Ganoderma lucidum strain yw-1 with high yield of triterpenes and sterols, identification method, cultivation method, molecular marker primer set and purposes

Abstract

The application discloses a ganoderma strain YW-1 with high yield of triterpenes and sterols, and an identification method, a cultivation method, molecular marker primers and purposes thereof. The ganoderma strain YW-1 is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC No: 67757, and the ITS sequence is shown as SEQ ID NO. 9. The ganoderma strain YW-1 provided in the application is stable in growth, high in yield, and outstanding in triterpenes and sterol content. Meanwhile, the strain authenticity can be quickly and accurately identified through PCR amplification using specific Indel molecular marker primers, and the cost is low and the stability is good.

Description

Technical Field

[0001] This invention belongs to the fields of edible and medicinal fungi and molecular biology, specifically relating to a Ganoderma lucidum strain YW-1 that produces high levels of triterpenes and sterols, its identification method, cultivation method, molecular marker primer set, and uses. Background Technology

[0002] Reishi mushroom, an important medicinal and edible fungus in my country, boasts a long history of medicinal use and a wide range of health benefits, demonstrating immense industrial development and application value in functional foods, health foods, cosmetics, and pharmaceuticals. In recent years, with the advancement of the "Healthy China" strategy and the booming development of the health industry, market demand for Reishi products has continued to grow, and the requirements for raw material quality and functional active ingredients have become increasingly stringent. The cultivation and precise identification of high-quality local varieties have become the core driving force for industrial upgrading. However, the main cultivated varieties in China are still primarily from the Korean Reishi series, and this single-source structure severely restricts the high-quality development of the industry. Meanwhile, existing molecular marker technologies such as RFLP (Restriction Fragment Length Polymorphism), RAPD (Random Amplified Polymorphic DNA), and SSR (Simple Sequence Repeat) have limitations in accuracy, stability, and ease of operation, making it difficult to meet the needs of rapid and precise identification of strains in industrial cultivation. Therefore, it is urgent to select high-quality local Reishi varieties and develop simple, accurate, and efficient new specific molecular marker identification methods. Summary of the Invention

[0003] The present invention aims to provide a Ganoderma lucidum strain YW-1 that produces high levels of triterpenes and sterols, along with its identification method, cultivation method, molecular marker primer set, and applications. This invention addresses the problems in the prior art, such as the scarcity of high-quality native Ganoderma lucidum varieties and the lack of specific molecular marker identification methods for the strain, which leads to difficulties in identifying the authenticity of the strain and easy confusion with similar strains.

[0004] To achieve the above objectives, the first aspect of the present invention provides:

[0005] A Ganoderma lucidum strain that produces high levels of triterpenes and sterols, wherein the strain is Ganoderma lucidum YW-1, deposited at Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 67757.

[0006] Preferably, the ITS sequence of the Ganoderma lucidum YW-1 is shown in SEQ ID NO.9.

[0007] The second aspect of the present invention provides:

[0008] An InDel molecular marker primer set for detecting or identifying the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols, wherein the primer set comprises any one or more of the following pairs:

[0009] (1) Primer pair 1 consisting of the forward primer shown in SEQ ID NO. 1 and the reverse primer shown in SEQ ID NO. 2;

[0010] (2) Primer pair 2 consisting of the forward primer shown in SEQ ID NO. 3 and the reverse primer shown in SEQ ID NO. 4;

[0011] (3) Primer pair 3 consisting of the forward primer shown in SEQ ID NO. 5 and the reverse primer shown in SEQ ID NO. 6.

[0012] The third aspect of the present invention is provided as follows:

[0013] A method for detecting or identifying the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols, includes the following steps:

[0014] DNA was extracted from the sample to be tested, and a PCR amplification system was established using the primer pairs in the InDel molecular marker primer set as PCR primers and amplification was performed. When the amplification result of any one or more of primer pairs 1, 2 or 3 is positive, the sample to be tested is determined to be Ganoderma lucidum strain YW-1.

[0015] Preferably, the PCR amplification reaction system comprises, by volume: DNA template 2 μL, forward primer 2 μL, reverse primer 2 μL The concentration of the DNA template was 50 ng / μL, and the concentrations of both the forward and reverse primers were 10 μmol / L.

[0016] Preferably, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 30 sec, for 32 cycles; and finally 72℃ extension for 10 min.

[0017] The fourth aspect of the present invention is provided as follows:

[0018] A method for cultivating the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols, includes the following steps:

[0019] (1) The mother culture of Ganoderma lucidum YW-1 was inoculated into the original culture medium and cultured to obtain the original culture;

[0020] (2) The original strain is inoculated into the cultivation medium and cultured. After the mycelium fills the bag, the bag is opened and the fruiting bodies are harvested and managed.

[0021] Preferably, the original culture medium comprises, by mass fraction: 75-80% sorghum, 15-25% millet and 1-2% calcium carbonate;

[0022] The cultivation medium comprises, by mass fraction: 55-60% sawdust, 30-35% cottonseed hulls, 10-15% wheat bran, and 1-2% calcium carbonate.

[0023] Preferably, the original culture medium comprises, by mass fraction: 78% sorghum, 20% millet and 2% calcium carbonate;

[0024] The cultivation medium comprises, by mass fraction: 58% sawdust, 31% cottonseed hulls, 10% wheat bran, and 1% calcium carbonate.

[0025] Preferably, the cultivation management conditions in step (2) are: temperature 25-28℃, humidity 85-95%, carbon dioxide concentration 800-1500 ppm, light intensity 600-800 lx, and light duration 8 hours / day.

[0026] The fifth aspect of the present invention provides:

[0027] The InDel molecular marker primer set is used in the authenticity identification or variety protection of the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols.

[0028] The sixth aspect of the present invention provides:

[0029] Application of the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols, in the preparation of functional foods, health foods, cosmetics, or pharmaceuticals.

[0030] The present invention has the following beneficial effects:

[0031] 1. This invention provides a Ganoderma lucidum strain YW-1 with excellent traits such as stable growth characteristics, high yield, and outstanding content of triterpenes and sterols, and also provides its cultivation method. YW-1 exhibits high yield and high quality when cultivated in factories in Guangzhou, providing a new Ganoderma lucidum cultivar for southern regions. It is suitable for the development of high-value-added Ganoderma lucidum products and has significant value and importance.

