubated at room temperature for 5 minutes to allow residual ethanol to evaporate. RNA was dissolved in 100 μl of sterile ultrapure water. RNA concentration was measured using a Merinton SMA4000 UV-VIS Spectrophotometer. A total TCR library was constructed using the SMART-Seq Human TCR (with UMIs) kit (Takara). Preparation was performed according to the kit instructions. In brief: 1000 ng of total RNA from tumor tissue was used to prepare cDNA. The library was amplified by two PCR cycles according to the SMART-Seq Human TCR (with UMIs) instructions. For the first PCR, 20 μl of the prepared first strand of cDNA was added to hTCR PCR1 Universal Forward + hTCRa / hTCRb PCR1 reverse primer mixture (12 μM). The first PCR was performed for 18 cycles. After the first PCR, the PCR products were transferred to EP tubes and stored at -20°C. In the second PCR, the TRa- and TCRb- chains were amplified separately. 1 μl of the first PCR product was added as substrate for each reaction, using a Unique Dual Index Primer (Takara) for each reaction. PCR was performed for 20 cycles. After PCR, 5 μl of the product was added to a 1.6% agarose gel for electrophoresis to determine the PCR amplification size. The remaining 42 μl of PCR product was transferred to an EP tube and stored at -20°C. After the library passed the initial testing, it was purified and mixed with 30% PhiX control library to create a base-balanced library. High-throughput sequencing was then performed using the NextSeq2000 platform.After quality control and filtering, the high-throughput raw data is parsed using MiXCR and the same TCR sequence is identified using UMI sequence tags.

[0164] 5. RT-PCR analysis of gene expression in tumor tissue

[0165] Using PrimeScript TM cDNA was prepared using the IV 1st strand cDNA Synthesis Mix (Takara). Following the kit instructions, 1000 ng of total RNA from tumor tissue was added, followed by 1 μl of Random 6mers, then 4 μl of 5×PrimeScript IV cDNA Synthesis Mix. The mixture was incubated at 30°C for 10 minutes, then at 42°C for 20 minutes, and finally inactivated at 70°C for 15 minutes. PCR was performed using TaKaRa Ex Premier. TM DNA Polymerase, 20 μl total volume per reaction, using 1 μl cDNA and 1 μl gene-specific primer mixture (including direct and reverse primers). PCR reaction conditions: 94℃ for 1 min pre-denaturation, followed by 30 cycles of PCR reaction: 98℃ for 10 s, 60℃ for 15 s, and 68℃ for 30 s. After PCR, loading buffer was added, and the sample was loaded onto a 1.6% agarose gel using 1×TAE buffer, and electrophoresed at 90V for 1 hour. Images were taken using a Tanon 1600 gel imaging system.

[0166] 6. Co-culture assay of tumor tissue-derived T cells and autologous tumor cells

[0167] T cells derived from tumor tissue were resuspended in 10% FBS (Cytiva) and the cell concentration was adjusted to 1×10⁻⁶. 6 Cells / ml, add IL-2 to 1000 IU / ml. Examine the growth of autologous tumor cells under a microscope and take pictures using a microscopic imaging system. Aspirate the supernatant from the tumor cell culture wells and add 1 ml of prepared tumor tissue-derived T-cell suspension. Add another 1 ml of tumor tissue-derived T-cell suspension to a blank well without tumor cells in another cell culture plate as a negative control. Incubate in a CO2 incubator. The next morning, examine the viability of tumor cells under a microscope and take microscopic pictures. Then, harvest the cells and perform flow cytometry staining: CD3-FITC, CD4-PE, CD8-PerCPCY5.5, and CD137-APC, staining for 20 minutes at room temperature. Use BD Accuri TM C6 plus Flow Cytometer for sample analysis.

[0168] 7. Co-culture experiment

[0169] TCR-T cells or T-cells that do not express any exogenous genes (control) were harvested and resuspended in 1640 μL of 10% FBS to prepare 1×10⁻⁶ cells. 6 Cells / ml cell suspension. Target cells expressing different HLA alleles and antigens, loaded and unloaded peptides, and blank target cells expressing no exogenous genes were harvested and resuspended in 1640 10% FBS to prepare 1×10⁻⁶ cells / ml. 6 Cells / ml cell suspension. Take a 24-well plate, first add target cells, 0.5 ml of target cells to each well, then add TCR-T cells or control T- cells, also 0.5 ml to each well. After adding, incubate the cells in a CO2 incubator. The next day, harvest the supernatant and store it at -80℃ for cytokine detection; harvest the cells for flow cytometry analysis.

[0170] 8. Co-culture assay of adherent tumor cells

[0171] Tumor cells were digested with trypsin and sampled for cell counting. Cells were collected by centrifugation and then resuspended in 1640 μL of 10% FBS to adjust the cell concentration to 1 × 10⁻⁶ cells / mL. 6 Cells / ml cell suspension. Take a 24-well plate, add tumor cells, 0.5 ml of cell suspension to each well. The next day, first aspirate the old culture medium from the 24-well plate, then add 0.5 ml of fresh 1640 10% FBS to each well, followed by the addition of prepared TCR-T cells (1×10⁻⁶ cells / ml). 6 Cells / ml resuspended in 1640 μL of 10% FBS. Add 0.5 ml of TCR-T cells or control T-cells to each well. After addition, incubate the cells in a CO2 incubator. Harvest the cells the next day for flow cytometry analysis.

[0172] 9. Preparation of TCR-T cells

[0173] One healthy volunteer's PBMC was resuscitated from liquid nitrogen, thawed in a 37°C water bath, and resuspended in 25 ml X VIVO-15 (Lonza) for cell counting. Cells were centrifuged at 1200 RPM for 10 minutes, the supernatant was discarded, and the cells were resuspended in X VIVO-15 to adjust the cell concentration to 1×10⁻⁶. 6Cells / ml, add IL-2 to a final concentration of 500 IU / ml, add OKT3 (Biolegend) to 50 ng / ml. Take one 12-well plate and add 1 ml of PBMC cell suspension to each well. Incubate in a CO2 incubator. On the second day, add lentiviral vectors. Take out the lentiviral vectors carrying TCR from the -80℃ freezer, thaw, and add the virus to the cells separately, adding 1 ml of virus to each well in 2 wells. After adding the virus, add 2 μl of 8 mg / ml Polybrene (Sigma) to each well. Leave 2 wells without adding any virus as T cell controls. Return the cell plate to the CO2 incubator. On the second day after viral infection, harvest the cells from the 2 wells infected with the same virus into a centrifuge tube, centrifuge at 1200 RPM for 8 minutes, and aspirate the supernatant after centrifugation. Resuspend each cell type in 6 ml of X VIVO-15 solution, add IL-2 to a final concentration of 500 IU / ml, and place each cell sample in a separate T25 flask (Corning). Incubate the flasks upright in a CO2 incubator. Monitor cell growth daily, supplementing with IL-2 every two days (to a final concentration of 500 IU / ml). Once the culture medium turns noticeably yellow, supplement with X VIVO-15 again. Harvest cells between days 8 and 10 of culture for experimental use.

[0174] 10. Construction of HLA gene expression lentiviral vectors: HLA allele sequences, including: HLA-A*02:06 (sequence number: HLA00011, the gene sequence of HLA-A*02:06 is shown in SEQ ID NO:3, and the protein sequence is shown in SEQ ID NO:4), HLA-A*33:03 (HLA00106, the gene sequence of HLA-A*33:03 is shown in SEQ ID NO:5, and the protein sequence is shown in SEQ ID NO:6), HLA-B*15:01 (HLA00162, the gene sequence of HLA-B*15:01 is shown in SEQ ID NO:7, and the protein sequence is shown in SEQ ID NO:8), HLA-B*15:02 (HLA00165, the gene sequence of HLA-B*15:02 is shown in SEQ ID NO:9, and the protein sequence is shown in SEQ ID NO:8). The gene sequences of HLA-B*15:05 (HLA00168, the gene sequence of HLA-B*15:05 is shown in SEQ ID NO:11, and the protein sequence is shown in SEQ ID NO:12), HLA-B*58:01 (HLA00386, the gene sequence of HLA-B*58:01 is shown in SEQ ID NO:13, and the protein sequence is shown in SEQ ID NO:14), HLA-C*03:02 (HLA00410, the gene sequence of HLA-C*03:02 is shown in SEQ ID NO:15, and the protein sequence is shown in SEQ ID NO:16), and HLA-C*08:01 (HLA00445, the gene sequence of HLA-C*08:01 is shown in SEQ ID NO:17, and the protein sequence is shown in SEQ ID NO:18) were downloaded from the IPD-IMGT / HLA database. The MageA1 gene (Accession number: NM_004988.5), MageA10 gene (NM_021048.5, the gene sequence of MageA10 is shown in SEQ ID NO:19, and the protein sequence is shown in SEQ ID NO:20), and Puromycin gene sequences (the gene sequence of Puromycin is shown in SEQ ID NO:21, and the protein sequence is shown in SEQ ID NO:22) were downloaded from GenBank. Sequences co-expressing HLA alleles and antigen genes were designed, with the HLA alleles upstream, the P2A self-splicing polypeptide gene in the middle (the gene sequence of P2A is shown in SEQ ID NO:23, and the protein sequence is shown in SEQ ID NO:24), and the antigen genes (including MageA1, MageA10, or Puromycin) downstream.The gene sequence co-expressing HLA-A*0206-P2A-MageA1 is shown in SEQ ID NO:25, and the protein sequence is shown in SEQ ID NO:26. The gene sequence co-expressing HLA-A*33:03-P2A-MageA1 is shown in SEQ ID NO:27, and the protein sequence is shown in SEQ ID NO:28. The gene sequence co-expressing HLA-B*15:01-P2A-MageA1 is shown in SEQ ID NO:29, and the protein sequence is shown in SEQ ID NO:30. The gene sequence co-expressing HLA-B*58:01-P2A-MageA1 is shown in SEQ ID NO:31, and the protein sequence is shown in SEQ ID NO:32. The gene sequence co-expressing HLA-C*03:02-P2A-MageA1 is shown in SEQ ID NO:33, and the protein sequence is shown in SEQ ID NO:34. The gene sequence co-expressing HLA-C*08:01-P2A-MageA1 is shown in SEQ ID NO:35, and the protein sequence is shown in SEQ ID NO:36. The gene sequence co-expressing HLA-B*15:01-P2A-Puromycin is shown in SEQ ID NO:37, and the protein sequence is shown in SEQ ID NO:38. The gene sequence co-expressing HLA-B*15:02-P2A-Puro is shown in SEQ ID NO:39, and the protein sequence is shown in SEQ ID NO:40. The gene sequence co-expressing HLA-B*15:02-P2A-MageA1 is shown in SEQ ID NO:41, and the protein sequence is shown in SEQ ID NO:42. The gene sequence co-expressing HLA-B*15:05-P2A-Puromycin is shown in SEQ ID NO:43, and the protein sequence is shown in SEQ ID NO:44. The gene sequence co-expressing HLA-B*15:05-P2A-MageA1 is shown in SEQ ID NO:45, and the protein sequence is shown in SEQ ID NO:46. The gene sequence co-expressing HLA-B*15:01-P2A-MageA10 is shown in SEQ ID NO:47, and the protein sequence is shown in SEQ ID NO:48. Based on the designed sequences, Nanjing GenScript synthesized the full-length gene DNA, which was then cloned into a lentiviral expression vector, and finally the sequences were verified by sequencing.

