LED-based real-time fluorescent ultrafast photothermal PCR device

Abstract

The application belongs to the technical field of biomedical detection equipment, and relates to a real-time fluorescent ultrafast photothermal PCR device based on an LED, which comprises an LED excitation module, a PCR reaction cavity, a temperature detection module, a refrigeration module, a fluorescence acquisition module and a temperature control system; the LED excitation module adopts a high-power LED light source with an output power of 10-100 W, and LED light is projected to the outer wall of the PCR reaction cavity through multiple light collection light paths; the temperature detection module is a non-contact infrared temperature measurement sensor; the refrigeration module is an aluminum alloy integrated refrigeration module, which integrates a Peltier refrigeration sheet and a cooling fan; the temperature control system integrates a PID temperature control algorithm and a pulse width modulation technology; the temperature control precision can reach ±1 DEG C; the PCR denaturation temperature range is 90-95 DEG C; the application has compact structure and controllable cost, and meets the actual application requirements of new infectious disease prevention and control and normalization screening.

Description

Technical Field

[0001] This invention belongs to the field of biomedical detection equipment technology, specifically relating to an LED real-time fluorescence ultrafast photothermal PCR device. Background Technology

[0002] Nucleic acid amplification test (NAAT) is a crucial technique for the in vitro replication and detection of target genes. This technology allows for the direct extraction of trace amounts of target genes from cell tissues for amplification and detection without the need for cell culture. Currently, temperature-dependent amplification and isothermal amplification techniques are widely used in disease diagnosis, food safety, environmental monitoring, and many other fields. Among these, polymerase chain reaction (PCR), with its high sensitivity and specificity, has become the mainstream technology in nucleic acid detection and a core method for the clinical diagnosis of infectious diseases. Currently, facing the practical needs of emerging infectious disease prevention and control, and routine infectious disease screening at the grassroots level, the market has placed higher demands on miniaturized, high-speed PCR testing equipment. Ultrafast PCR technology can perform rapid detection and quantitative analysis of target genes, possessing extremely high application value in scenarios such as infectious disease early warning and virus control.

[0003] Traditional PCR equipment often uses Peltier elements, relying on heat conduction for thermal cycling, resulting in slow heating and cooling rates and long overall detection times. To address this, the industry has gradually developed ultrafast photothermal PCR technology based on nanomaterials. This technology utilizes photothermal conversion mechanisms such as noble metal plasmon resonance, semiconductor band transitions, and vibrational relaxation of organic dye molecules to convert light energy into heat energy to construct the PCR thermal cycling system. This bulk heating mode replaces traditional heat conduction heating, significantly improving heating and cooling rates and shortening nucleic acid amplification time. Existing technologies have already utilized carbon black films and gold-magnetic composite photothermal materials to construct photothermal PCR detection systems, effectively achieving rapid nucleic acid detection.

[0004] However, existing ultrafast photothermal PCR devices still have many shortcomings: First, most existing devices use contact-type K-type thermocouples for temperature detection, which not only easily leads to reagent contamination, but temperature fluctuations also introduce detection errors, requiring additional compensation circuits and sensing components, increasing the difficulty of device integration. At the same time, the photothermal system of nanomaterials has a fast heating rate, high thermal inertia, and a lag in temperature response, which prolongs the amplification time and reduces the accuracy of temperature control. Second, the preparation process of existing photothermal functional nanomaterials is complex and the production cost is high, making it difficult to adapt to the large-scale development and widespread application of nucleic acid detection kits. Furthermore, current research results are mostly at the laboratory prototype stage, and there is still no highly integrated, stable, and commercially viable ultrafast photothermal PCR device.