[0032] 2. This invention utilizes whole-genome resequencing data from YW-1, Hanzhi, and Hunong 1 to screen for differentially expressed InDel sites and design specific primers to obtain specific molecular markers for YW-1. This method is suitable for the authenticity identification of YW-1, with high accuracy and stable and reliable results.

[0033] 3. This invention is based on PCR amplification reaction and utilizes InDel molecular markers to quickly and accurately identify the authenticity of YW-1. The method is fast, convenient, and low in detection cost, overcoming the shortcomings of existing marker technologies such as RFLP, RAPD, and SSR, and providing a better technical option for the quality control and variety rights protection of YW-1 strain. Attached Figure Description

[0034] Figure 1 The results are electrophoresis results of PCR products of Ganoderma lucidum strain YW-1 with three specific primer pairs in Example 2 of this invention, where M is DL2000 DNA Marker, 1 is YW-1, 2 is Hanzhi, and 3 is Hunong 1.

[0035] Figure 2 It is the upper surface of the mature fruiting bodies obtained by domestication of YW-1 and Hanzhi in Embodiment 3 of the present invention.

[0036] Figure 3 It is the lower surface of the mature fruiting bodies obtained by domestication of YW-1 and Hanzhi in Embodiment 3 of the present invention.

[0037] Figure 4 It is the mature fruiting body flesh of YW-1 and Hanzhi obtained through domestication in Example 3 of this invention. Detailed Implementation

[0038] To enable those skilled in the art to more clearly understand the technical solutions of the present invention, the technical solutions will be clearly and completely described below in conjunction with specific embodiments. The described embodiments are only a part of the embodiments of the present invention, and not all of them. Specific conditions are not specified in the following embodiments; they are generally implemented under conventional conditions or according to the conditions recommended by the manufacturer.

[0039] Reishi mushroom is an important medicinal fungus, belonging to the kingdom Fungi, phylum Basidiomycota, order Polyporales, family Polyporaceae, and genus Ganoderma. It has a long history of use and rich pharmacological activities. In traditional medicine, Reishi is considered a superior medicinal material for "tonifying the middle energizer, replenishing qi, and strengthening the body's foundation." Modern pharmacological studies have shown that Reishi has anti-cancer, antiviral, antioxidant, antibacterial, cardiovascular disease prevention, and anti-epileptic effects. Its main active substances include triterpenes, sterols, and polysaccharides. Reishi was included in the catalogue of medicinal and edible fungi and the catalogue of raw materials for health foods on November 9th and December 18th, 2023, respectively. Its value and demand are increasingly prominent with the deepening of natural product research and the rise of the health industry, making it an important variety for the development of edible and medicinal fungi in my country's health product industry.

[0040] Reishi mushrooms are primarily used medicinally in the form of dried fruiting bodies of Ganoderma lucidum (red and purple varieties). Currently, the main cultivated varieties of Reishi mushrooms in China are mostly from the Korean Ganoderma series. The scarcity of high-quality native varieties has become a key bottleneck restricting the sustainable and high-quality development of my country's Reishi mushroom industry. Simultaneously, with the promotion of factory-style cultivation, higher requirements are placed on the adaptability and purity of the strains, necessitating simple, rapid, and accurate identification techniques to ensure strain specificity, controllable product quality, and industry standardization.

[0041] Currently, molecular markers for Ganoderma lucidum strains mainly include RFLP (Restriction Fragment Length Polymorphism), RAPD (Random Amplified Polymorphic DNA), SCAR (Sequence Characterized Amplified Region), SRAP (Sequence-Related Amplified Polymorphism), and SSR (Simple Sequence Repeat). However, these techniques each have limitations. For example, RFLP is cumbersome to operate, requires radioactive isotopes, and has a long experimental cycle and high cost; RAPD has poor stability and reproducibility, resulting in low reliability and making it difficult to use for precise typing; SCAR and SRAP have low polymorphism, making marker development difficult and limiting their universality; although SSR is widely used, it is prone to problems such as blurred amplified bands, false alleles, and invalid alleles, which can easily lead to errors in genotype determination and data analysis. Overall, existing markers are insufficient to simultaneously meet the industry's demand for rapid and accurate identification of Ganoderma lucidum strains in terms of accuracy, stability, and operability.

[0042] Therefore, selecting and breeding high-quality native Ganoderma lucidum varieties and researching simple, accurate, and efficient new molecular marker methods suitable for their specific identification remain key technical problems that urgently need to be solved.

[0043] Therefore, there is an urgent need to provide a Ganoderma lucidum strain YW-1 that produces high levels of triterpenes and sterols, along with its identification method, cultivation method, molecular marker primer set, and applications, in order to address the current shortage of high-quality native Ganoderma lucidum varieties and the insufficient accuracy and stability of existing molecular marker identification techniques.

[0044] Therefore, the present invention aims to provide a Ganoderma lucidum strain that produces high levels of triterpenes and sterols. The strain is Ganoderma lucidum YW-1, which is deposited at the Guangdong Provincial Center for Microbial Culture Collection with accession number GDMCCNo: 67757.

[0045] The Ganoderma lucidum strain provided in this invention is Ganoderma lucidum YW-1, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on January 28, 2026, with the accession number GDMCC No: 67757. In this application specification, it is also referred to as "Ganoderma lucidum strain YW-1" or "YW-01" (another name). This strain was obtained from wild Ganoderma lucidum fruiting bodies in the Dabie Mountains of Anhui Province through tissue isolation, purification, and ITS sequence molecular identification. Although modern taxonomy has revised the name of cultivated Ganoderma lucidum in China to Ganoderma lingzhi, this invention retains G. lucidum as the official scientific name to comply with the current legal standards of the Pharmacopoeia of the People's Republic of China and industry practice. In terms of biological characteristics and production performance, YW-1 exhibits a mycelial growth rate of 8.08 mm / d, significantly faster than the main control variety, Hanzhi, and comparable resistance to mold. Under factory-scale bag cultivation conditions, it shows uniform mycelial growth and a stable cycle. Mature fruiting bodies are kidney-shaped with short stipes, large cap diameters, numerous annular rings, and good marketability. The bioconversion rate reaches 15.87%, and the dry weight of a single plant is approximately 15.96 g, significantly higher than Hanzhi. Furthermore, its total triterpenoid content reaches 1.42%, ganoderic acid A content is 2.40 mg / g, and ergosterol content is 1.54 mg / g, all significantly superior to the control variety. It is an excellent native Ganoderma lucidum germplasm resource with high yield, high quality, and strong adaptability, which can effectively alleviate the current industrial bottleneck of the scarcity of high-quality native Ganoderma lucidum varieties in China. It is suitable for the standardized and large-scale development of high-value-added edible and medicinal Ganoderma lucidum products.