[0175] 11. Preparation of target cells expressing HLA alleles and antigens

[0176] Target cells expressing HLA alleles and antigen genes were constructed using K562 and HMy2.CIR cell lines. K562, derived from a patient with chronic myeloid leukemia, does not express HLA genes and is a commonly used target cell line for cytotoxicity assays. HMy2.CIR is a B lymphoblastic cell line that does not express HLA-A and -B genes, but expresses a small amount of HLA Cw4; it is also a commonly used target cell line for immunoassays. Both K562 and HMy2.CIR cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai). The expressed genes were delivered to K562 and HMy2.CIR cells using a lentiviral vector. A tray of healthy K562 or HMy2.CIR cells was transferred to a 50ml centrifuge tube, and cells were sampled and counted. The cells were centrifuged at 1000 RPM for 8 minutes. After centrifugation, the supernatant was removed, and the cells were resuspended in 1640×10% FBS to adjust the cell concentration to 1×10⁻⁶ cells / mL. 6 cells / ml. Take a 60mm cell culture dish (Corning), first put 1ml of fresh 1640FBS 10% into each culture dish, then add 1ml of cell suspension (1×10) to each dish. 6 Cells / dish were added, followed by 2 ml of lentivirus carrying different HLA alleles and antigens, or 2 ml of 1640 10% FBS as a blank control. After adding the virus, 4 μl of 8 mg / ml Polybrene was added to each cell culture dish, and the cells were then placed in a CO2 incubator. On the second day after viral infection, the cells were transferred to 50 ml centrifuge tubes, centrifuged at 1000 RPM for 8 minutes, and the supernatant was discarded. Each sample was resuspended in 10 ml of 1640 10% FBS and then placed in a 100 mm cell culture dish and incubated in a CO2 incubator.

[0177] 12. MageA1 HLA-B*15:01 Peptide Immunoprecipitation and Mass Spectrometry Identification

[0178] Four trays of healthy HMy2.CIR cells were harvested and transferred to 50ml centrifuge tubes. Cell counting was performed, and the cells were centrifuged at 1000RPM for 8 minutes. After centrifugation, the supernatant was discarded, and the cells were resuspended in 1640 10% FBS to prepare 1×10⁻⁶ cells / tubes. 6 Cells / ml cell suspension. Take 20 60mm cell culture dishes, add 1ml of 1640 10% FBS to each dish, then add 1ml of cells (containing 1×10⁻⁶ cells / ml). 6 HMy2.CIR cells), then add virus, 2ml lentivirus per dish:

[0179] 1 disc of cells infected with B1501-Puro

[0180] 18 discs of cells infected with B1501-MageA1

[0181] One tray of cells was not infected with any virus; blank control.

[0182] After adding the virus, 4 μl of 8 mg / ml Polybrene was added to each cell culture dish, and the cells were then placed in a CO2 incubator. The next day, the virus-infected HMy2.CIR cells were transferred to 50 ml centrifuge tubes, centrifuged at 1000 RPM for 8 minutes, and the supernatant was discarded. Each cell aliquot was resuspended in 10 ml of 1640 10% FBS and placed in a 100 mm cell culture dish, then incubated in a CO2 incubator. On the third day after virus infection, HMy2.CIR cells expressing HLA-B*15:01-Puromycin, HLA-B*15:01-MageA1, and blank cells (without any exogenous gene expression) were co-cultured with N5.3 TCR-T cells and T-cells. Cells were collected on the second day of the co-culture experiment for flow cytometry analysis. Simultaneously, the expression of HLA-B*15:01 in HMy2.CIR cells was analyzed by flow cytometry. After verifying the above results, HMy2.CIR cells co-expressing HLA-B*15:01 and MageA1 were collected for immunoprecipitation and mass spectrometry identification of the peptide library. Seventeen 100mm cell culture dishes containing 10ml of HMy2.CIR cells co-expressing HLA-B*15:01 and MageA1 were harvested, with the cells in good condition. These 17 dishes of cells were transferred to four 50ml centrifuge tubes. The cells in each tube were centrifuged at 1000 RPM for 10 minutes, and the supernatant was discarded. 35ml of ice-cold PBS was added to each tube to fully resuspend the cells, and then the cells were centrifuged at 1000 RPM for 10 minutes. After centrifugation, the supernatant was discarded, and 35ml of ice-cold PBS was added to each tube to fully resuspend the cells. The cells were then centrifuged at 1000 RPM for 10 minutes, and the supernatant was discarded. Resuspend the cells in two tubes with 35 ml of PBS, then combine the cells from both tubes into one tube, for a total of two tubes. Centrifuge both tubes at 1000 RPM for 10 minutes. After centrifugation, cell clumps will be visible at the bottom of the tubes; aspirate the supernatant. Tightly cap the tubes. The final total cell count obtained from the two tubes is 14 × 10⁻⁶ cells / tube. 7Cells were rapidly frozen in liquid nitrogen in two centrifuge tubes and then stored at -80°C. Immunoprecipitation and peptide mass spectrometry identification were performed by Baizhen Biotechnology. Baizhen Biotechnology's NEODiscovery™ HLA-I Immunopeptide Enrichment Kit was used to enrich and elute type I HLA-peptides complexes in the samples. The enrichment process is briefly described as follows: cell samples were added to lysis buffer, incubated on ice for 60 minutes, sonicated for 5 minutes, centrifuged at high speed, and the supernatant was collected for subsequent immunopeptide enrichment. HLA-peptides complexes were purified by immunoprecipitation, and immunopeptides were separated using a reverse-phase column chromatography method. The collected components were analyzed by LC-MS / MS mass spectrometry. Mass spectrometry data acquisition was performed using a Bruker TimsTOF Pro2 high-resolution mass spectrometer in DDA mode for 60 minutes. The mass-to-charge ratio scan range was 100-1700 m / z, PASEF was set to 10 MS / MS scans (total cycle time 2.22 sec), and the ion intensity threshold was 2500. Raw mass spectrometry data (.d) were generated. Secondary mass spectrometry data were obtained using DDA mode. All raw data files were analyzed using the DeepImmu™ neoantigen analysis platform, combined with de novo sequencing, database search, and homology search to obtain peptide identification results, and peptides with lengths of 7-16 amino acids were screened. The DeepImmu™ analysis platform can obtain not only canonical immune peptides matching the database, but also some non-canonical immune peptides (including single-point mutations) outside the database.

[0183] 13. Peptide loading and co-culture assay with TCR-T cells

[0184] The peptides were synthesized by Nanjing Genscript and had a purity ≥90%. The lyophilized peptide powder was dissolved in DMSO to prepare a 10 mg / ml stock solution and stored at -20℃. HMy2.CIR-B1501 cells (HMy2.CIR cells expressing HLA-B*15:01) and HMy2.CIR blank cells not expressing the exogenous gene were transferred to 50 ml centrifuge tubes, and cells were counted. After centrifugation at 1000 RPM for 8 minutes, the cells were resuspended in 1640 μL of 10% FBS and the cell concentration was adjusted to 1 × 10⁻⁶ cells / mL. 6 cells / ml, take the required number of cells from a 60mm cell culture dish.

[0185] For the first group, add 3 ml of HMy2.CIR B1501-Puro cells to each cell culture dish;

[0186] For the second group, add 3 ml of HMy2.CIR cells to each cell culture dish.

[0187] Remove the peptide stock solution and thaw before use. Take a 1.5 ml EP tube and add 90 μl of 1640 10% FBS to each tube. Then, take 10 μl of each peptide stock solution (the last portion should be the same volume of DMSO) and add it to 90 μl of 1640 10% FBS to prepare a 1 mg / ml peptide working solution. Add 30 μl of the peptide working solution to each 3 ml of cells, bringing the final concentration to 10 μg / mL. After adding the peptide, incubate the cells in a CO2 incubator for 2 hours. After 2 hours, transfer the cells loaded with different peptides to 50 ml centrifuge tubes. Add 5 ml of 1640 10% FBS to each centrifuge tube and centrifuge at 1000 RPM for 8 minutes. After centrifugation, aspirate the supernatant and resuspend the cells in 3 ml of fresh 1640 10% FBS. Take a 24-well plate and add 0.5 ml of cells loaded with different peptides to each well. Prepared TCR-T cells and control T-cells without exogenous gene transfection were transferred to 50 ml centrifuge tubes, and cell counts were performed separately. Cells were centrifuged at 1200 RPM for 8 minutes. After centrifugation, the supernatant was discarded, and the cells were resuspended in 1640×10% FBS to adjust the cell concentration to 1×10⁻⁶ cells / mL. 6 cells / ml. Add 0.5 ml of T cells or TCR-T cells to each well of a 24-well plate containing target cells loaded with different peptides. After addition, incubate the cells in CO2. The next day, harvest the supernatant and freeze it at -80°C for cytokine detection. Harvest the cells and perform flow cytometry staining and analysis.

[0188] 14. Flow cytometry analysis of T-cell activation

[0189] CD137 is a cell membrane surface protein and a classic immunological marker molecule induced by T-cell specific activation. Flow cytometry antibodies were purchased from Biolegend and included: FITC anti-human CD3 Antibody (300306), PE anti-human CD4 Antibody (344606), PerCP / Cyanine 5.5 anti-human CD8a (301032), APC anti-human CD137 (4-1BB) Antibody (309810), PE anti-mouse TCRβchain Antibody (109208), and APC anti-human HLA-A, B, C Antibody (311410). On the second day of co-culture, cells were harvested and transferred to flow cytometry tubes (BD). Cells were resuspended in flow cytometry staining solution (1% FBS in PBS), and staining antibodies were added. Staining was performed at room temperature in the dark for 20 minutes. After staining, the cells were washed once with flow cytometry staining solution. Cells were resuspended in flow cytometry staining solution, and cell clumps were dispersed. Using BD Accuri TM C6plus Flow Cytometer was used to analyze samples.

[0190] 15. ELISA detection of IFN-γ levels in supernatant after co-culture

[0191] The IFN-γ level in culture supernatant was detected using the R&D system hIFN-g DuoSet kit. Following the kit instructions, the coating antibody was prepared into a coating buffer the day before the experiment. 100 μl of the coating buffer was added to each well of the ELISA plate and incubated overnight at room temperature. The next day, the coating buffer was discarded, and the plate was washed three times with the provided Wash Buffer, adding 400 μl of Wash Buffer to each well each time. After washing, the plate was dried, and blocking buffer was added, adding 300 μl of Reagent Diluent to each well. The plate was incubated at room temperature for at least 1 hour. After blocking, the plate was washed three times with Wash Buffer. After the final wash, the plate was dried, and then samples and standards were added. All samples were diluted 10-fold using the provided Reagent Diluent, with 100 μl of the diluted sample added to each well, and each sample was added to two replicate wells. Standards were prepared according to the kit instructions to concentrations of 600, 300, 150, 75, 37.5, 18.8, and 9.38 pg / ml. 100 μl of diluted standard was added to each well, with two replicates per concentration. Two blank wells were also added, each containing 100 μl of Reagent Diluent. After adding samples, the wells were sealed and incubated at room temperature for 2 hours. After incubation, the wells were washed three times with Wash Buffer, adding 400 μl of Wash Buffer to each well each time. Then, 100 μl of diluted detection antibody was added to each well. A new sealing film was added, and the wells were incubated at room temperature for 2 hours. After incubation, the wells were washed three times with Wash Buffer, adding 400 μl of Wash Buffer to each well each time. Finally, 100 μL of diluted Streptavidin-HRP B was added to each well, and the wells were incubated in the dark at room temperature for 20 minutes. Then, wash three times with Wash Buffer, adding 400 μl of Wash Buffer to each well each time. After washing, thoroughly shake off any remaining liquid from the wells, then add 100 μl of freshly prepared substrate solution to each well, and incubate in the dark at room temperature for 20 minutes for color development. After color development, add 50 μl of stop solution to each well. Use a ThermoFisher Multiskan GO automated microplate reader to read the absorbance at 450 nm, and perform wavelength correction at 570 nm. Data processing was performed using the SkanIt microplate reader software. First, a standard curve was plotted based on the results of the standards. A linear regression model was used to calculate the sample concentration. Then, the original sample concentration was calculated based on the dilution factor. Finally, the mean and SD values ​​were calculated using replicate wells. The results were output in Excel format, and a bar chart was created using GraphPad Prism 9.