[0005] Therefore, developing an ultrafast photothermal PCR device that combines rapid heating, accurate temperature measurement, strong stability, high integration, and ease of industrialization has become an urgent technical problem to be solved in this field. Summary of the Invention

[0006] This invention provides the following technical solution: an LED real-time fluorescence ultrafast photothermal PCR device, comprising an LED excitation module, a PCR reaction chamber, a temperature detection module, a cooling module, a fluorescence acquisition module, and a temperature control system. The LED excitation module, the PCR reaction chamber, and the cooling module are sequentially assembled to form the overall optical path and temperature control chamber structure. The temperature detection module and the fluorescence acquisition module are respectively set corresponding to the PCR reaction chamber. The temperature control system is electrically connected to the LED excitation module, the temperature detection module, the cooling module, and the fluorescence acquisition module.

[0007] The LED excitation module uses a high-power LED light source with a peak wavelength of 808±10 nm, and the rated output power of the LED in the module is 10~100W. The module features a multi-focusing optical path structure, including a light-collecting lens, a light-reflecting tube, and a light-emitting lens. All light emitted from the LED excitation module is projected onto the outer wall of the PCR reaction chamber through this multi-focusing optical path. The temperature detection module is a non-contact infrared temperature sensor used to collect the temperature of the reaction solution inside the PCR reaction chamber in real time. The cooling module is an integrated aluminum alloy cooling module, integrating a Peltier cooling pad and a cooling fan for rapid cooling of the PCR reaction chamber. The temperature control system integrates a PID temperature control algorithm and pulse width modulation technology. It receives the temperature signal from the temperature detection module and uses a closed-loop control system to regulate the output power of the LED excitation module and the operating status of the cooling module. The overall temperature control accuracy is ±1℃; the PCR denaturation temperature range is 90~95℃. The temperature control system of this device adopts the industry-standard PID closed-loop temperature control algorithm combined with pulse width modulation (PWM) technology. Based on the temperature deviation signal collected in real time by the infrared temperature sensor, it dynamically adjusts the output power of the LED excitation module and the Peltier cooling module to achieve continuous and high-precision temperature control of the PCR thermal cycling process.

[0008] The device is equipped with a single-channel data analysis system, which communicates with both the temperature control system and the fluorescence acquisition module. This system is used to acquire and store temperature data and fluorescence signals in real time, and to generate thermal cycling and fluorescence amplification curves. The single-channel data analysis system is a standard data processing module in the field, communicating with both the temperature control system and the fluorescence acquisition module to acquire and store temperature data and fluorescence signals in real time, automatically generating thermal cycling and fluorescence amplification curves to visually demonstrate the entire PCR amplification process.

[0009] Preferably, the temperature control chamber structure is hexagonal prism-shaped, with the PCR reaction chamber located at the center of rotation of the temperature control chamber structure. The PCR reaction chamber has a stepped hole structure that is concave from top to bottom and wider at the top than at the bottom. Three sets of cooling modules are provided, arranged on the spaced sidewalls of the hexagonal prism-shaped temperature control chamber. The LED excitation module, temperature detection module, and fluorescence acquisition module are staggered with the cooling modules. The cold end of the cooling module is attached to the sidewall of the temperature control chamber, and the hot end of the cooling module is equipped with a cooling fan. This staggered layout allows for independent installation of each functional module, avoiding structural interference between functional components. Simultaneously, the three sets of cooling modules can uniformly cool the central PCR reaction chamber, further improving the cooling rate, ensuring temperature uniformity during the cooling process, and meeting the requirements for rapid cooling during PCR thermal cycling.

[0010] Preferably, the light-collecting lens is a hemispherical mirror, with its flat end facing the emission direction of the LED light source and its convex spherical end facing the light-emitting lens, which is a convex lens. The optical axes of the light-collecting lens and the light-emitting lens coincide. The emission direction of the light-emitting lens is directly opposite the outer wall of the PCR reaction chamber. A light-reflecting tube is fitted outside the light-collecting lens, with its rotation axis coinciding with the optical axis of the light-collecting lens. The multi-focusing optical path structure is embedded inside the side wall of the temperature control chamber structure. The hemispherical mirror collects the large-angle divergent light emitted by the LED light source, and the light-reflecting tube blocks stray light from escaping outwards. After being focused by the convex lens, all the light is projected onto the PCR reaction chamber, improving light energy utilization, ensuring sufficient light power for the central reaction zone, and achieving rapid heating.