[0046] This invention provides for the first time a Ganoderma lucidum strain, YW-1, with excellent traits such as stable growth characteristics, high yield, and outstanding content of triterpenes and sterols. YW-1 exhibits high yield and high quality when cultivated in factories in the Guangzhou area, providing a new Ganoderma lucidum cultivar for southern regions. It is suitable for the development of high-value-added Ganoderma lucidum products and has significant value and importance.

[0047] As a preferred embodiment, the ITS sequence of Ganoderma lucidum YW-1 is shown in SEQ ID NO.9 provided below.

[0048] The second aspect of the invention provides:

[0049] An InDel molecular marker primer set for detecting or identifying the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols, wherein the primer set comprises any one or more of the following pairs:

[0050] (1) Primer pair 1 consisting of the forward primer shown in SEQ ID NO. 1 and the reverse primer shown in SEQ ID NO. 2;

[0051] (2) Primer pair 2 consisting of the forward primer shown in SEQ ID NO. 3 and the reverse primer shown in SEQ ID NO. 4;

[0052] (3) Primer pair 3 consisting of the forward primer shown in SEQ ID NO. 5 and the reverse primer shown in SEQ ID NO. 6.

[0053] The nucleotide sequence of SEQ ID NO. 1 is shown below:

[0054] TATATGGAGGGCGTCGGACT;

[0055] The nucleotide sequence of SEQ ID NO. 2 is shown below:

[0056] GGGCTTACGAATTGCGCAAT;

[0057] The nucleotide sequence of SEQ ID NO. 3 is shown below:

[0058] GAGCTGGCAGAAGACATGGT;

[0059] The nucleotide sequence of SEQ ID NO. 4 is shown below:

[0060] GCGGCTCGTCTTAGTAACGT;

[0061] The nucleotide sequence of SEQ ID NO. 5 is shown below:

[0062] TGGCATTCCGACGACAC;

[0063] The nucleotide sequence of SEQ ID NO. 6 is shown below:

[0064] ACGTAACCGAGGATACAACC.

[0065] The three pairs of specific InDel primers (primer pair 1, primer pair 2, and primer pair 3) were used for detection. Compared with the limitations of traditional morphological identification, which is susceptible to environmental influences, poor repeatability of anonymous markers such as RAPD, and insufficient resolution of ITS sequences among closely related species, InDel markers are designed based on insertion / deletion variation sites in the genome and have advantages such as stable polymorphism, clear differences in amplified fragment length, and easy electrophoretic interpretation. The three primer pairs obtained by this invention through whole-genome resequencing and comparative genomics screening target three independent InDel sites unique to strain YW-1. This not only achieves high specificity for identifying this strain and effectively eliminates interference from Ganoderma lucidum and other common Ganoderma lucidum cultivars, but also allows for flexible adaptation to different detection scenarios through the use of single or multiple primer pairs: a single primer pair can be used for rapid initial screening, while multiple pairs can form a multi-validation mechanism that significantly improves the reliability and error tolerance of the identification results. Thus, this provides a precise, efficient, and standardized molecular detection tool for the protection of the variety rights of strain YW-1, the monitoring of germplasm purity, and the traceability of strain quality in industrial production.

[0066] The third aspect of the present invention provides:

[0067] A method for detecting or identifying the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols, includes the following steps:

[0068] DNA was extracted from the sample to be tested, and a PCR amplification system was established using the primer pairs in the InDel molecular marker primer set as PCR primers and amplification was performed. When the amplification result of any one or more of primer pairs 1, 2 or 3 is positive, the sample to be tested is determined to be Ganoderma lucidum strain YW-1.

[0069] The method is based on the principle that InDel markers exhibit insertion or deletion variations at specific locations in the genome. It utilizes specific primers designed for the unique InDel site of YW-1 for PCR amplification. Only when the genome of the sample contains an allele sequence completely identical to YW-1 can the primers effectively bind and amplify the target band of the expected size, thus achieving accurate genotype identification. Compared to traditional identification methods relying on fruiting body morphology, which are susceptible to cultivation environment interference, have long cycles, and are highly subjective, and where conventional ITS barcodes have insufficient resolution among closely related Ganoderma lucidum species, the method provided by this invention offers superior results. The detection method is not limited by the sample development stage or culture conditions, and can complete rapid and accurate identification at the mycelial stage. At the same time, since the three pairs of primers target three independent genetic loci, as long as any one or more pairs are positive, it can be determined that it belongs to the Ganoderma lucidum strain YW-1. This not only ensures the high sensitivity and convenience of single-pair primer detection, but also significantly improves the specificity and error tolerance of the results through multiple pair combination verification, effectively avoiding false positives or false negatives. It provides standardized, repeatable and efficient and reliable molecular technology support for the variety rights protection, seedling purity supervision, production seed quality control and market authenticity identification of strain YW-1.

[0070] In a preferred embodiment, the PCR amplification reaction system comprises, by volume: DNA template 2 μL, forward primer 2 μL, reverse primer 2 μL The concentration of the DNA template was 50 ng / μL, and the concentrations of both the forward and reverse primers were 10 μmol / L.

[0071] In this embodiment, the system selected The This is a PCR premix containing high-fidelity DNA polymerase, optimized buffer, and dNTPs, designed to simplify solution preparation and reduce the risk of contamination. The DNA template dosage is 100 ng per reaction, which, according to preliminary experiments, can reduce the amplification inhibition caused by genomic impurities while ensuring amplification detection sensitivity. Both forward and reverse primers have a final concentration of 0.8 μmol / L, ensuring stable acquisition of specific amplification bands. The 50 μL reaction system exhibits good batch-to-batch reproducibility and is suitable for standardized molecular identification of strain YW-1.