[0192] 16. Intracellular IFN-γ assay

[0193] HMy2.CIR cells were used to construct the following structures: one co-expressing HLA-B*15:01 and MageA1, another co-expressing HLA-B*15:01 and Puromycin, and a third expressing HLA-B*15:01 and then loading MageA1. 160-169 KEADPTGHSY peptide or blank DMSO control, blank control cells not expressing any exogenous genes, blank control cells loaded with MageA1 160-169 KEADPTGHSY peptide or DMSO control. Prepare 1×10⁶ target cells from each of the above target cells. 6 Cell suspension was collected at 1640 μL / ml and resuspended in 10% FBS. Simultaneously, TCR-T cells and control T-cells were harvested into centrifuge tubes, centrifuged to collect the cells, and resuspended in 1640 μL / ml FBS to adjust the cell concentration to 1 × 10⁻⁶ cells / ml. 6 Cells / ml. Take a 24-well plate, first add target cells, 0.5 ml per well, then add TCR-T cells or T-cells, also 0.5 ml per well. Next, add 1 μl of GolgiPlugger (BD) to each well (1 μl of GolgiPlugger is added to 9 μl of 1640 10% FBS, then the diluted GolgiPlugger is added to the cell culture wells). Incubate at 37°C in a CO2 incubator for 6 hours, then harvest the cells for flow cytometry staining. The first step is extracellular staining. Transfer the cells to flow cytometry tubes, wash once with flow cytometry staining solution, then add flow cytometry antibodies CD3-FITC, mTCRβ-PE, and CD8-PerCPCyC5.5, and stain at room temperature for 20 minutes. After staining, wash once with 2 ml of PBS and 1% FBS, centrifuge, and discard the supernatant. After staining for cell surface proteins, add 250 μl of Fixation / Permeabilization solution (BD) to each tube and incubate at 4°C for 20 minutes. Wash cells twice with 1×BD Per / Wash buffer, 1 ml buffer each time. Prepare intracellular staining antibody: add 1 μl of anti-IFN g-APC to 20 μl of 1×BD Per / Wash buffer, then add to the flow cytometry tube. Incubate at 4°C for 30 minutes. After staining, wash cells twice with 1 ml of 1×BD Per / Wash buffer. Resuspend cells in 100 μl of PBS (1% FBS) and prepare for flow cytometry. Use BD Accuri TM C6 plus Flow Cytometer for sample analysis.

[0194] The primers and their sequences used in this invention are as follows:

[0195]

[0196] Example 1: Isolation and Detection of T Cells

[0197] 1. Obtaining and processing tumor tissue

[0198] Melanoma tumor tissue, after being washed with PBS, was fragmented into 1-3 mm pieces using surgical scissors. These fragments were then inoculated into T-cell culture medium to establish multiple T-cell microcultures. These T-cell cultures were numbered as PBD3, PFA3, PFA3 exp, PDB5, PCC6, PDC5, PBC2, PBD5, and PFC3. Simultaneously, tumor cells were cultured from these tumor tissue samples. The tumor cells were cultured in 24-well plates. Under a microscope, the tumor cells were observed to be adherent, slightly golden-yellow in color, round or elongated spindle-shaped, relatively large, and growing in clusters.

[0199] 2. Co-culture assay of tumor tissue-derived T cells and autologous tumor cells

[0200] Two T-cell cultures (PDB5 and PBD3) derived from the same isolated tumor tissue were added to autologous tumor cell culture wells and co-cultured overnight with the autologous tumor cells. Results are as follows: Figure 1A As shown.

[0201] The results showed that all tumor cells in the culture wells died, and a large number of dead cell fragments were visible. At the same time, a large number of healthy T cells were present in the wells. This indicates that the tumor tissue-derived T-cell culture contains T-cell clones that specifically kill autologous tumor cells.

[0202] 3. Detection of T cell activation marker CD137

[0203] Two T-cell cultures (PDB5 and PBD3) derived from the same tumor tissue isolated in step 2 were co-cultured with autologous tumor cells. Cells were harvested from the wells, with the separately cultured T-cell culture serving as a blank control. Flow cytometry staining antibodies included CD3-FITC, CD4-PE, CD8-PerCPCY5.5, and CD137-APC. Staining was performed at room temperature for 20 minutes, followed by flow cytometry analysis to detect CD137 expression in cytotoxic T cells. Results are as follows... Figure 1B As shown.

[0204] The results showed that CD3+CD8+ cytotoxic T cells specifically expressed CD137 (1.64% and 2.08%), significantly higher than the blank control (0.32%). CD137-induced expression is a classic immunological marker molecule for the specific activation of cytotoxic T cells, indicating that these tumor-derived T cells contain T cell clones with specific killing activity against autologous tumor cells.

[0205] Example 2: Detection of tumor-associated antigens in tumor tissue

[0206] 1. Centrifuge the tumor tissue lysate to collect cells. Lyse the cells using Trizol reagent to prepare total RNA. Take 1000 ng of total RNA to prepare cDNA, and then check gene expression by PCR. Perform PCR using TaKaRa Ex Premier DNA Polymerase. For each reaction, use a 20 μl system, adding 1 μl of cDNA and 1 μl of the corresponding primer. PCR products are directly loaded onto a 1.6% agarose gel. Results are as follows: Figure 1C As shown in the figure, the expression of tumor-associated antigens in this tumor tissue was analyzed using RT-PCR. The results showed that this tumor tissue expressed MageA1, MageA3, MageA6, PRAME, and a weaker expression of MageA4.

[0207] 2. RNA-seq analysis of tumor transcriptome data from another tumor tissue sample taken from the same patient at a different site was performed to determine the expression of tumor-associated antigens. The results are shown in Table 1.

[0208] Table 1. Expression of relevant antigens

[0209]

[0210] The results showed that among all tumor-associated antigens, the three genes most highly expressed were those associated with melanoma, listed from highest to lowest expression level as PMEL, PRAME, and MLANA. MageA1 ranked fourth in expression level and was the most highly expressed MAGE family gene in this tumor tissue.

[0211] Example 3: Detection of Targeted Antigens in T Cells of Tumor Tissue

[0212] Classical immunological assays use autologous dendritic cells (DCs) as antigen-presenting cells. However, obtaining autologous DCs is practically difficult, and DCs cannot proliferate in vitro, resulting in a limited number of cells, which is not conducive to screening assays. The inventors discovered that CD4 T cells highly express HLA molecules, and that activated CD4 T cells are easily infected by lentiviral vectors. Genes delivered by lentiviral vectors, after expression on CD4 T cells, can be naturally processed into various peptides, which are then presented to the cell surface by the expressed HLA molecules. The inventors further discovered that co-expressing the NY-ESO-1 gene and the HLA-A*02:01 gene in healthy donor T cells specifically activates T cells expressing anti-NY-ESO-1TCR, indicating that T cells also have the ability to process antigens and present epitope peptides. By using autologous CD4 T cells instead of DCs as autologous antigen-presenting cells (APCs) and utilizing lentiviral vectors to deliver targeting genes, antigen-presenting cells targeting various antigens can be constructed for screening purposes.

[0213] Based on the gene expression analysis results of the tumor tissue in Example 2, lentiviral vectors expressing MageA1 (MageA1 gene sequence as shown in SEQ ID NO:1, MageA1 protein sequence as shown in SEQ ID NO:2) and PRAME (PRAME gene sequence as shown in SEQ ID NO:49, MageA1 protein sequence as shown in SEQ ID NO:50) were constructed. Then, autoantigen-presenting cells expressing MageA1, PRAME, and a blank control without any exogenous genes were constructed using these lentiviral vectors. Nine tumor tissue-derived T-cell cultures prepared in Example 1 were co-cultured with the aforementioned autoantigen-presenting cells (aAPC), or autoantigen-presenting cells expressing MageA1 (aAPC-MageA1) or PRAME (aAPC-PRAME). Cells were harvested the following day, and the expression of the CD3+CD8+ cell-specific activation molecular marker CD137 was analyzed by flow cytometry. The results are as follows: Figure 1D , 1E As shown.

[0214] The results showed that CD137 expression remained unchanged in tumor-derived T-cells compared to blank control autologous cells or autologous cells expressing PRAME, remaining at background levels of approximately 0.13-0.49%. However, after culturing with autologous cells expressing MageA1, CD137 expression significantly increased in all six T-cell samples, ranging from 1.11% to 8.94% of CD3+CD8+ cells. This indicates that the tumor tissue was rich in MageA1-targeting T-cell clones.

[0215] Example 4: Screening and sequencing of T-cell clones targeting MageA1

[0216] MageA1-specific T-cell clones were sorted and TCR sequences were obtained using flow cytometry and single-cell sequencing.

[0217] 1. Nine T-cell cultures were obtained from this tumor tissue. Among them, the T-cell culture designated PBD3 showed cytotoxic activity against autologous tumor cells and significant immunogenicity against MageA1. Cytotoxic T-cells (CD3+CD8+CD137+) that responded to both autologous tumor cells and MageA1 were isolated from this cell culture. Single-cell TCR library sequencing and 5'-transcriptome sequencing were then performed on the isolated cells. For the other T-cell cultures, multiple viable T-cell cultures were cultured separately with autologous tumor cells and then merged into one cell. Simultaneously, multiple T-cell cultures were co-cultured separately with autologous cells expressing MageA1 and then merged into another cell. These two merged cell cultures were then flow cytometry-sorted to identify cytotoxic T-cells (CD3+CD8+CD137+) that specifically responded to either autologous tumor cells or MageA1. The isolated cells were then subjected to single-cell TCR library sequencing and 5'-transcriptome sequencing. To obtain the proportion of each TCR clone in tumor tissue and to compare the reliability of TCR sequence results obtained from different TCR sequencing platforms, we used the SMART-Seq HumanTCR (with UMIs) kit to perform quantitative analysis of the TCR library in tumor tissue.

[0218] Table 2 shows the proportion of different T-cell clones in the same T-cell culture (numbered PBD3) after different sorting processes. For clarity, each TCR clone was assigned a TCRi number, such as N3.1 and N5.3. Table 2 shows that in the unsorted cell culture sample of PBD3, TCR clone N3.1 was the dominant clone, accounting for 93.83%. After sorting for in vivo tumor cell-specific killing clones and MageA1-specific T-cell clones, the proportion of clone N3.1 gradually decreased to 82.06% and 63.39%, respectively. TCR clone N5.3 accounted for 3.81% of the unsorted cells, but after sorting for in vivo tumor cell-specific killing clones and MageA1-specific T-cell clones, the proportion gradually increased to 13.53% and 33.59%, respectively, suggesting that this clone is likely a MageA1-recognizing T-cell clone. No significant increase in the proportion of other TCR clones in the PBD3 sample was observed after sorting.

[0219] Table 2 Single-cell sequencing results

[0220]

[0221]

[0222] 2. In another single-cell sequencing result of MageA1-specific T-cells sorted after merging multiple T-cell samples, as shown in Table 3, TCR clone N5.3 was the most prevalent TCR clone, accounting for 42.88%. In this sample, TCR clone N4.2 accounted for 21.33%, ranking second. Preliminary analysis suggests that TCR clone N5.3 may be the main TCR clone targeting MageA1 in this tumor tissue; therefore, the next step will be TCR function validation experiments. The human TRAC (wild type) nucleic acid sequence is shown in SEQ ID NO:83. The human TRAC (wild type) amino acid sequence is shown in SEQ ID NO:84. The human TRBC1 (wild type) nucleic acid sequence is shown in SEQ ID NO:85. The human TRBC1 (wild type) amino acid sequence is shown in SEQ ID NO:86. The human TRBC2 (wild type) nucleic acid sequence is shown in SEQ ID NO:87. The human TRBC2 (wild type) amino acid sequence is shown in SEQ ID NO:88.