[0011] Preferably, the rated output power of the LED light source is 70 W, and after the LED excitation module is optimized through multiple focusing optical paths, the maximum instantaneous heating rate of the PCR reaction chamber is 20 ℃ / s.

[0012] Preferably, the maximum cooling rate of the cooling module can reach 10 °C / s.

[0013] Preferably, the PCR reaction chamber is equipped with a PCR reaction tube, which is filled with a photothermal medium and PCR amplification solution. The photothermal medium is AuNR@SiO2 gold-silicon core-shell structured nanomaterial, and the ultraviolet absorption wavelength range of the gold-silicon core-shell structured nanomaterial is 750~860 nm.

[0014] More preferably, the AuNR@SiO2 gold-silicon core-shell structured nanomaterial has a gold nanorod as the core and a silicon dioxide passivation layer on the outside. The silicon dioxide passivation layer is used to suppress the thermal deformation of the gold nanorod during repeated photothermal cycling and improve the operational stability of the photothermal system.

[0015] Even better, the fluorescence acquisition module integrates a camera and a laser probe, which can read the fluorescence signal changes of the fluorescent dye in the PCR reaction tube in real time and output the fluorescence signal in association with the number of thermal cycles.

[0016] Preferably, the single-channel data analysis system is connected to a host operating software via a communication port. The host operating software has functions such as custom setting of thermal cycling parameters, correction of equipment parameters, equipment self-test, and visualization of operating status. The single-channel data analysis system connects to the host operating software via a communication port. This host software is a conventional human-computer interaction program in the field, which can flexibly set PCR thermal cycling parameters, calibrate temperature control parameters, and display the equipment operating status, temperature curves, and fluorescence signal changes in real time, adapting to the ultrafast photothermal PCR detection process of this device.

[0017] The real-time fluorescence ultrafast photothermal PCR detection method of the present invention includes the following steps: S1: Prepare AuNR@SiO2 gold-silicon core-shell structured photothermal nanomaterials and prepare PCR amplification solution containing the plasmid DNA to be tested, primers, fluorescent dyes, DNA polymerase, and dNTP mixture. Mix the photothermal nanomaterials with the PCR amplification solution and add them to the PCR reaction tube. Then place the PCR reaction tube inside the PCR reaction chamber. S2: Connect the device power supply, complete the device communication connection, parameter configuration and whole machine self-test through the upper operation software, set the PID temperature control parameters, thermal cycle parameters and cooling temperature parameters, start the cooling system, and after the cooling temperature reaches the standard, preheat the whole machine for no less than 20 minutes. S3: Start the thermal cycling program. The temperature control system controls the 10~100W, 808±10 nm LED light source to work. The PCR reaction tube is photothermally heated through multiple focusing optical paths. The integrated aluminum alloy cooling module completes the heating and cooling cycle. A single thermal cycle realizes DNA denaturation, annealing and extension reactions. The infrared temperature sensor collects temperature data non-contactly throughout the process, and the fluorescence acquisition module collects fluorescence signals simultaneously. S4: The single-channel data analysis system receives temperature data and fluorescence signals in real time, generates and displays thermal cycling curves and fluorescence amplification curves, and completes 41 consecutive thermal cycles within 7 minutes. S5: After the thermal cycling process is completed, the device will automatically shut down, and the operator will determine the amplification result of the nucleic acid to be tested based on the fluorescence amplification curve.