[0072] As a preferred embodiment, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 30 sec, for 32 cycles; and finally 72℃ extension for 10 min.

[0073] In this embodiment, the PCR amplification reaction program first fully opens the double strands of the Ganoderma lucidum genome and activates the hot-start enzyme through pre-denaturation at 94℃ for 5 min. Then, in 32 cycles, it sequentially performs denaturation at 94℃ for 30 sec to maintain the template single-stranded state, annealing at 58℃ for 30 sec to ensure the specific binding of the three InDel primer pairs to the target sequence, extension at 72℃ for 30 sec to accurately synthesize the target short fragment, and finally, a final extension at 72℃ for 10 min to ensure complete end-finishing of all amplification products. The program is optimized for the high GC content of the Ganoderma lucidum genome and the short InDel marker fragments. The 58℃ annealing temperature has been verified through gradient experiments as the optimal specific binding temperature for the three primer pairs of this invention. The 30 sec extension is used to match target InDel fragments with a sequence length less than 1000 bp. 32 cycles yield amplification products sufficient for electrophoresis detection, ultimately resulting in a stable and clear InDel marker amplification fragment with a single band.

[0074] The fourth aspect of the present invention provides:

[0075] A method for cultivating the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols, includes the following steps:

[0076] (1) The mother culture of Ganoderma lucidum YW-1 was inoculated into the original culture medium and cultured to obtain the original culture;

[0077] (2) The original strain is inoculated into the cultivation medium and cultured. After the mycelium fills the bag, the bag is opened and the fruiting bodies are harvested and managed.

[0078] The cultivation method is a two-stage propagation system. By screening the mycelial growth and purity at the original seed stage, degenerate or contaminated individuals can be effectively removed, ensuring that the genetic traits of the subsequent cultivation population are stable and consistent. The bags are opened and the fruiting bodies are harvested only after the mycelium has fully colonized them, ensuring that the nutrients in the substrate are fully converted and utilized, the mycelium reaches physiological maturity and accumulates sufficient biomass, thereby simultaneously improving the uniformity of fruiting bodies, the yield of fruiting bodies, and the content of active ingredients such as polysaccharides and triterpenes. Ultimately, this achieves high-quality, stable, and repeatable large-scale cultivation of strain YW-1.

[0079] In a preferred embodiment, the original culture medium comprises, by mass fraction: 75-80% sorghum, 15-25% millet, and 1-2% calcium carbonate;

[0080] The cultivation medium comprises, by mass fraction: 55-60% sawdust, 30-35% cottonseed hulls, 10-15% wheat bran, and 1-2% calcium carbonate.

[0081] In this embodiment, the original culture medium is prepared from 75-80% sorghum, 15-25% millet, and 1-2% calcium carbonate. Sorghum and millet provide carbon and nitrogen sources for the mycelial growth of strain YW-1, and calcium carbonate is used to adjust the pH value of the culture medium. This original culture medium can prepare the original strain of strain YW-1 with excellent mycelial vitality. The cultivation culture medium is composed of 55-60% sawdust, 30-35% cottonseed hulls, 10-15% wheat bran, and 1-2% calcium carbonate. Sawdust provides the carbon source lignocellulose, while cottonseed hulls and wheat bran supplement the nitrogen source, vitamins, and mineral nutrients to meet the nutritional needs of fruiting body development. Calcium carbonate is also used to adjust the pH value of the culture medium. This cultivation culture medium is suitable for the large-scale cultivation of strain YW-1.

[0082] In a preferred embodiment, the original culture medium comprises, by mass fraction: 78% sorghum, 20% millet, and 2% calcium carbonate;

[0083] The cultivation medium comprises, by mass fraction: 58% sawdust, 31% cottonseed hulls, 10% wheat bran, and 1% calcium carbonate.

[0084] In this embodiment, the primary culture medium preferably uses a ratio of 78% sorghum, 20% millet, and 2% calcium carbonate. This ratio ensures sufficient nutrients while providing good aeration, promoting uniform mycelial growth and resulting in high-quality primary culture with uniform viability. The cultivation medium is preferably a combination of 58% sawdust, 31% cottonseed hulls, 10% wheat bran, and 1% calcium carbonate. This preferred ratio has been experimentally verified to shorten the time for mycelial full coverage of the YW-1 strain, improve the uniformity of fruiting, and result in high content of active ingredients in the fruiting bodies.

[0085] As a preferred embodiment, the cultivation management conditions in step (2) are: temperature 25-28℃, humidity 85-95%, carbon dioxide concentration 800-1500 ppm, light intensity 600-800 lx, and light duration 8 hours / day.

[0086] In this embodiment, 25–28°C is the optimal growth temperature range, which ensures that enzyme activity and metabolic rate are at their peak; a high humidity environment of 85–95% effectively prevents primordia from drying out and promotes cap expansion; a carbon dioxide concentration of 800–1500 ppm avoids excessive concentrations that could lead to deformed mushrooms or inhibit cap opening, while maintaining adequate respiratory metabolism to accumulate active ingredients; a light intensity of 600–800 lx combined with a photoperiod of 8 hours / day induces primordia formation, regulates stipe elongation and pigment synthesis through light signals, ensuring that the fruiting bodies are plump and brightly colored.

[0087] The fifth aspect of the present invention provides:

[0088] The InDel molecular marker primer set is used in the authenticity identification or variety protection of the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols.

[0089] The InDel molecular marker primer set described above can be widely used for the authenticity identification and variety rights protection of Ganoderma lucidum strain YW-1. For example, in the production, circulation and cultivation of strains, by extracting DNA from the sample to be tested and using the primer set for PCR amplification and electrophoresis detection, YW-1 can be quickly and accurately distinguished from other similar strains or mixed strains based on the presence and size of characteristic bands, effectively preventing counterfeit and inferior strains from entering the market. In the process of protecting variety rights, the primer set can be used as legal molecular evidence for judicial or administrative confirmation of rights, providing breeders with objective and repeatable genetic identity certificates.