[0223] Table 3 Single-cell sequencing results

[0224]

[0225]

[0226] In addition, the sequencing results of single-cell 10×Genomics and SMART-Seq Human TCR libraries were compared to verify the sequences of multiple TCRs. It was found that the TCR sequences obtained by the two TCR sequencing platforms were completely identical and without any difference, which also indicates that the sequencing results are reliable.

[0227] 3. SMART seq was used to perform in-depth quantitative analysis of the total T cell TCR library in tumor tissue.

[0228] SMART-Seq Human TCR library sequencing uses total RNA prepared from uncultured raw tumor tissue, and employs UMI sequence tags to label each cDNA molecule, enabling more precise quantitative analysis of individual TCR clones in the tumor tissue. SMART-Seq Human TCR library sequencing results showed that over 1000 TCR clones were detected in this tumor tissue. Counting by TCR β-chain, only 9 TCR clones had a proportion greater than 1%, with the highest being 12.9%. The remaining 990 TCR clones each had a proportion less than 1%. N5.3's TCR β-chain ranked 4th, accounting for 3.0% of the tumor tissue TCR library, and its TCR α-chain ranked 6th, accounting for 1.49%. TCR clone N5.3 is a highly abundant T-cell clone in this tumor tissue. The results are as follows... Figure 2A , 2B As shown.

[0229] Therefore, tumor tissues are rich in tumor cell-specific cytotoxic T-cell clones. These T-cells can be isolated and cultured in vitro to restore their growth and activity, allowing for their study and use in testing and screening of T-cell clones with immunological activity against tumor antigens.

[0230] Example 5: Construction and detection of TCR expression lentiviral vector

[0231] 1. Based on the single-cell TCR sequencing results in Example 4, seven T-cell clones (N3.1, N3.3, N3.4, N4.2, N4.4, N5.1, and N5.3) were selected for further functional validation experiments. Two of these T-cell clones (N3.3 and N5.1), each containing two TCR α-strand genes, were used to construct two TCR expression vectors. The remaining seven T-cell clones each expressed only one pair of TCR genes. Therefore, a total of nine TCR lentiviral expression vectors were constructed. The TCR expression vector (pCDH-EF1α-MCS Cloning and ExpressionLentivector, System Biosciences) was constructed using a third-generation self-deficient lentiviral vector with the EF-1a promoter. TCR expression employs a chimeric approach, fusing a portion of the variable region (V-region) of the desired TCR β-chain gene with the constant region sequence of the mouse TCR β-chain. Similarly, a portion of the variable region of the paired TCR α-chain gene is fused with the constant region sequence of the mouse TCR α-chain. Simultaneously, an S57C point mutation (SEQ ID NO: 95-96 or SEQ ID NO: 97-98) is introduced into the constant region of the mouse TCR β-chain (SEQ ID NO: 91-92 or SEQ ID NO: 93-94), and a T48C point mutation is introduced into the constant region of the mouse TCR α-chain (SEQ ID NO: 89-90). The introduction of these two cysteine ​​residues allows the expressed chimeric TCR to form a second disulfide bond in its constant region, resulting in more stable pairing and improved TCR expression efficiency. In addition, three point mutations (SVMG to LVIV (SEQ ID NO: 99-100)) were introduced into the transmembrane region of the α-chain constant region (SEQ ID NO: 89-90) of the mouse TCR to increase its hydrophobicity, thereby increasing TCR expression and enhancing its activity. In the expression vector construction, the TCRβ chain gene was located upstream, the α chain gene downstream, and P2A self-cleaving peptides were in between. The specific gene and protein sequences are shown in Table 4. The variable region gene sequences and amino acid sequences of TRB (TCRβ chain) and TRA (TCRα chain) of seven T-cell clones (N3.1, N5.3, N3.3.1, N3.3.2, N3.4, N5.1.1, N5.1.2, N4.2, N4.4) are shown in SEQ ID NO: 51-82. The TCR expression gene sequences and amino acid sequences of seven T-cell clones are shown in SEQ ID NO:101-124. A schematic diagram of the TCR expression lentiviral vector structure is shown below. Figure 2CAs shown. The preparation methods of lentiviral vectors, preparation of autologous APC cells expressing MageA1, and preparation of TCR-T cells are as described in the experimental methods above.

[0232] Table 4 Gene Sequences

[0233]

[0234] 2. Before identifying HLA type I gene dependence, autologous cells expressing the MageA1 gene were first constructed as target cells for selection. After preparing TCR-T cells, they were co-cultured with autologous cells expressing MageA1 and autologous cells not expressing any exogenous genes. On the second day of co-culture, flow cytometry analysis was performed on CD137 expression in TCR-T cells. The results are as follows: Figure 2D , 2E As shown.

[0235] Flow cytometry results showed that among the nine selected TCR-T cell lines, TCR clone N5.3, when co-cultured with autologous cells expressing MageA1, exhibited significant and strong CD137 induction, with the proportion of CD137-positive cells reaching 51.3% in CD8+ TCR-T+ cells. In contrast, after culturing N5.3 with control cells, CD137-positive cells in CD8+ TCR-T cells were only at a background level, i.e., 2.73%. The remaining eight TCR clones, when co-cultured with MageA1-expressing target cells, showed no change in CD137 expression, remaining at only a background level. This result indicates that among the nine TCR clones selected in this study, only one TCR clone, N5.3, specifically recognizes the MageA1 antigen.

[0236] 3. Identify the N5.3 TCR-dependent HLA type I gene.

[0237] Based on the RNA-seq data of the tumor tissue described above, seq2HLA analysis was used to obtain the HLA-I gene identification results for this tumor sample. The results are shown in Table 5.

[0238] Table 5 HLA type I gene identification

[0239] #Locus Allele 1 Allele 2 HLA-A A*33:03 A*02:06 HLA-B B*15:01 B*58:01 HLA-C C*08:01 C*03:02'

[0240] Table 5 shows that at the HLA-A locus, this individual possesses two alleles, A*33:03 and A*02:06. At the HLA-B locus, this individual possesses B*15:01 and B*58:01. At the HLA-C locus, this individual possesses C*08:01 and C*03:02'.

[0241] 4. Based on the HLA type I gene identification results, six lentiviral vectors were constructed to co-express each HLA type I gene and MageA1. K562 cells were used as target cells. After transfecting K562 cells with co-expressed HLA type I and MageA1 genes using lentiviral vectors, they were co-cultured with N5.3 TCR-T cells. Simultaneously, K562 cells expressing HLA-A*02:06-Puromycin, HLA-A*33:03-Puromycin, and blank cells without any exogenous genes were added as negative controls. Flow cytometry analysis was performed the day after co-culturing the N5.3 TCR-T cells with the target cells. The results are as follows: Figure 3A , 3C As shown. Figure 3C The first row of images shows the results of circle-gate TCR-T cells (CD3+mTCRβ+), and the second row shows the results of circle-gate CD8+ cytotoxic TCR-T cells (CD3+mTCRβ+CD8+).

[0242] The results showed that N5.3 TCR-T cells exhibited significant and strong CD137 expression only after co-culturing with target cells co-expressing HLA-B*15:01 and MageA1. In CD8+ TCR-T cells, the proportion of CD137+ cells reached 79.2%, while co-culturing with target cells expressing other HLA genes resulted in only background levels (0.33%–1.7%), with no significant increase. Flow cytometry results also showed that only CD8+ TCR-T cells induced CD137 expression, while CD4+ TCR-T cells showed no CD137 induction. This indicates that N5.3 TCRs are typically CD8-dependent TCRs, which is consistent with the logic that N5.3 TCRs originate from CD8+ cytotoxic T cells.

[0243] 5. The same test was performed using HMy2.CIR cells, and the results were as follows: Figure 3B , 3D As shown. Figure 3D The first row of images shows the results of circle-gate TCR-T cells (CD3+mTCRβ+), and the second row shows the results of circle-gate CD8+ cytotoxic TCR-T cells (CD3+mTCRβ+CD8+).

[0244] The results showed that after N5.3 TCR-T cells were cultured with target cells co-expressing HLA-B*15:01 and MageA1, 31.8% of CD8+ TCR-T cells expressed CD137, while CD4+ TCR-T cells did not express CD137. However, after co-culturing with cells expressing other HLA genes, CD137 expression remained unchanged, only at background levels (0.30%-0.92%). These results indicate that N5.3 TCR cells rely on HLA-B*15:01 to present antigenic epitopes.

[0245] 6. The HLA-B*15:01 molecule has high sequence similarity with other HLA-B*15 alleles. The other two alleles, HLA-B*15:02 and HLA-B*15:05, were tested to see if they could present the MageA1 antigen epitope to the N5.3 TCR.

[0246] Four lentiviral expression vectors were constructed: one co-expressing HLA-B*15:02 and MageA1, another co-expressing HLA-B*15:02 and Puromycin, and yet another co-expressing HLA-B*15:05 and MageA1. K562 cells and HMy2.CIR cells were used for testing. Results for K562 cells are shown below. Figure 3E , 3G As shown. Among them. Figure 3G The first row of images shows the results of circle-gate TCR-T cells (CD3+mTCRβ+), and the second row shows the results of circle-gate CD8+ cytotoxic TCR-T cells (CD3+mTCRβ+CD8+). The HMy2.CIR cell results are as follows... Figure 3F , 3H As shown. Among them. Figure 3H In the image, the first row shows the results of circle-gate TCR-T cells (CD3+mTCRβ+), and the second row shows the results of circle-gate CD8+ cytotoxic TCR-T cells (CD3+mTCRβ+CD8+).

[0247] The results showed that, due to the endogenous expression of MageA1 in K562 cells, co-expression of HLA-B*15:01 and Puromycin stimulated 45.9% of CD8+ TCR-T cells to express CD137. In contrast, blank K562 cells showed only background levels (3.5% of CD8+ TCR-T cells expressed CD137). Co-expression of HLA-B*15:01 and MageA1 in K562 cells induced CD137 expression in 91.4% of CD8+ TCR-T cells. Co-expression of HLA-B*15:05 and Puromycin, and co-expression of HLA-B*15:05 and MageA1 in K562 cells, induced CD137 expression in 18.4% and 63.7% of CD8+ TCR-T cells, respectively, with activation levels lower than those of HLA-B*15:01. When K562 cells expressed HLA-B*15:02 and MageA1, only 5.36% of CD137+N5.3 TCR-T cells expressed CD137, only slightly higher than the control sample (3.93%). Similar results were obtained using HMy2.CIR (without endogenous MageA1 expression): co-expression of HLA-B*15:01 and MageA1 induced CD137 expression in 51.8% of CD8+ TCR-T cells, co-expression of HLA-B*15:05 and MageA1 induced CD137 expression in 17.2% of CD8+ TCR-T cells, while co-expression of HLA-B*15:02 and MageA1 resulted in only 3.03% CD8+ TCR-T cells expressing CD137, almost the same as the control sample (2.36%).

[0248] The results above indicate that HLA-B*15:01, which naturally pairs with N5.3 TCR, presents the MageA1 epitope most effectively and elicits the strongest immune response. HLA-B*15:05 can also effectively present the MageA1 epitope to N5.3 TCR-T cells, but it elicits a weaker T-cell response. The HLA-B*15:05 molecule differs from the HLA-B*15:01 molecule by only two amino acids, while the HLA-B*15:02 molecule differs from the HLA-B*15:01 molecule by five amino acids.

[0249] Example 6N5.3 TCR Recognition of MageA1 Peptide Epitope Prediction

[0250] The epitopes presented by HLAI-type molecules are 8-11 amino acid peptides, mostly 9-amino acid peptides. The full-length human MageA1 protein has 309 amino acids. To further identify the MageA1 peptide epitopes recognized by the N5.3 TCR, a preliminary attempt was made to predict them using a computational model. Based on the prediction results, the peptides were then artificially synthesized, followed by a peptide-loaded immune activation assay.