[0018] Specifically, the preparation steps of the AuNR@SiO2 gold-silicon core-shell structured photothermal nanomaterial in step S1 are as follows: S101: Prepare a mixed solution by mixing HAuCl4 solution and CTAB solution, and then add NaBH4 solution sequentially to prepare AuNR seed solution; prepare a growth solution by mixing HAuCl4 solution, CTAB solution, AgNO3, L-ascorbic acid and HCl, and then react the AuNR seed solution with the growth solution to prepare pure gold nanorod solution. S102: PEG solution was added to the gold nanorod solution for modification, and AuNR@PEG complex was obtained by centrifugation. S103: Dissolve the AuNR@PEG composite in pure water, then add ammonia-isopropanol solution and TEOS-isopropanol solution in sequence, and stir continuously for 2 hours to obtain AuNR@PEG@SiO2 gold-silicon core-shell structured photothermal nanomaterials.

[0019] In step S3, the LED light source is a 70 W high-power light source, the PCR reaction chamber heating rate is 2~20 ℃ / s, the cooling rate can reach 10 ℃ / s, the PCR denaturation temperature is controlled within the range of 90~95 ℃, and the overall temperature fluctuation is controlled within ±1 ℃.

[0020] In step S1, the total volume of the PCR amplification solution is 25 μL, containing a final concentration of 5 × 10⁻⁶. - ² ng / μL monkeypox virus plasmid DNA, 0.5 μM forward primer, 0.5 μM reverse primer, 1×SYBR fluorescent dye, and 0.2 U / μL DNA polymerase.

[0021] The beneficial effects of this invention are: 1. This invention uses a non-contact infrared temperature sensor to replace the traditional K-type thermocouple, completely avoiding the PCR reaction solution contamination problem caused by contact temperature measurement, while effectively shortening the temperature response time and improving the timeliness of temperature measurement.

[0022] 2. This invention integrates proportional-integral-derivative control with pulse width modulation technology, enabling real-time, high-precision temperature feedback and regulation, and ensuring temperature stability during the PCR thermal cycling process.

[0023] 3. This invention is equipped with a single-channel data analysis system that can output thermal cycling curves in real time; with an optimized operating interface, various thermal cycling parameters can be flexibly set to meet the temperature control requirements of different testing scenarios.

[0024] 4. This invention integrates the LED heating module and the temperature feedback module into one unit, and completes the overall machine construction in conjunction with temperature control, filling the relevant technology gap and realizing the application of domestically produced ultrafast PCR equipment.

[0025] 5. The fluorescence reading module of this invention can correlate fluorescence signal changes with the number of thermal cycles, intuitively presenting fluorescence growth nodes, making it easier for operators to quickly determine the timing of nucleic acid amplification products, and improving the readability and analysis efficiency of detection results. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of an LED real-time fluorescence ultrafast photothermal PCR device according to the present invention. Figure 2 This is a top view of the structure of the present invention; Figure 3 This is a schematic diagram of the multiple focusing structure of the LED excitation module of the present invention.

[0027] In the diagram, 1. LED excitation module; 2. PCR reaction chamber; 3. Temperature detection module; 4. Cooling module; 5. Fluorescence acquisition module; 6. Fan; 7. Peltier cooler; 8. Light collecting lens; 9. Light emitting lens; 10. Light reflecting tube. Detailed Implementation