[0090] The sixth aspect of the present invention provides:

[0091] Application of the Ganoderma lucidum strain YW-1, which produces high levels of triterpenes and sterols, in the preparation of functional foods, health foods, cosmetics, or pharmaceuticals.

[0092] The Ganoderma lucidum strain YW-1 described in this application possesses significant advantages, including stable growth characteristics, high bioconversion rate, and outstanding content of active ingredients. Its fruiting bodies contain significantly higher levels of total triterpenes, ganoderic acid A, and ergosterol than existing main cultivated varieties, providing a high-quality raw material foundation for the development of high-value-added products. Given that Ganoderma lucidum has been included in the National Catalogue of Food and Medicinal Herbs and the Catalogue of Raw Materials for Health Foods, the Ganoderma lucidum strain YW-1 can be widely used in the fields of functional foods and health foods to prepare tablets, capsules, oral liquids, powders, and functional beverages with effects such as enhancing immunity, anti-oxidation, assisting in lowering blood lipids, or protecting the liver. Simultaneously, due to its rich content of triterpenes and sterols, the extract of the Ganoderma lucidum strain YW-1 is also suitable for the cosmetics field as a raw material with anti-aging, anti-inflammatory, soothing, or skin barrier repair effects. In addition, in the pharmaceutical field, this strain can be used as a special raw material strain for extracting high-purity Ganoderma lucidum triterpenes, sterols and other medicinal active ingredients. It can be used for the research and development and production of drugs or traditional Chinese medicine preparations related to anti-tumor, antiviral and cardiovascular disease prevention and treatment, and has broad industrial application prospects and market value.

[0093] Example 1 Isolation and Identification of Strains

[0094] 1. Isolation of strains

[0095] This strain was collected from the Dabie Mountains in Anhui Province, and a pure strain was obtained through tissue isolation. The specific method was as follows: The surface of the Ganoderma lucidum fruiting bodies collected in the wild was wiped with 75% alcohol. Under aseptic conditions, 0.2-0.5 mm × 0.2-0.5 mm internal mycelial tissue was inoculated into a PDA-enriched composite (by mass fraction, including 20% ​​potato, 2% glucose, 2% agar, 0.3% potassium dihydrogen phosphate, 0.15% magnesium sulfate, 0.001% vitamin B1, with the remainder being water). The mixture was placed in a 25℃ incubator. Once the mycelium had completely covered the slant, it was transferred to the culture medium. The original Ganoderma lucidum strain was thus isolated and named YW-1.

[0096] 2. Molecular biological identification of the strain

[0097] Fresh mycelia were ground with liquid nitrogen, and genomic DNA was extracted using the Ezup column-based fungal genomic DNA extraction kit (manufactured by Sangon Biotech (Shanghai) Co., Ltd.). ITS-PCR detection was performed using universal primers for fungal ribosomal intergenic spacers, ITS1 / ITS4 (ITS1: TCCGTAGGTGAACCTGCGG (SEQ ID NO.7), ITS4: TCCTCGCTTATTGATATGC (SEQ ID NO.8), synthesized by Sangon Biotech (Shanghai) Co., Ltd.). Reagents were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0098] The composition of the PCR reaction system (total 50 μL) is shown in Table 1 below.

[0099] The PCR amplification procedure is shown in Table 2 below.

[0100] Table 1 ITS-PCR reaction system

[0101]

[0102] Table 2 ITS-PCR Amplification Program

[0103]

[0104] The PCR products were directly sent for bidirectional sequencing, which was performed by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results are shown in SEQ ID NO. 9.

[0105] SEQ ID NO.9 sequence (ITS sequence of YW-1):

[0106] ATCGAGTTTTGACCGGGTTGTAGCTGGCCTTCTGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGATTGCGAGGCACGCTCTTTACCGGGCTTGCGGAGCATATCTGTGCCTGCGTTTAT CACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCG AATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCGTTATCGGTCGGCTCCTCTTAAATGCA TTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAATGTCTACGCCGTGACCGTGAAGCGTTTGGCGAGCTTCTAACCGTCTTATAAGACAGCTTTATGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCAT

[0107] The sequencing results were compared with the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to complete the strain identification. The results showed that the ITS sequence of strain YW-1 was identified as Ganoderma lingzhi. Previous related studies have found that Ganoderma lingzhi (commonly known as red Ganoderma), which has long been widely distributed and cultivated in China, is not the same species as Ganoderma lucidum distributed in Europe, but is actually a separate new species (Ganoderma lingzhi). YW-1 involved in this patent is a wild Ganoderma strain native to China, but because the current Chinese Pharmacopoeia has not revised the Latin name of Ganoderma lingzhi, this patent temporarily uses Ganoderma lucidum as its official scientific name.

[0108] Ganoderma lucidum strain YW-1 was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on January 28, 2026, with accession number GDMCC No: 67757, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0109] Example 2: Whole-genome resequencing and development of specific molecular markers

[0110] This embodiment uses whole-genome resequencing technology to obtain the genomic sequence information of the main cultivated Ganoderma lucidum strains (Hanzhi and Hu Nong No. 1) in the market. The obtained data is then aligned to the genome of YW-1 to obtain the set of Indel variant sites. Specific primers are designed specifically for PCR amplification to obtain the specific DNA fragment of YW-1, which serves as the molecular marker for YW-1. The specific experiments are as follows:

[0111] 1. Whole genome resequencing and Indel locus acquisition

[0112] Fresh mycelium of YW-1 and other commonly cultivated Ganoderma lucidum strains (Hanzhi and Hu Nong 1) was collected and total DNA was extracted. After passing genomic DNA testing, the DNA was fragmented using ultrasound. The fragmented DNA was then purified, end-repaired, 3′-A-added, and ligated with sequencing adapters. Fragment size selection was performed using agarose gel electrophoresis, followed by PCR amplification to form sequencing libraries. The constructed libraries underwent quality control, and those that passed were sequenced using Illumina.

[0113] The raw sequencing reads obtained from sequencing were quality assessed and filtered to obtain clean reads for subsequent bioinformatics analysis. The main steps of data filtering are as follows: (1) Remove reads with adapters; (2) Filter reads with N content exceeding 10%; (3) Remove reads with more than 50% of bases having a quality value below 10.