[0251] 1. NetMHCpan version 4.1b was used to predict peptides that might be presented by HLA-B*15:01 for the full-length MageA1 protein, and peptides predicted to bind strongly (EL_Rank < 0.5) were selected. The same predictive analysis was performed using IEDB MHC-I ProcessingPredictions. Combining the results of the two predictions, the nine peptides with the highest scores and greatest likelihood were synthesized artificially. The synthesized peptides were then used to identify the peptide epitopes recognized by the N5.3 TCR using immunoassay. Table 6 lists the MageA1 epitope peptides that might be presented by HLA-B*15:01 predicted by the computational model.

[0252] Table 6. Peptides predicted by the computational model.

[0253]

[0254] Nine peptides were synthesized artificially and then loaded onto HMy2.CIR cells or autoantigen-presenting cells expressing HLA-B*15:01, followed by co-culture with N5.3 TCR-T cells. Flow cytometry analysis was performed on the second day of co-culture, and the results are as follows: Figure 4A , 4B As shown in Figures 4C and 4C. Figure 4B In the image, the first row shows gated TCR-T cells (CD3+mTCRβ+), and the second row shows gated CD8+ cytotoxic TCR-T cells (CD3+mTCRβ+CD8+). Figure 4C In the image, the first row shows circle-gate TCR-T cells (CD3+mTCRβ+), and the second row shows circle-gate CD8+ cytotoxic TCR-T cells (CD3+mTCRβ+CD8+).

[0255] The results showed that none of the nine peptides specifically activated CD137 expression in N5.3 TCR-T cells. This indicates that the selected peptides were not epitopes recognized by N5.3 TCR, suggesting that the predictive function needs further improvement.

[0256] Example 7: Isolation and Detection of MageA1-Derived Peptides

[0257] Since MageA1, whether expressed in autologous cells or co-expressed with HLA-B*15:01 in K562 or HMy2.CIR cells, can effectively activate N5.3 TCR-T cells, it indicates that MageA1 protein can be processed intracellularly into epitope peptides that can be bound to HLA-B*15:01 and presented to the cell surface. Therefore, traditional immunoprecipitation and mass spectrometry methods were used to identify the MageA1 epitope peptides recognized by N5.3 TCR.

[0258] 1. A list of human MageA1 epitope peptides presented by HLA-B*15:01 was identified using immunoprecipitation and mass spectrometry (MS). Human HLA-B*15:01 and human MageA1 were co-expressed in HMy2.CIR cells using lentiviral vector-mediated gene delivery. The total number of collected peptides was approximately 1 × 10⁻⁶. 8 HLA-peptides complexes were purified from HMy2.CIR-B1501-MageA1 cells using immunoprecipitation. Immunopeptide fragments were then separated using a reverse-phase column chromatography method, and the collected components were analyzed by LC-MS / MS mass spectrometry. Twelve MageA1-related peptides were extracted from the mass spectrometry results, as shown in Table 7. Based on the peptide sequences, these 12 peptides were artificially synthesized for immunoassay to identify peptide sites recognized by the N5.3 TCR.

[0259] Table 7 Artificially synthesized peptides

[0260]

[0261]

[0262] Two of the peptides (IMPKTGF and NQIMPKTGF) are conserved in MageA1 and MageA6. Of these 12 peptides, 6 were predicted using a model and experimentally verified to be ineffective in activating N5.3 TCR-T cells, while the other 6 were newly discovered in this mass spectrometry identification. Four peptides originated from region 160-171 of MageA1, with only 1-2 amino acid intervals between them. Based on the mass spectrometry quantification results, peptide MageA1... 160-169 KEADPTGHSY was the most abundant and was the major epitope. The peptide MageA1 160-169 The KEADPTGHSY secondary mass spectrum is shown below. Figure 4H As shown.

[0263] 2. Based on the mass spectrometry results, six newly identified peptides were artificially synthesized, and peptide loading and co-culture experiments were performed again. Since HMy2.CIR cells do not express HLA type I genes or endogenously express MageA1, they are suitable for peptide loading experiments. HMy2.CIR cells expressing HLA-B*15:01 were loaded with different peptides, including the six newly identified peptides by mass spectrometry and nine peptides synthesized based on algorithm predictions. DMSO was used as a blank control, and co-expression of HLA-B*15:01 and MageA1 was used as a positive control. Simultaneously, HMy2.CIR blank cells without expressing any exogenous genes loaded with peptides were used as a negative control. These were then co-cultured with N5.3 TCR-T cells or T- cells without any exogenous TCR transfection. The next day, the supernatant was collected for IFN-γ ELISA quantitative analysis, and cells were harvested for flow cytometry analysis.

[0264] Streaming results as follows Figure 4D As shown. The results show that among the 15 peptides tested, peptide MageA1... 160- 169 KEADPTGHSY specifically relies on HLA-B*15:01 to strongly activate N5.3 TCR-T cells, with 54% of CD8+ TCR-T cells expressing CD137, while other peptides showed only background levels (1.08%-1.8%) and no increase in expression.

[0265] ELISA results as follows Figure 4E As shown, the results indicate that cells expressing HLA-B*15:01 are loaded with MageA1. 160- 169 The KEADPTGHSY peptide stimulated N5.3 TCR-T cells to produce IFN-γ levels significantly higher than other peptides or DMSO. Peptide MageA1 160-169 When KEADPTGHSY was loaded onto HMy2.CIR blank cells, there was no significant increase in IFN-γ levels, indicating that the peptide is dependent on HLA-B*15:01 molecule to activate N5.3 TCR-T cells.

[0266] The original flow cytometry plots are shown in 4F and 4G. In 4F, the first row of plots shows gated TCR-T cells (CD3+mTCRβ+), and the second row shows gated CD8+ cytotoxic TCR-T cells (CD3+mTCRβ+CD8+). In 4G, the first row of plots shows gated TCR-T cells (CD3+mTCRβ+), and the second row shows gated CD8+ cytotoxic TCR-T cells (CD3+mTCRβ+CD8+). The results show that MageA1... 160-169The KEADPTGHSY peptide strongly activated N5.3 TCR-T cells, exhibiting similar activation levels to MageA1-expressing cells, while other peptides showed no activation activity. Two other peptides, MageA1161-169 EADPTGHSY and MageA1162-169 ADPTGHSY, respectively lacking the first and first two amino acids, were completely inactive. This indicates that the first amino acid of this epitope is a key binding site, and this amino acid may be involved in peptide loading into the HLA-B*15:01 molecule binding groove and participating in TCR binding.

[0267] Example 8: Specificity of TCR molecules

[0268] This embodiment analyzed whether the N5.3 TCR might cross-react with peptides of similar sequences to MageA1. Cross-reactive TCRs, when used clinically, might recognize other proteins expressed in normal tissues, leading to off-target effects and serious adverse events. A search of sequence-similar protein databases revealed that MageA1... 160-169 The KEADPTGHSY polypeptide shows significant sequence similarity to 10 other MageA and B family proteins.

[0269] 1. Using KEADPTGHSY as the query sequence, the BlastP tool was used to search for similar sequences in the GenBank protein sequence database. Based on the query results, the full-length protein sequences of the similar sequences were obtained. Multiple sequence alignment was performed using EBI ClustalOmega. The results are as follows: Figure 5A As shown. The red box shows the sequence alignment of KEADPTGHSY and other proteins with similarity. Based on the sequence similarity analysis and alignment results, we artificially synthesized 9 polypeptides at this position of these 10 proteins (the polypeptide sequences at this position are completely identical for MageA8 and MageA9), and then loaded them into HMy2.CIR cells expressing HLA-B*15:01, using MageA1 160-169 KEADPTGHSY peptide and co-expression of the MageA1 full-length gene were used as positive controls, while HMy2.CIR cells without expressing any exogenous genes loaded with the peptide were used as negative controls. Cells were then co-cultured with N5.3TCR-T cells or T- cells without expressing any exogenous TCRs. On the second day of co-culture, cells were collected for flow cytometry analysis. The results are as follows: Figure 5B As shown.

[0270] The results showed that MageA10 192-201The KEVDPTGHSF (SEQ ID NO:138) peptide can strongly stimulate N5.3 TCR-T cells to express CD137 in a HLA-B*15:01-dependent manner. The proportion of CD137-positive cells in CD8+ TCR-T cells reached 37.3%, which is slightly lower than that of MageA1. 160-169 The KEADPTGHSY peptide stimulation resulted in 53.2% of the levels. Other peptides showed only background levels, with no increase compared to the negative control. The IFN-γ level in the supernatant after co-culture was detected by ELISA. Figure 5C As shown. The results show that only MageA10 192-201 Only the KEVDPTGHSF peptide produced a significant increase in IFN-γ levels, while no significant changes in IFN-γ levels were observed in other tested peptides. This result indicates that the N5.3 TCR can recognize peptide sequences originating from MageA10.

[0271] N5.3 TCR-T cells and HMy2.CIR cells expressing HLA-B*15:01 (HMy2.CIR-B1501), or blank control cells without expression (HMy2.CIR), loaded with MageA1 160-169 KEADPTGHSY contains different polypeptides with sequence similarity, or DMSO is a negative control, or MageA1160-169 KEADPTGHSY (positive control), and after co-culturing overnight, CD137 expression in CD8+ cytotoxic TCR-T cells was shown in the original flow cytometry diagram. Figure 5D As shown.

[0272] The above results show that artificially synthesized MageA10 192-201 The KEVDPTGHSF peptide can activate N5.3 TCR-T cells, while other peptides have no activity against N5.3 TCR-T cells.

[0273] Since this peptide loading assay used artificially synthesized peptides, it remains to be determined whether the MageA10 protein can be processed into this peptide intracellularly and presented to the cell surface. This invention further constructed a lentiviral vector co-expressing HLA-B*15:01 and MageA10, and used a vector co-expressing HLA-B*15:01 and MageA1 as a positive control, and a vector co-expressing HLA-B*15:01 and Puromycin as a negative control. This validation assay used two cell lines: HMy2.CIR cells, derived from Caucasians, and AY1206, a melanoma cell line from Chinese individuals. Using Chinese-derived tumor cell lines allows for analysis of differences in antigen processing and epitope presentation among cells from different ethnic groups, providing practical clinical guidance. Four cell lines expressing different genes were constructed using these two cell lines, and then co-cultured with N5.3 TCR-T cells or T- cells, as follows: Figure 5E , 5F As shown in 5G.

[0274] The results showed that only cells co-expressing HLA-B*15:01 and MageA1 could effectively stimulate N5.3 TCR-T cells. Cells co-expressing HLA-B*15:01 and MageA10, however, could not stimulate N5.3 TCR-T cells, and CD137 expression was not significantly increased compared to the control. The results from the two cell lines were completely consistent. This indicates that although the artificially synthesized MageA10 peptide can activate N5.3 TCR, the MageA10 protein cannot be processed intracellularly into a peptide epitope that can be presented by HLA-B*15:01 molecules and activate N5.3 TCR.

[0275] This indicates that MageA10 cannot be processed into a peptide that can effectively activate the N5.3 TCR within cells. The N5.3 TCR can only recognize peptides derived from MageA1 that have been naturally processed within cells to be presented by HLA-B*15:01. Other peptides with sequence similarity to MageA1 cannot be recognized or processed into peptides that can be effectively presented. Therefore, the target recognition of the N5.3 TCR is highly specific, with no cross-reactivity.

[0276] In summary, after a series of analyses and tests, and repeated verifications, N5.3 TCR relies on HLA-B*15:01 to specifically recognize MageA1. 160-169 KEADPTGHSY peptide epitope. Cross-recognition assays showed that the N5.3 TCR does not recognize conserved similar peptides of other proteins with sequence similarity to MageA1, or that such peptides cannot be naturally produced and presented in cells.

[0277] Example 9: Bioactivity of TCR molecules

[0278] In this embodiment, classical immunological analyses were performed on N5.3 TCR-T cells, including the K562 killing assay, CD107a degranulation assay, intracellular IFN-γ induction expression assay, and peptide concentration dilution assay.