[0028] The related technologies of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0029] like Figures 1-3As shown, the LED real-time fluorescence ultrafast photothermal PCR device of this embodiment includes an 808 ±10nm LED, a temperature detection module 3 using an infrared temperature sensor, a temperature control system and a single-channel data analysis system, a PCR tube cooling integrated design module, a camera, and a laser probe. The actual power output of the LED (peak wavelength 808+ / -10nm, factory power 50W) is increased through multiple focusing optical paths to meet the requirements of rapid heating. Coupled with a non-contact infrared temperature sensor, temperature control can be achieved for different batches of nanoparticles (different wavelengths, concentrations, etc.) to meet the ultra-high temperature requirements of PCR (90-95℃). Combined with a proportional-integral-derivative control algorithm (PID temperature control algorithm with adaptive adjustment function) and pulse width modulation technology (programmed temperature control function), precise temperature control is achieved, ensuring that the PCR amplification efficiency is not reduced due to excessive temperature deviation. If the denaturation temperature is too low, the DNA cannot be converted from double strand to single strand to continue the PCR amplification process. If the denaturation temperature is too high, a large number of primer dimers will be generated. After integrating the LED excitation module 1 and the temperature detection module 3, the temperature accuracy can be controlled within ±1℃ (commercial real-time fluorescence PCR ±0.5℃). A single-channel data analysis system was used to acquire real-time temperature data and perform image processing. Based on the size of commercial PCR tubes, Solidworks was used to design an integrated cooling module, and aluminum alloy materials were used to prepare a constant-temperature cooling environment. Finally, the modules were integrated and the whole machine was controlled. Visual operation with independent design software was achieved through a communication port, which can display the thermal cycling curve of the PCR amplification process. At the same time, the fluorescence reading interface can observe the fluorescence value increase in real time to ensure the PCR reaction amplification process.

[0030] This embodiment optimizes the LED optical path. When an 808 nm laser heats the nanoparticle PCR reaction solution, a conventional 10 W 808 nm LED cannot achieve rapid heating, with a maximum heating rate of 2-3 °C / s and a photoelectric conversion efficiency of 20%-30% as measured by a densitometer. Therefore, increasing the LED power to 70 W resulted in excessive light loss due to the large divergence angle, which could not meet the heating requirements. Thus, a multi-focusing optical path was designed to ensure that the output light is completely irradiated onto the PCR tube wall to achieve rapid heating, with a maximum instantaneous rate of 20 °C / s. Testing showed that 41 thermal cycles could be completed within 7 minutes. Furthermore, this embodiment selects an LED as the light source to achieve rapid heating of the nanomaterials. Under the same excitation wavelength of 808 nm, the cost of an LED is at least 1 / 10 lower than that of a laser. This can further reduce costs after commercial mass production, providing a possible foundation for the commercialization of photothermal PCR technology.

[0031] Choosing high-power LEDs can easily lead to localized overheating and damage to the LED components themselves. Therefore, this embodiment designs an integrated cooling module 4 made of aluminum alloy. This not only prevents damage to the original components but, more importantly, increases the cooling rate to 7℃ / s, compared to 1~2℃ / s for conventional commercial qPCR, representing an improvement of 5~6℃ / s. Therefore, this embodiment can meet the temperature control requirements for different thermal cycling parameter settings.

[0032] This implementation method is based on the optimization of nanomaterials. Gold nanorods (AuNR) used as photothermal materials undergo thermal deformation after 7 minutes (41 thermal cycles), making it impossible to guarantee a consistent heating and cooling rate for each cycle. Therefore, AuNR@SiO2 is needed as the core reagent. Due to the passivation effect of the silicon layer, the rapid heating of the gold nanorods can prevent localized liquid boiling, thereby improving the stability of the reaction system.

[0033] Example I. Preparation of Gold-Silicon Core-Shell Nanomaterials 1. Mix HAuCl4 solution and CTAB solution at a concentration ratio of 1:10 to obtain HAuCl4-CTAB mixture; mix HAuCl4-CTAB mixture at a concentration ratio of 3:50 with NaBH4 solution, and wait for the reaction solution to turn brown to obtain AuNR seed solution. Mix HAuCl4 solution, CTAB solution, AgNO3, L-ascorbic acid and HCl at a concentration ratio of 1:10:1:10:10 to obtain growth solution. Mix AuNR seed solution and growth solution to obtain AuNR solution.

[0034] 2. Mix AuNR solution and PEG at a volume ratio of 20:1, centrifuge to obtain AuNR@PEG.