[0114] The Clean Reads were aligned with the reference genome using BWA software. Based on the location of the Clean Reads in the reference genome, redundant Reads were filtered using samtools software to ensure the accuracy of the detection results. Then, the HaplotypeCaller (Local Haplotype Assembly) algorithm of GATK software was used to detect and filter InDel variants, obtaining the final set of variant sites. The main filtering parameters for the mutation detection results are as follows: (1) SNPs within 5 bp of InDel and adjacent InDel within 10 bp are filtered out based on the subroutine vcfutils.pl in bcftools; (2) clusterSize2 clusterWindowSize 5, indicating that the number of mutations within a 5 bp window should not exceed 2; (3) QUAL<30, Phred format quality value, those with a quality value lower than 30 are filtered out; (4) QD<2.0, the ratio of the mutation quality value (Quality) to the coverage depth (Depth), those with a QD lower than 2.0 are filtered out; (5) MQ<40, the root mean square of the alignment quality values ​​of all reads aligned to this site, those with an MQ lower than 40 are filtered out; (6) FS>60.0, the value converted from the p-value by Fisher test, those with an FS higher than 60 are filtered out; (7) Other mutation filtering parameters are processed using the default values ​​specified by GATK.

[0115] 2. Design of specific Indel site primers and PCR amplification

[0116] Based on the Indel detection results from whole-genome resequencing, specific Indel sites for YW-1 were screened according to sequencing depth and the number of bases in the insertion / deletion fragments for primer design. We designed and screened three primer pairs, the primer information of which is as follows:

[0117] (1) Primer pair 1: SEQ ID NO. 1: TATATTGGAGGGCGTCGGACT, SEQ ID NO. 2: GGGCTTACGAATTGCGCAAT;

[0118] (2) Primer pair 2: SEQ ID NO. 3: GAGCGTGGCAGAAGACATGGT, SEQ ID NO. 4: GCGGCTCGTCTTAGTAACGT.

[0119] (3) Primer pair 3: SEQ ID NO. 5: TGGCATTCCGACGACAC, SEQ ID NO. 6: ACGTAACCGAGGATACAACC.

[0120] Genomic DNA from YW-1, Hanzhi, and Hu Nong 1 was used as templates for PCR amplification using specific Indel primer pairs. PCR amplification was performed on a BioRad PCR instrument. The composition of the PCR reaction system (total 50 μL) is shown in Table 3 below, and the PCR reaction amplification program is shown in Table 4 below.

[0121] Table 3. PCR reaction system for YW-1 molecular marker

[0122]

[0123] Table 4. PCR amplification program for YW-1 molecular marker

[0124]

[0125] PCR products and DNA markers were spotted onto 1.5-2% (w / v) agarose gels and electrophoresed at 80V for 30 min. The gels were then observed and photographed using a gel imaging system.

[0126] 3. Detection and analysis of PCR amplification products

[0127] The amplification results of primer pair 1 (SEQ ID NO. 1 and SEQ ID NO. 2) are shown in the figure. Figure 1 M stands for DL2000 DNAMarker, 1 stands for YW-1, 2 stands for Hanzhi, and 3 stands for Hu Nong 1. Figure 1 The results showed that only YW-1 exhibited a specific band at 100 bp to 150 bp; neither Hanzhi nor Hunong 1 showed a band. YW-1 could be distinguished from Hanzhi and Hunong 1 using specific primer pair 1 (SEQ ID NO. 1 and SEQ ID NO. 2).

[0128] The amplification results of primer pair 2 (SEQ ID NO. 3 and SEQ ID NO. 4) are shown in the figure. Figure 1 M stands for DL2000 DNAMarker, 1 stands for YW-1, 2 stands for Hanzhi, and 3 stands for Hu Nong 1. Figure 1 The results showed that only YW-1 exhibited a specific band at 150 bp to 200 bp; neither Hanzhi nor Hunong 1 showed a band at this range. YW-1 was distinguished from Hanzhi and Hunong 1 using specific primer pair 2 (SEQ ID NO. 3 and SEQ ID NO. 4).

[0129] The amplification results of primer pair 3 (SEQ ID NO. 5 and SEQ ID NO. 6) are shown in the figure. Figure 1 M stands for DL2000 DNAMarker, 1 stands for YW-1, 2 stands for Hanzhi, and 3 stands for Hu Nong 1. Figure 1 The results showed that only YW-1 exhibited a specific band at 400 bp to 500 bp; Hanzhi and Hunong 1 showed no bands at 400 bp to 500 bp, but exhibited polymorphic bands above 500 bp. YW-1 could be distinguished from Hanzhi and Hunong 1 using specific primer pair 3 (SEQ ID NO. 5 and SEQ ID NO. 6).

[0130] In summary, the specific primer pairs 1 (SEQ ID NO. 1 and SEQ ID NO. 2), 2 (SEQ ID NO. 3 and SEQ ID NO. 4), and 3 (SEQ ID NO. 5 and SEQ ID NO. 6) of this invention can all be used to distinguish YW-1 from other Ganoderma lucidum strains.

[0131] Based on the above results, the present invention provides a detection or identification product for YW-1, which can quickly and accurately complete the authenticity identification of YW-1 and provide a technical basis for quality control in its production.

[0132] Example 3 Cultivation method of Ganoderma lucidum strain YW-1

[0133] I. Experimental Methods

[0134] 1. Mother Seed Production

[0135] The formula for the mother culture medium is: enriched with comprehensive PDA (by mass fraction, including 20% ​​potato + 2% glucose + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + 0.001% vitamin B1, with the balance being water). The preparation method is as follows: Weigh 200 g of peeled potatoes, cut them into small pieces, add water and boil (maintain for 20-30 min), filter through 6 layers of gauze to discard the residue, add the filtrate to 1000 mL, add 20 g of glucose, 20 g of agar, 3 g of potassium dihydrogen phosphate, 1.5 g of magnesium sulfate, and 0.01 g of vitamin B1 to the filtrate, stir well, and heat over low heat until the agar is completely dissolved; after slightly cooling, dispense into test tubes, stopper and seal, sterilize at 121℃ under high temperature and high pressure for 20 min, and then place the test tubes on a slant. After cooling, the culture was aseptically inoculated with strain YW-1 and placed in a 25℃ incubator for constant temperature dark incubation. The time for the mycelium to fully grow on the slant was between 10 and 12 days.