[0279] 1. Peptide dilution assay is used to test the lowest concentration at which a peptide can be bound by HLA molecules and activate TCR.

[0280] N5.3 TCR-T cells loaded with different concentrations of MageA1 160-169 KEADPTGHSY peptide or DMSO-containing HMy2.CIR-B1501 (highly expressing HLA-B*15:01), or HMy2.CIR blank cells, after co-culture overnight, showed CD137 expression in CD8+ cytotoxic TCR-T cells. (Original flow cytometry data follows.) Figure 6 As shown.

[0281] Experimental results show that N5.3 and HMy2.CIR-B1501 are effective against MageA1. 160-169 Antigen responses are concentration-dependent; peptide activity exhibits a relatively significant dose-response effect between 10 μg / ml and 1 ng / ml, and high concentrations of peptide (10 μg / ml) significantly induce CD137 expression. MageA1 160-169 Even at concentrations as low as 0.1 μg / ml, the KEADPTGHSY peptide can still be effectively loaded into cells expressing HLA-B*15:01 molecules and effectively activate N5.3 TCR-T cells, causing a specific increase in CD137 expression.

[0282] 2. CD107a threshing test

[0283] N5.3 TCR-T cells with or without HLA-B*15:01 expression, and with or without MageA1 loading. 160- 169 KEADPTGHSY peptide, or DMSO, or HMy2.CIR cells co-expressing HLA-B*15:01 and MageA1 or Puromycin, or blank cell controls, were co-cultured with Golgi Stop and APC-anti-CD107a antibodies. After 4 hours of culture, cells were harvested, and flow cytometry was used to analyze the extracellular membrane eversion of CD107a in CD8+ cytotoxic TCR-T cells. Results are as follows: Figure 7A As shown.

[0284] The results showed that whether HLA-B*15:01 and MageA1 were co-expressed, or MageA1 was loaded in cells expressing HLA-B*15:01, the effect was not significant. 160-169 The KEADPTGHSY polypeptide can cause 64.6% or 87% of CD8+TCR-T cells to outward turn CD107a.

[0285] 3. Intracellular staining of interferon-gamma (IFN-γ) cells

[0286] N5.3 TCR-T cells with or without HLA-B*15:01 expression, and with or without MageA1 loading. 160- 169 KEADPTGHSY peptide, or DMSO, or HMy2.CIR cells co-expressing HLA-B*15:01 and MageA1 or Puromycin, or blank cell controls, were co-cultured with Golgi Plugger. After 6 hours of culture, cells were harvested, and intracellular flow cytometry was used to analyze the expression of gamma interferon in CD8+ cytotoxic TCR-T cells. Results are as follows: Figure 7B As shown.

[0287] The results showed that whether HLA-B*15:01 and MageA1 were co-expressed, or MageA1 was loaded in cells expressing HLA-B*15:01, the effect was not significant. 160-169 KEADPTGHSY peptides can specifically stimulate 35.4% or 55.5% of CD8+ TCR-T cells to express IFN-γ.

[0288] 4. K562 lethality test

[0289] K562 cells were used to construct target cells expressing different genes: HLA-B*15:01 and MageA1 co-expressed, HLA-B*15:01 and Puromycin co-expressed, and HLA-B*58:01 and MageA1 co-expressed. Target cells were collected into centrifuge tubes, sampled, and counted. Cells were centrifuged at 1000 RPM for 8 minutes, the supernatant was discarded, and the cells were resuspended in 10% FBS 1640 solution to adjust the cell concentration to 1×10⁻⁶ cells / mL. 6 Cells / ml. Take a 24-well plate, add target cells, 0.5 ml of target cell suspension to each well. Transfer T-cells and TCR-T cells separately to centrifuge tubes, sample and count the cells, centrifuge at 1200 RPM for 8 minutes, discard the supernatant, resuspend in 10% FBS 1640, and adjust the cell concentration to 1×10⁻⁶ cells / ml. 6cells / ml. Add 0.5 ml of cell suspension to each well containing target cells, either T cells or TCR-T cells. After addition, incubate the cells in a CO2 incubator. On day 2, perform a half-medium change by aspirating 0.5 ml of old culture medium from each well and adding 1 ml of fresh 1640 (10% FBS). On days 3 and 4, perform a half-medium change again, aspirating 0.75 ml of old culture medium from each well and adding 0.75 ml of fresh 1640 10% FBS. After co-culturing for 4 days, harvest the cells and divide them into two aliquots. One aliquot is stained with CD3-FITC, PE-anti-mouse TCRβchain Antibody, CD8a-PerCPCY5.5, and CD137-APC to examine the TCR-T cell ratio and activation status; the other aliquot is stained with CD3-FITC and HLA-ABC-APC to examine target cell residue. Use BD Accuri TM C6plus Flow Cytometer was used to analyze samples.

[0290] The results are as follows Figure 8A , 8B As shown in the figure, red dots represent T-cells or TCR-T cells, which are located in the lower left of the flow cytometry plot due to their small size and uniform morphology. Blue dots represent K562 cells, which are located in the upper right of the flow cytometry plot due to their larger size and more complex morphology. K562 cells endogenously express a small amount of MageA1, and after co-culturing with N5.3 TCR-T cells, the number of K562-B1501 cells decreased significantly. K562 cells co-expressing HLA-B*15:01 and MageA1 were almost completely killed after co-culturing with N5.3 TCR-T cells, indicating that N5.3 TCR-T cells have very good cytotoxic activity. However, N5.3 TCR-T cells did not kill K562 B5801-MageA1 cells, which express unrelated HLA molecules.

[0291] 5. Immune responses of N5.3 TCR-T cells to different tumor cell lines

[0292] (1) Immunoassay results of HLA-restricted target-specific CD137 expression after co-culturing N5.3 TCR-T cells with human tumor cell lines SHP77, H1299, and AY1206 (melanoma). Results are as follows: Figure 8C As shown.

[0293] SHP-77 is a small cell lung cancer cell line that endogenously expresses low levels of MageA1. NCI-H1299 is a non-small cell lung cancer cell line that endogenously expresses low levels of MageA1. AY1206 is a Chinese-derived melanoma cell line that does not express MageA1. Tests on tumor cell lines also confirmed that N5.3 TCR-T cells can recognize tumor cells expressing MageA1 in an HLA-B*15:01-dependent manner. Furthermore, increasing MageA1 expression levels significantly increased CD137-positive cell counts, indicating that MageA1 expression levels affect the activity of N5.3 TCR-T cells.

[0294] (2) N5.3 TCR-T cells were co-cultured overnight with the human small cell lung cancer cell line SHP77, which co-expresses HLA-B*15:01 and MageA1 or Puromycin, or a blank cell line. Flow cytometry analysis showed that CD137 expression in CD8+ cytotoxic TCR-T cells was observed. Results are as follows: Figure 8D As shown.

[0295] (3) N5.3 TCR-T cells were co-cultured overnight with human non-small cell lung cancer cells H1299, which co-express HLA-B*15:01 and MageA1 or Puromycin, or a blank cell line. Flow cytometry analysis showed that CD137 expression in CD8+ cytotoxic TCR-T cells was observed. Results are as follows: Figure 8E As shown.

[0296] (4) Flow cytometry analysis of CD137 expression in CD8+ cytotoxic TCR-T cells after co-culturing N5.3 TCR-T cells with a human melanoma cell line (AY1206) co-expressing HLA-B*15:01 and MageA1 or Puromycin, or a blank cell line, overnight. Results are as follows. Figure 8F As shown.

[0297] The test results showed that N5.3 TCR-T cells, under HLA-B*15:01 restriction, could be specifically activated and effectively kill target cells regardless of whether they expressed the MageA1 gene or were loaded with peptides. Simultaneously, the activation and killing experiments of N5.3 TCR-T cells against three different tumor cell lines (SHP77, H1299, AY1206) showed that, regardless of whether the expression was endogenous or exogenously high, N5.3 TCR-T cells could effectively activate and kill tumor cells under HLA-B*15:01 restriction.

[0298] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

[0299] sequence list

[0300] Sequence 1: MageA1 gene sequence (coding region)

[0301]

[0302]

[0303] Sequence 2: MageA1 protein sequence

[0304] Sequence 3: HLA-A*02:06 gene sequence

[0305] Sequence 4: HLA-A*02:06 protein sequence

[0306] Sequence 5: HLA-A*33:03 gene sequence

[0307] Sequence 6: HLA-A*33:03 protein sequence

[0308] Sequence 7: HLA-B*15:01 gene sequence

[0309] Sequence 8: HLA-B*15:01 protein sequence

[0310]

[0311] Sequence 9: HLA-B*15:02 gene sequence

[0312] Sequence 10: HLA-B*15:02 protein sequence

[0313] Sequence 11: HLA-B*15:05 gene sequence

[0314] Sequence 12: HLA-B*15:05 protein sequence

[0315] Sequence 13: HLA-B*58:01 gene sequence

[0316] Sequence 14: HLA-B*58:01 protein sequence

[0317] Sequence 15: HLA-C*03:02 gene sequence

[0318]

[0319] Sequence 16: HLA-C*03:02 protein sequence

[0320] Sequence 17: HLA-C*08:01 gene sequence

[0321] Sequence 18: HLA-C*08:01 protein sequence

[0322] Sequence 19: MageA10 gene sequence (coding region)

[0323]

[0324] Sequence 20: MageA10 protein sequence

[0325] Sequence 21: Puromycin gene sequence

[0326] Sequence 22: Puromycin protein sequence

[0327]

[0328] Sequence 23: P2A gene sequence

[0329]

[0330] Sequence 24: P2A protein sequence

[0331]

[0332] Sequence 25: Co-expressed HLA-A*0206-P2A-MageA1 gene sequence

[0333] Sequence 26: Co-expressed HLA-A*0206-P2A-MageA1 protein sequence

[0334] Sequence 27: Co-expressed HLA-A*33:03-P2A-MageA1 gene sequence

[0335] Sequence 28: Co-expressed HLA-A*33:03-P2A-MageA1 protein sequence

[0336]

[0337] Sequence 29: Co-expression of the HLA-B*15:01-P2A-MageA1 gene sequence

[0338] Sequence 30: Co-expressed HLA-B*15:01-P2A-MageA1 protein sequence

[0339] Sequence 31: Co-expressed HLA-B*58:01-P2A-MageA1 gene sequence

[0340] Sequence 32: Co-expressed HLA-B*58:01-P2A-MageA1 protein sequence

[0341]

[0342] Sequence 33: Co-expressed HLA-C*03:02-P2A-MageA1 gene sequence

[0343] Sequence 34: Co-expressed HLA-C*03:02-P2A-MageA1 protein sequence

[0344] Sequence 35: Co-expressed HLA-C*08:01-P2A-MageA1 gene sequence

[0345] Sequence 36: Co-expressed HLA-C*08:01-P2A-MageA1 protein sequence

[0346]

[0347] Sequence 37: Co-expressed HLA-B*15:01-P2A-Puromycin gene sequence

[0348] Sequence 38: Co-expressed HLA-B*15:01-P2A-Puromycin protein sequence

[0349] Sequence 39: Co-expressed HLA-B*15:02-P2A-Puro gene sequence

[0350] Sequence 40: Co-expressed HLA-B*15:02-P2A-Puro protein sequence

[0351] Sequence 41: Co-expressed HLA-B*15:02-P2A-MageA1 gene sequence

[0352]

[0353] Sequence 42: Co-expressed HLA-B*15:02-P2A-MageA1 protein sequence

[0354] Sequence 43: Co-expressed HLA-B*15:05-P2A-Puromycin gene sequence

[0355] Sequence 44: Co-expressed HLA-B*15:05-P2A-Puromycin protein sequence

[0356] Sequence 45: Co-expressed HLA-B*15:05-P2A-MageA1 gene sequence

[0357]