[0035] 3. Dissolve AuNR@PEG in water, and while stirring, sequentially add an ammonia-isopropanol solution and a TEOS-isopropanol solution with a volume ratio of 143:80. Continue stirring for 2 hours to obtain an AuNR@PEG@SiO2 solution, which is a gold-silicon core-shell structured photothermal nanomaterial. The absorbance of this AuNR@PEG@SiO2 solution was measured by ultraviolet spectroscopy, and the absorption wavelength was found to be 750–860 nm.

[0036] II. Construction of PCR Reaction System Based on Gold-Silicon Core-Shell Structure The PCR amplification buffer consisted of DEPC water, 1.25 μL of 1× SYBR fluorescent dye, 1 μL of 0.2 U / μL DNA polymerase, 2 μL of 200 μM dNTP mixture, 2.5 μL of 1× 10× Fast buffer I, and 1.25 μL of monkeypox virus (plasmid DNA) solution with a final concentration of 5×10⁻² ng / μL, along with 1.25 μL of 0.5 μM forward primer (CAGAATCTGTAGGCCGTGTATC) and 1.25 μL of 0.5 μM reverse primer (TGATCTTCAACGTAGTGCTATGG), for a total reaction volume of 25 μL.

[0037] III. Operating Procedures After starting the PCR device, enter the communication interface and set the device address to 192.168.1.8 and port number 502. After connecting, complete the device self-test. Once the PCR device is successfully connected, confirm that the camera cable connection is normal. Enter the settings interface to confirm the PID parameters, set the temperature correction, and start data acquisition. The interface will display the real-time temperature curve.

[0038] When operating the refrigeration system, start the refrigeration system after setting the temperature and completing the parameter configuration.

[0039] During thermal cycling, after starting data collection, confirm that the cooling temperature is within the acceptable range and that the equipment has been preheated for ≥20 minutes. Start thermal cycling until the PCR device completes its operation and automatically stops; alternatively, you can manually operate the system during the process.

[0040] In summary, this invention proposes a highly integrated, stable, and commercially viable LED-based real-time fluorescence ultrafast photothermal PCR device. Utilizing gold-silicon core-shell nanomaterials as the photothermal conversion medium, it combines high-power LEDs with multiple focusing optical paths to achieve rapid heating. Non-contact infrared temperature measurement and precise temperature control algorithms ensure accurate temperature control. This solution addresses the problems of contamination and slow response in traditional contact temperature measurement methods, while also overcoming the shortcomings of poor stability and high manufacturing costs of existing photothermal materials. It can complete 41 thermal cycles within 7 minutes, significantly shortening nucleic acid testing time. Furthermore, the overall device is compact and cost-effective, providing a high-performance, domestically produced equipment solution for rapid nucleic acid testing at the grassroots level, meeting the practical application needs of emerging infectious disease prevention and control and routine screening.

[0041] It should be emphasized that the above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention shall still fall within the scope of the technical solution of the present invention.

Claims

1. An LED-based real-time fluorescence ultrafast photothermal PCR device, comprising an LED excitation module, a PCR reaction chamber, a temperature detection module, a cooling module, a fluorescence acquisition module, and a temperature control system, wherein the LED excitation module, the PCR reaction chamber, and the cooling module are sequentially assembled to form the overall optical path and temperature control chamber structure; the temperature detection module and the fluorescence acquisition module are respectively disposed corresponding to the PCR reaction chamber; and the temperature control system is electrically connected to the LED excitation module, the temperature detection module, the cooling module, and the fluorescence acquisition module, characterized in that: The LED excitation module uses a high-power LED light source with a peak wavelength of 808±10 nm and the rated output power of the LED in the LED excitation module is 10 to 100W. The LED excitation module is equipped with a multi-focusing optical path structure, which includes a light collecting lens, a light reflecting tube and a light emitting lens. The light emitted by the LED excitation module is projected onto the outer wall of the PCR reaction chamber through the multi-focusing optical path. The temperature detection module is a non-contact infrared temperature sensor used to collect the temperature of the reaction solution inside the PCR reaction chamber in real time. The cooling module is an integrated aluminum alloy cooling module that integrates a Peltier cooling pad and a cooling fan for rapid cooling of the PCR reaction chamber. The temperature control system integrates PID temperature control algorithm and pulse width modulation technology. It receives the temperature signal from the temperature detection module and controls the output power of the LED excitation module and the operating status of the cooling module in a closed loop. The overall temperature control accuracy can reach ±1℃; the PCR denaturation temperature range is 90~95℃. The device is equipped with a single-channel data analysis system, which is connected to the temperature control system and the fluorescence acquisition module for real-time acquisition and storage of temperature data and fluorescence signals, and generation of thermal cycling curves and fluorescence amplification curves.