[0136] 2. Measurement of mycelial growth rate

[0137] PDA medium that has been sterilized at high temperature was poured into sterile plates. After cooling, 8 mm × 8 mm Ganoderma lucidum mother culture blocks were inoculated under aseptic conditions and placed in a 25℃ incubator for constant temperature dark incubation. Each experimental group was set up with 6 replicates and cultured for 7-8 days. The mycelial growth rate, growth vigor and color were observed and recorded every day to compare the growth rate of different Ganoderma lucidum varieties.

[0138] 3. Measurement of mycelial resistance to fungal diseases

[0139] PDA medium, sterilized at high temperature, was poured into sterile plates. After cooling, an 8 mm × 8 mm Ganoderma lucidum mother culture block was inoculated onto one side of the plate under aseptic conditions and incubated in the dark at 25℃ for 3–4 days. Then, an 8 mm × 8 mm pathogenic fungal block (Trichoderma harzianum, Trichoderma hookeriana, and Aspergillus flavus) was inoculated onto the other side of the plate under aseptic conditions and incubated in the dark at 25℃ for 4 days. After co-culturing the Ganoderma lucidum strains and pathogenic fungal strains for 4 days, the growth diameters of the Ganoderma lucidum colonies and pathogenic fungal colonies were observed and recorded. By comparing the growth diameters of the Ganoderma lucidum colonies and pathogenic fungal colonies, the resistance of each Ganoderma lucidum variety to fungal diseases was evaluated.

[0140] 4. Original Seed Production

[0141] The original culture medium formula, by mass fraction, includes 78% sorghum, 20% millet, and 2% calcium carbonate. The preparation method is as follows: Weigh the required proportions of sorghum and millet, wash and soak overnight; boil the soaked sorghum and millet until no white core remains, rinse with clean water, spread out to dry, add calcium carbonate according to the proportion, stir well, and bag (approximately 40 g of wet material per bag); sterilize at 126℃ under high pressure for 90 minutes. After cooling, aseptically inoculate with the production mother culture and place in a 25℃ incubator for constant temperature dark incubation. The time for mycelium to fully colonize the medium is between 10 and 12 days.

[0142] 5. Making cultivation bags

[0143] The cultivation medium formula, by mass fraction, comprises 58% sawdust, 31% cottonseed hulls, 10% wheat bran, and 1% calcium carbonate. The preparation method is as follows: Weigh the required proportions of sawdust and cottonseed hulls, soak them in water overnight, then add wheat bran and calcium carbonate in the specified proportions. Add water until the moisture content is approximately 65%, and pack the mixture into 17 cm × 35 cm heat-resistant polypropylene plastic bags, each containing 340–400 g of dry material. Sterilize at 126℃ under high-pressure autoclave for 120 min. Remove the bags and place them in an inoculation room. After cooling, inoculate with the primary culture under aseptic conditions. The time for mycelium to fully colonize the medium is between 21 and 25 days. Each experimental group should have at least 80 replicates.

[0144] 6. Cultivation and Management

[0145] After inoculation of the cultivation bags, maintain a temperature of 24-25℃, humidity of 60-70%, and carbon dioxide concentration of 2000-3000 ppm in the mycelial culture room. Once the mycelium has fully colonized the bags, open them and release the fruiting bodies, then transfer them to the cultivation room. During the fruiting stage, maintain a temperature of 25-28℃, humidity of 85-95%, carbon dioxide concentration of 800-1500 ppm, light intensity of 600-800 lx, and light duration of 8 hours / day in the cultivation room. The fruiting bodies are considered mature when the cap color becomes uniform.

[0146] 7. Comparison of main agronomic traits of fruiting bodies

[0147] During cultivation, detailed records were kept of the time required for different growth stages, fruiting body morphology, average yield, bioconversion rate, and other major agronomic traits of each Ganoderma lucidum variety.

[0148] 8. Analysis of active ingredients in fruiting bodies

[0149] After harvesting, the fruiting bodies of various Ganoderma lucidum varieties were dried, pulverized, and the total triterpenoid content of Ganoderma lucidum was tested according to the 2020 edition of the Chinese Pharmacopoeia.

[0150] The content of ganoderic acid A in Ganoderma lucidum was determined by HPLC. Chromatographic column: Agilent Eclipse Plus C18 column (250 mm * 4.6 mm, 5 μm); mobile phase: 0.03% phosphoric acid aqueous solution (phase A) and acetonitrile (phase B); flow rate: 1.0 mL / min; column temperature: 30℃; detection wavelength: 254 nm; injection volume: 10 μL; elution was performed according to the following gradient.

[0151] Table 5 Gradient elution method for HPLC detection of ganoderic acid A

[0152]

[0153] The ergosterol content in Ganoderma lucidum was determined by HPLC. Chromatographic column: Agilent Eclipse Plus C18 column (250 mm * 4.6 mm, 5 μm); mobile phase: 100% methanol; flow rate: 1.0 mL / min; column temperature: 30℃; detection wavelength: 282 nm; injection volume: 20 μL; detection time: 17 min.

[0154] II. Experimental Results

[0155] 1. Mycelial growth

[0156] Table 6 shows a comparison of mycelial growth between Ganoderma lucidum strain YW-1 and the main cultivated Ganoderma lucidum variety Hanzhi. The mycelial growth rate of YW-1 on the plate was 8.08 mm / d, which was significantly faster than that of Hanzhi, and the growth was comparable to that of Hanzhi.

[0157] Table 6. Mycelial growth rate and vigor

[0158]

[0159] Note: Mycelial growth is indicated by "+", with +, ++, and +++ indicating that mycelial growth is gradually increasing.

[0160] 2. Mycelial resistance to fungal diseases

[0161] The differences in disease resistance between Ganoderma lucidum strains and pathogens were assessed by comparing the diameter of Ganoderma lucidum colonies after inoculation with that of pathogens through plate confrontation culture. Table 7 shows a comparison of the resistance to fungal diseases between YW-1 and the mainstream cultivated Ganoderma lucidum variety, Hanzhi. In the presence of pathogens Trichoderma harzianum, Trichoderma hookeriana, and Aspergillus flavus, there was no significant difference in the growth ratio of mycelia to pathogen mycelia between YW-1 and Hanzhi, indicating comparable resistance to fungal diseases.