[0358] Sequence 46: Co-expressed HLA-B*15:05-P2A-MageA1 protein sequence

[0359] Sequence 47: Co-expressed HLA-B*15:01-P2A-MageA10 gene sequence

[0360] Sequence 48: Co-expressed HLA-B*15:01-P2A-MageA10 protein sequence

[0361] Sequence 49: PRAME gene sequence, coding region

[0362]

[0363] Sequence 50: PRAME protein sequence

[0364]

[0365] Sequence 51: NB3.1 (TRBV6-5, TRBJ1-2) nucleic acid sequence

[0366] Sequence 52: NB3.1 (TRBV6-5, TRBJ1-2) amino acid sequence

[0367] Sequence 53: NA3.1 (TRAV17, TRAJ52) nucleic acid sequence

[0368] Sequence 54: NA3.1 (TRAV17, TRAJ52) amino acid sequence

[0369] Sequence 55: NB5.3 (TRBV4-3, TRBJ1-5) nucleic acid sequence

[0370] Sequence 56: NB5.3 (TRBV4-3, TRBJ1-5) amino acid sequence

[0371] Sequence 57: NA5.3 (TRAV1-2, TRAJ27) nucleic acid sequence

[0372] Sequence 58: NA5.3 (TRAV1-2, TRAJ27) amino acid sequence

[0373] Sequence 59: NB3.3 (TRBV29-1, TRBD1, TRBJ2-2) nucleic acid sequence

[0374] Sequence 60: NB3.3 (TRBV29-1, TRBD1, TRBJ2-2) amino acid sequence

[0375] Sequence 61: NA3.3.1 (TRAV5,TRAJ7) nucleic acid sequence

[0376] Sequence 62: NA3.3.1 (TRAV5,TRAJ7) amino acid sequence

[0377] Sequence 63: NA3.3.2 (TRAV3,TRAJ28) nucleic acid sequence

[0378] Sequence 64: NA3.3.2 (TRAV3,TRAJ28) amino acid sequence

[0379] Sequence 65: NB3.4 (TRBV5-1, TRBJ2-7) nucleic acid sequence

[0380] Sequence 66: NB3.4 (TRBV5-1, TRBJ2-7) amino acid sequence

[0381] Sequence 67: NA3.4 (TRAV22,TRAJ43) nucleic acid sequence

[0382] Sequence 68: NA3.4 (TRAV22,TRAJ43) amino acid sequence

[0383] Sequence 69: NB4.2 (TRBV6-6, TRBJ2-5) nucleic acid sequence

[0384] Sequence 70: NB4.2 (TRBV6-6, TRBJ2-5) amino acid sequence

[0385] Sequence 71: NA4.2 (TRAV4,TRAJ39) nucleic acid sequence

[0386] Sequence 72: NA4.2 (TRAV4,TRAJ39) amino acid sequence

[0387] Sequence 73: NB4.4 (TRBV20-1, TRBJ1-1) nucleic acid sequence

[0388] Sequence 74: NB4.4 (TRBV20-1, TRBJ1-1) amino acid sequence

[0389] Sequence 75: NA4.4 (TRAV19, TRAJ30) nucleic acid sequence

[0390] Sequence 76: NA4.4 (TRAV19,TRAJ30) amino acid sequence

[0391] Sequence 77: NB5.1 (TRBV13, TRBJ2-5) nucleic acid sequence

[0392] Sequence 78: NB5.1 (TRBV13, TRBJ2-5) amino acid sequence

[0393] Sequence 79: NA5.1.1 (TRAV13-2, TRAJ5) nucleic acid sequence

[0394] Sequence 80: NA5.1.1 (TRAV13-2, TRAJ5) amino acid sequence

[0395] Sequence 81: NA5.1.2 (TRAV3,TRAJ4) nucleic acid sequence

[0396] Sequence 82: NA5.1.2 (TRAV3,TRAJ4) amino acid sequence

[0397] Sequence 83: Human TRAC (wild type) nucleic acid sequence

[0398] Sequence 84: Human TRAC (wild type) amino acid sequence

[0399] Sequence 85: Human TRBC1 (wild type) nucleic acid sequence

[0400] GAGAAAGGATTTCTGA

[0401] Sequence 86: Human TRBC1 (wild type) amino acid sequence

[0402] Sequence 87: Human TRBC2 (wild type) nucleic acid sequence

[0403]

[0404] Sequence 88: Human TRBC2 (wild type) amino acid sequence

[0405]

[0406] Sequence 89: Mouse TRAC (wild type) nucleic acid sequence

[0407]

[0408] Sequence 90: Mouse TRAC (wild type) amino acid sequence

[0409]

[0410] Sequence 91: Mouse TRBC1 (wild type) nucleic acid sequence

[0411]

[0412] Sequence 92: Mouse TRBC1 (wild type) amino acid sequence

[0413]

[0414] Sequence 93: Mouse TRBC2 (wildtype) nucleic acid sequence

[0415]

[0416] Sequence 94: Mouse TRBC2 (wildtype) amino acid sequence

[0417] Sequence 95: Mouse TRBC1 (S57C mutation) nucleic acid sequence

[0418]

[0419] Sequence 96: Amino acid sequence of mouse TRBC1 (S57C mutation)

[0420]

[0421] Sequence 97: Mouse TRBC2 (S57C mutation) nucleic acid sequence

[0422]

[0423] Sequence 98: Amino acid sequence of mouse TRBC2 (S57C mutation)

[0424]

[0425] Sequence 99: Mouse TRAC (T48C, S112L, M114I, G115V mutation) nucleic acid sequence

[0426] acctgctcgttatcgttctccgaatcctcctgctgaaagtagccggatttaacctgctcatgacgctgaggctgtggtccagttga

[0427] Sequence 100: Amino acid sequence of mouse TRAC (T48C, S112L, M114I, G115V mutation)

[0428]

[0429] Sequence 101: N5.3 TCR expression, gene sequence: NB5.3(TRBV4-3)-mouse TRBC1(wildtype)-P2A-NA5.3(TRAV1-2)-mouse TRAC(wildtype)

[0430]

[0431] Sequence 102: N5.3 TCR expression, amino acid sequence: NB5.3(TRBV4-3)-mouse TRBC1(wildtype)-P2A-NA5.3(TRAV1-2)-mouse TRAC(wildtype)

[0432]

[0433] Sequence 103: N5.3 TCR expression, gene sequence, NB5.3(TRBV4-3)–mTRBC1(S57C)–P2A-NA5.3(TRAV1-2)–mTRAC(T48C,S112L,M114I,G115V)

[0434]

[0435] Sequence 104: N5.3 TCR expression, amino acid sequence, NB5.3(TRBV4-3)–mTRBC1(S57C)–P2A-NA5.3(TRAV1-2)–mTRAC(T48C,S112L,M114I,G115V)

[0436]

[0437] Sequence 105: N5.3 TCR expression, gene sequence: NB5.3(TRBV4-3)-mTRBC2(wildtype)-P2A-NA5.3(TRAV1-2)-mTRAC(wildtype)

[0438]

[0439] Sequence 106: N5.3 TCR expression, amino acid sequence: NB5.3(TRBV4-3)-mTRBC2(wildtype)-P2A-NA5.3(TRAV1-2)-mTRAC(wildtype)

[0440]

[0441] Sequence 107: N5.3 TCR expression, gene sequence: NB5.3(TRBV4-3)-mTRBC2(S57C)-P2A-NA5.3(TRAV1-2)-mTRAC(T48C,S112L,M114I,G115V)

[0442]

[0443] Sequence 108: N5.3 TCR expression, amino acid sequence: NB5.3(TRBV4-3)-mTRBC2(S57C)-P2A-NA5.3(TRAV1-2)-mTRAC(T48C,S112L,M114I,G115V)

[0444]

[0445] Sequence 109: N3.1 TCR expression, gene sequence, NB3.1(TRBV6-5)–mTRBC1(S57C)–P2A-NA3.1(TRAV17)–murine TRAC(T48C,S112L,M114I,G115V)

[0446]

[0447]

[0448] Sequence 110: N3.1 TCR expression, amino acid sequence, NB3.1(TRBV6-5)–mTRBC1(S57C)–P2A-NA3.1(TRAV17)–murine TRAC(T48C,S112L,M114I,G115V)

[0449]

[0450] Sequence 111: N3.3.1 TCR expression, gene sequence, NB3.3(TRBV29-1)–mTRBC1(S57C)–P2A-NA3.3.1(TRAV5)–murine TRAC(T48C,S112L,M114I,G115V)

[0451]

[0452] Sequence 112: N3.3.1 TCR expression, amino acid sequence, NB3.3(TRBV29-1)–mTRBC1(S57C)–P2A-NA3.3.1(TRAV5)–murine TRAC(T48C,S112L,M114I,G115V)

[0453]

[0454] Sequence 113: N3.3.2 TCR expression, gene sequence, NB3.3(TRBV29-1)–mTRBC1(S57C)–P2A-NA3.3.2(TRAV3)–murine TRAC(T48C,S112L,M114I,G115V).

[0455]

[0456]

[0457] Sequence 114: N3.3.2TCR expression, amino acid sequence, NB3.3(TRBV29-1)–mTRBC1(S57C)–P2A-NA3.3.2(TRAV3)–murine TRAC(T48C,S112L,M114I,G115V)

[0458]

[0459] Sequence 115: N3.4 TCR expression, gene sequence: NB3.4(TRBV5-1)–mTRBC1(S57C)–P2A-NA3.4(TRAV22)–murine TRAC(T48C,S112L,M114I,G115V)

[0460]

[0461] Sequence 116: N3.4 TCR expression, amino acid sequence, NB3.4(TRBV5-1)–mTRBC1(S57C)–P2A-NA3.4(TRAV22)–murine TRAC(T48C,S112L,M114I,G115V)

[0462]

[0463] Sequence 117: N5.1.1 TCR expression, gene sequence, NB5.1(TRBV13)–mTRBC1(S57C)–P2A-NA5.1.1(TRAV13-2)–murine TRAC(T48C,S112L,M114I,G115V)

[0464]

[0465]

[0466] Sequence 118: N5.1.1TCR expression, amino acid sequence, NB5.1(TRBV13)–mTRBC1(S57C)–P2A-NA5.1.1(TRAV13-2)–murine TRAC(T48C,S112L,M114I,G115V)

[0467]

[0468] Sequence 119: N5.1.2 TCR expression, gene sequence, NB5.1(TRBV13)–mTRBC1(S57C)–P2A-NA5.1.2(TRAV3)–murine TRAC(T48C,S112L,M114I,G115V).