2. The LED real-time fluorescence ultrafast photothermal PCR device according to claim 1, characterized in that, The temperature control chamber has a hexagonal prism structure, and the PCR reaction chamber is located at the center of rotation of the temperature control chamber structure. The PCR reaction chamber has a stepped hole structure that is concave from top to bottom and wider at the top than at the bottom. There are three sets of cooling modules, which are arranged on the spaced sidewalls of the hexagonal prism-shaped temperature control chamber. The LED excitation module, temperature detection module, and fluorescence acquisition module are arranged alternately with the cooling modules. The cold end of the refrigeration module is attached to the side wall of the temperature control cavity, and the hot end of the refrigeration module is equipped with the cooling fan.

3. The LED real-time fluorescence ultrafast photothermal PCR device according to claim 1, characterized in that, The light-collecting lens is a hemispherical mirror, with its flat end facing the emission direction of the LED light source and its convex spherical surface facing the light-emitting lens, which is a convex lens; the light-collecting lens and the light-emitting lens have their optical axes coincident. The light-emitting lens emits light in a direction that is directly opposite the outer wall of the PCR reaction chamber. The light reflecting tube is sleeved outside the light collecting lens, and the rotation axis of the light reflecting tube coincides with the optical axis of the light collecting lens; The multiple focusing optical path structure is embedded inside the side wall of the temperature control cavity structure.

4. The LED real-time fluorescence ultrafast photothermal PCR device according to claim 1, characterized in that, The rated output power of the LED light source is 70 W, and after optimization of the multiple focusing optical paths, the maximum instantaneous heating rate of the PCR reaction chamber is 20 ℃ / s.

5. The LED real-time fluorescence ultrafast photothermal PCR device according to claim 1, characterized in that, The maximum cooling rate of the cooling module can reach 10 ℃ / s.

6. The LED real-time fluorescence ultrafast photothermal PCR device according to claim 1, characterized in that, The PCR reaction chamber is equipped with PCR reaction tubes, which are filled with photothermal medium and PCR amplification solution. The photothermal medium is AuNR@SiO2 gold-silicon core-shell structured nanomaterial, and the ultraviolet absorption wavelength range of the gold-silicon core-shell structured nanomaterial is 750~860 nm.

7. The LED real-time fluorescence ultrafast photothermal PCR device according to claim 6, characterized in that, The AuNR@SiO2 gold-silicon core-shell structured nanomaterial uses gold nanorods as the core and is coated with a silicon dioxide passivation layer. The silicon dioxide passivation layer is used to suppress thermal degeneration of the gold nanorods during repeated photothermal cycles and improve the operational stability of the photothermal system.

8. The LED real-time fluorescence ultrafast photothermal PCR device according to claim 6, characterized in that, The fluorescence acquisition module integrates a camera and a laser probe, which can read the changes in fluorescence signal of fluorescent dye in PCR reaction tubes in real time and output the fluorescence signal in association with the number of thermal cycles.

9. The LED real-time fluorescence ultrafast photothermal PCR device according to claim 1, characterized in that, The single-channel data analysis system is connected to a host operating software via a communication port; the host operating software has functions such as custom setting of thermal cycling parameters, correction of equipment parameters, equipment self-test, and visualization of operating status.

Images