[0162] Table 7. Growth ratio of Ganoderma lucidum mycelium to pathogenic fungal mycelium (%)

[0163]

[0164] 3. Main agronomic traits of Ganoderma lucidum strain YW-1 after domestication

[0165] Table 8 shows a comparison of the main agronomic traits of YW-1 and the main cultivated Ganoderma lucidum variety, Hanzhi. During cultivation, YW-1 took approximately 24 days for mycelium to fill the bag, approximately 4 days for primordia formation, approximately 8 days for cap opening, and approximately 28 days from cap opening to fruiting body maturity. Mature fruiting bodies have short, cylindrical stipes, approximately 2.56 cm long; the cap diameter is approximately 13.05 cm, kidney-shaped, with a reddish-brown upper surface and a light yellow lower surface, without obvious radial longitudinal ridges, numerous annular rings, and rounded edges; the flesh is brown. The fresh weight of the fruiting bodies is approximately 55.12 g, the dry weight is approximately 15.96 g, and the bioconversion rate is approximately 15.87%, significantly higher than Hanzhi. The upper and lower surfaces and flesh of mature fruiting bodies of YW-1 and Hanzhi are shown in the table. Figures 2-4 As shown.

[0166] Table 8. Major agronomic traits

[0167]

[0168] 4. Analysis of active ingredients in Ganoderma lucidum strain YW-1

[0169] The active ingredient contents of YW-1 and the main cultivated Ganoderma lucidum variety Hanzhi are shown in Table 9. The total triterpenoid content of YW-1 is 1.41%, which is significantly higher than that of Hanzhi; the content of ganoderic acid A in YW-1 is 2.40 mg / g, which is significantly higher than that of Hanzhi; and the content of ergosterol in YW-1 is 1.54 mg / g, which is significantly higher than that of Hanzhi.

[0170] Table 9 Results of Active Ingredient Content Determination

[0171]

[0172] In summary, through comparisons of mycelial growth and resistance to mold, the growth advantages of YW-1 were preliminarily assessed. Its growth rate was significantly higher than that of the mainstream Ganoderma lucidum variety, Hanzhi, and its resistance to mold was comparable to Hanzhi. Subsequently, YW-1 was acclimatized using a bag cultivation method. Further evaluation of YW-1's production performance was conducted by observing the mycelial growth rate and fruiting body morphology during cultivation, as well as assessing the yield and active ingredients of the fruiting bodies. The results showed that its mycelial growth rate during bag cultivation was comparable to Hanzhi, with good uniformity; the bioconversion rate of mature fruiting bodies and the content of active ingredients such as total triterpenes, ganoderic acid A, and ergosterol were significantly higher than those of Hanzhi.

[0173] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A Ganoderma lucidum strain that produces high levels of triterpenes and sterols, characterized in that, The Ganoderma lucidum strain mentioned is Ganoderma lucidum YW-1, which is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 67757.

2. The Ganoderma lucidum strain with high production of triterpenoids and sterols according to claim 1, characterized in that, The ITS sequence of Ganoderma lucidum YW-1 is shown in SEQ ID NO.

9.

3. An InDel molecular marker primer set for detecting or identifying the Ganoderma lucidum strain with high triterpenoid and sterol production as described in claim 1 or 2, characterized in that, The primer set includes any one or more of the following pairs: (1) Primer pair 1 consisting of the forward primer shown in SEQ ID NO. 1 and the reverse primer shown in SEQ ID NO. 2; (2) Primer pair 2 consisting of the forward primer shown in SEQ ID NO. 3 and the reverse primer shown in SEQ ID NO. 4; (3) Primer pair 3 consisting of the forward primer shown in SEQ ID NO. 5 and the reverse primer shown in SEQ ID NO.

6.

4. A method for detecting or identifying the Ganoderma lucidum strain that produces high levels of triterpenes and sterols as described in claim 1 or 2, characterized in that, Includes the following steps: DNA is extracted from the sample to be tested. A PCR amplification system is established using the primer pairs in the InDel molecular marker primer set described in claim 2 as PCR primers, and amplification is performed. When the amplification result of any one or more pairs of primer pairs 1, 2, or 3 is positive, the sample to be tested is determined to be Ganoderma lucidum strain YW-1.

5. The method according to claim 4, characterized in that, The PCR amplification reaction system comprises, by volume: DNA template 2 μL, forward primer 2 μL, reverse primer 2 μL The DNA template concentration was 50 ng / μL, and the concentrations of both the forward and reverse primers were 10 μmol / L. The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 30 sec, for 32 cycles; and finally 72℃ extension for 10 min.

6. A method for cultivating a Ganoderma lucidum strain that produces high levels of triterpenes and sterols as described in claim 1 or 2, characterized in that, Includes the following steps: (1) The mother culture of Ganoderma lucidum YW-1 was inoculated into the original culture medium and cultured to obtain the original culture; (2) The original strain is inoculated into the cultivation medium and cultured. After the mycelium fills the bag, the bag is opened and the fruiting bodies are harvested and managed.

7. The cultivation method according to claim 6, characterized in that, The original culture medium comprises, by mass fraction: 75-80% sorghum, 15-25% millet, and 1-2% calcium carbonate; The cultivation medium comprises, by mass fraction: 55-60% sawdust, 30-35% cottonseed hulls, 10-15% wheat bran, and 1-2% calcium carbonate.

8. The cultivation method according to claim 7, characterized in that, The original culture medium comprises, by mass fraction: 78% sorghum, 20% millet and 2% calcium carbonate; The cultivation medium comprises, by mass fraction: 58% sawdust, 31% cottonseed hulls, 10% wheat bran, and 1% calcium carbonate.

9. The cultivation method according to claim 6, characterized in that, The cultivation and management conditions in step (2) are: temperature 25-28℃, humidity 85-95%, carbon dioxide concentration 800-1500 ppm, light intensity 600-800 lx, and light duration 8 hours / day.

10. The use of the InDel molecular marker primer set according to claim 3 in the authenticity identification or variety rights protection of Ganoderma lucidum strain YW-1 according to claim 1 or 2.

Images