[0469]

[0470] Sequence 120: N5.1.2TCR expression, amino acid sequence, NB5.1(TRBV13)–mTRBC1(S57C)–P2A-NA5.1.2(TRAV3)–murine TRAC(T48C,S112L,M114I,G115V)

[0471]

[0472] Sequence 121: N4.2 TCR expression, gene sequence, NB4.2(TRBV6-6)–mTRBC1(S57C)–P2A-NA4.2(TRAV4)–murine TRAC(T48C,S112L,M114I,G115V)

[0473]

[0474]

[0475] Sequence 122: N4.2 TCR expression, amino acid sequence, NB4.2(TRBV6-6)–mTRBC1(S57C)–P2A-NA4.2(TRAV4)–murine TRAC(T48C,S112L,M114I,G115V)

[0476]

[0477] Sequence 123: N4.4 TCR expression, gene sequence, NB4.4(TRBV20-1)–mTRBC1(S57C)–P2A-NA4.4(TRAV19)–murine TRAC(T48C,S112L,M114I,G115V)

[0478]

[0479] Sequence 124: N4.4 TCR expression, amino acid sequence, NB4.4(TRBV20-1)–mTRBC1(S57C)–P2A-NA4.4(TRAV19)–murine TRAC(T48C,S112L,M114I,G115V)

[0480]

[0481] Sequence 125: NB5.3(N5.3 TRBV)CDR1 nucleic acid sequence

[0482] CTGGGTCATAACGCT

[0483] Sequence 126: NB5.3(N5.3 TRBV)CDR1 amino acid sequence

[0484] LGHNA

[0485] Sequence 127: NB5.3(N5.3 TRBV)CDR2 nucleic acid sequence

[0486] TACAGTCTTGAAGAACGG

[0487] Sequence 128: NB5.3(N5.3 TRBV)CDR2 amino acid sequence

[0488] YSLEER

[0489] Sequence 129: NB5.3(N5.3 TRBV)CDR3 nucleic acid sequence

[0490] TGCGCCAGCAGCCAAGTCCTTAGCAATCAGCCCCAGCATTTT

[0491] Sequence 130: NB5.3(N5.3 TRBV)CDR3 amino acid sequence

[0492] CASSQVLSNQPQHF

[0493] Sequence 131: NA5.3(N5.3 TRAV)CDR1 nucleic acid sequence

[0494] ACATCTGGGTTCAACGGG

[0495] Sequence 132: NA5.3(N5.3 TRAV)CDR1 amino acid sequence

[0496] TSGFNG

[0497] Sequence 133: NA5.3(N5.3 TRAV)CDR2 nucleic acid sequence

[0498] AATGTTCTGGATGGTTTG

[0499] Sequence 134: NA5.3(N5.3 TRAV)CDR2 amino acid sequence

[0500] NVLDGL

[0501] Sequence 135: NA5.3(N5.3 TRAV)CDR3 nucleic acid sequence

[0502] TGTGCTGTTTTTAACACCAATGCAGGCAAATCAACCTTT

[0503] Sequence 136: NA5.3(N5.3 TRAV)CDR3 amino acid sequence

[0504] CAVFNTNAGKSTF

[0505] Sequence 137: MageA1160-169

[0506] KEADPTGHSY

[0507] Sequence 138: MageA10 192-201

[0508] KEVDPTGHSF

[0509] Sequence 139: N5.3 TCR expression gene sequence, NB5.3(TRBV4-3)-human TRBC1(wildtype)-P2A-NA5.3(TRAV1-2)-human TRAC(wild type)

[0510]

[0511] Sequence 140: N5.3 TCR expression, amino acid sequence, NB5.3(TRBV4-3)-human TRBC1(wildtype)-P2A-NA5.3(TRAV1-2)-human TRAC(wild type)

[0512]

[0513] Sequence 141: N5.3 TCR expression, gene sequence, NB5.3(TRBV4-3)-human TRBC1(S57C)-P2A-NA5.3(TRAV1-2)-human TRAC(T48C,S116L,G119V,F120L mutation)

[0514]

[0515] Sequence 142: N5.3 TCR expression, amino acid sequence, NB5.3(TRBV4-3)-human TRBC1(S57C)-P2A-NA5.3(TRAV1-2)-human TRAC(T48C,S116L,G119V,F120L mutation)

[0516]

[0517] Sequence 143: N5.3 TCR expression, gene sequence: NB5.3(TRBV4-3)-human TRBC2(wildtype)-P2A-NA5.3(TRAV1-2)-human TRAC(wild type)

[0518]

[0519] Sequence 144: N5.3 TCR expression, amino acid sequence: NB5.3(TRBV4-3)-human TRBC2(wildtype)-P2A-NA5.3(TRAV1-2)-human TRAC(wild type)

[0520]

[0521] Sequence 145: N5.3 TCR expression, gene sequence, NB5.3(TRBV4-3)-human TRBC2(S57C)-P2A-NA5.3(TRAV1-2)-human TRAC(T48C,S116L,G119V,F120L mutation)

[0522]

[0523] Sequence 146: N5.3 TCR expression, amino acid sequence, NB5.3(TRBV4-3)-human TRBC2(S57C)-P2A-NA5.3(TRAV1-2)-human TRAC(T48C,S116L,G119V,F120L mutation)

[0524]

[0525]

[0526] Sequence 208: Human TRAC (T48C, S116L, G119V, F120L mutation) nucleic acid sequence

[0527] Sequence 209: Human TRAC (T48C, S116L, G119V, F120L mutant) amino acid sequence

[0528] Sequence 210: Human TRBC1 (S57C mutation) nucleic acid sequence

[0529]

[0530] Sequence 211: Human TRBC1 (S57C mutation) amino acid sequence

[0531]

[0532] Sequence 212: Human TRBC2 (S57C mutation) nucleic acid sequence

[0533]

[0534] Sequence 213: Human TRBC2 (S57C mutation) amino acid sequence

[0535]

Claims

1. A T-cell receptor, characterized in that: The T-cell receptor has the ability to recognize the MageA1 polypeptide epitope presented by HLA class I molecules; Preferably, the HLA class I molecule is HLA-B*15; Preferably, the HLA-B*15 is HLA-B*15:01 or HLA-B*15:

05.

2. A T-cell receptor as described in claim 1, characterized in that: The MageA1 polypeptide includes the sequence KEADPTGHSY (SEQ ID NO:137) or KEVDPTGHSF (SEQ ID NO:138); Preferably, the MageA1 polypeptide is about 8-11 amino acids in length; more preferably, the MageA1 polypeptide is about 10 amino acids in length. Preferably, the MageA1 polypeptide is composed of the sequence KEADPTGHSY (SEQ ID NO: 137) or KEVDPTGHSF (SEQ ID NO: 138); Preferably, the MageA1 polypeptide epitope is generated through the intracellular degradation pathway of MageA1 protein, loaded onto the antigen-binding groove of the HLA-B*15 molecule polypeptide, and then transported to the cell membrane surface. Preferably, the MageA1 polypeptide is composed of the sequence KEADPTGHSY (SEQ ID NO:137).

3. A T-cell receptor as described in claim 1, characterized in that: The T-cell receptor includes at least one complementarity-determining region 3 (CDR3) of a variable region, the complementarity-determining region 3 comprising an amino acid sequence selected from the amino acid sequences shown in SEQ ID NO:130, SEQ ID NO:136 or functional variants thereof; Preferably, the T-cell receptor includes a variable region (Vα) of the TCRα chain and / or a variable region (Vβ) of the TCRβ chain; wherein, the complementarity-determining region 3 (CDR3) of at least one of the variable regions of Vα and / or Vβ comprises an amino acid sequence selected from the amino acid sequences shown in SEQ ID NO:130, SEQ ID NO:136 or functional variants thereof; Preferably, the CDR1 and CDR2 of the Vα respectively contain the amino acid sequences shown in SEQ ID NO:132 and SEQ ID NO:134 or their functional variants; Preferably, the CDR1 and CDR2 of the Vβ respectively contain the amino acid sequences shown in SEQ ID NO:126 and SEQ ID NO:128 or their functional variants; Preferably, the amino acid sequences of the Vα and Vβ variable regions are as shown in SEQ ID NO:58 and SEQ ID NO:56, respectively, or sequences that have at least 90% identity with the amino acid sequences shown in SEQ ID NO:58 and SEQ ID NO:

56. Preferably, the amino acid sequence of the Vα variable region is as shown in SEQ ID NO:58, and the amino acid sequence of the Vβ variable region is as shown in SEQ ID NO:56; Preferably, the α-chain and β-chain of the TCR further include constant regions (C-regions), and the amino acid sequences of the constant regions can be derived from the constant regions of TCRs of suitable species, such as humans or mice. Preferably, the amino acid sequence of the α-chain constant region of the TCR is selected from any of the following sequences, such as SEQ ID NO:84, SEQ ID NO:90, SEQ ID NO:100, and SEQ ID NO:209; Preferably, the amino acid sequence of the β-chain constant region of the TCR is selected from any of the following sequences, such as SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:211, and SEQ ID NO:

213.

4. A T-cell receptor as described in claim 1, characterized in that: The TCR is a chimeric TCR; Preferably, the TCR is a single-chain TCR (scTCR) or a chimeric TCR dimer; Preferably, the amino acid sequence of the TCR is as shown in any one of SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, or SEQ ID NO:

146. Preferably, the TCR is an antigen-binding fragment of a TCR or a chimeric antigen receptor (CAR), wherein the antigen-binding fragment of the TCR may be selectively linked to a transmembrane or intracellular signal transduction domain. Preferably, the T-cell receptor is at least one soluble TCR; Preferably, the T-cell receptor can be modified; Preferably, the T cell receptor may be fused with a functional domain; Preferably, the T-cell receptor may bind to a detectable marker, a therapeutic agent, or be PEGylated; Preferably, the T-cell receptor is highly specific, specifically recognizing the MageA1 polypeptide epitope (SEQ ID NO:1) without any cross-reactivity; Preferably, the T cell receptor's binding to or response to the MageA1 polypeptide epitope (SEQ ID NO:1) is concentration-dependent; Preferably, the concentration of MageA1 has a significant dose-effect when it is between 10 μg / ml and 1 ng / ml; Preferably, the T cell receptor binds to the MageA1 polypeptide epitope (SEQ ID NO:137) presented by HLA-B*15 to activate or enhance the immune response; Preferably, the binding of the T cell receptor to the MageA1 polypeptide epitope (SEQ ID NO:1) presented by HLA-B*15 promotes or induces effector cells to express cytokines such as CD107a, IFN-γ, TNF-α (tumor necrosis factor), and IL-2; preferably, the IFN-γ secretion can exceed 500 pg / ml. Preferably, the T cell receptor binds to the MageA1 polypeptide epitope (SEQ ID NO:137) presented by HLA-B*15 to induce effector cells to express CD137; Preferably, the binding of the T cell receptor to the MageA1 polypeptide epitope (SEQ ID NO:137) presented by HLA-B*15 can enhance the killing activity of effector cells against target cells. Preferably, the effector cells can be peripheral blood lymphocytes (PBLs) or peripheral blood mononuclear cells (PBMCs); more preferably, the effector cells are immune effector cells, especially T cells; Preferably, the target cells are tumor cells expressing MageA1; more preferably, the target cells include not only tumor cells endogenously expressing MageA1, but also tumor cells exogenously expressing MageA1. Preferably, the tumor cells include, but are not limited to, lung cancer cells, melanoma cells, small cell lung cancer cells, and non-small cell lung cancer cells.

5. A nucleic acid molecule, characterized in that: The nucleic acid molecule comprises a nucleotide sequence or its complementary sequence encoding the TCR that recognizes the MageA1 polypeptide epitope presented by HLA-B15:01 as described in any one of claims 1-4.

6. An expression vector, characterized in that: The expression vector comprises the nucleic acid molecule of claim 5 or expresses the T-cell receptor.

7. An engineered cell, characterized in that: The engineered cells include any cells suitable for expressing the TCR of any one of claims 1-4 and activating an immune response, or cells containing the nucleic acid molecule of claim 5 or the expression vector of claim 6.

8. A pharmaceutical composition, characterized in that: The active ingredient includes the specific TCR for recognizing the MageA1 polypeptide epitope presented by HLA-B15:01 as described in any one of claims 1-4, the nucleic acid molecule as described in claim 5, the carrier as described in claim 6, or the cell as described in claim 7.

9. The use of the specific TCR for recognizing the MageA1 polypeptide epitope presented by HLA-B15:01 as described in any one of claims 1-4, the nucleic acid molecule as described in claim 5, the carrier as described in claim 6, the cell as described in claim 7, or the pharmaceutical composition as described in claim 8 in the preparation of a medicament for the treatment and prevention of tumors.

10. An isolated HLA-peptide target, characterized in that: The HLA-peptide target comprises HLA class I molecules and a restriction peptide, wherein the restriction peptide comprises the sequence KEADPTGHSYSEQ, and the HLA class I molecule is HLA subtype B*15:

01.

11. A method for detecting tumors, characterized in that: The detection was performed using the anti-MageA1T-cell receptor according to any one of claims 1-4.

Images