Cinnamomum camphora ganoderma strain L7402 and cultivation method thereof

Abstract

The present application relates to a camphor ganoderma strain L7402 and a cultivation method thereof, and belongs to the technical field of biotechnology.The classification name of the camphor ganoderma strain L7402 is Ganoderma camphorae, which has been preserved in the Guangdong Microbial Culture Collection Center on August 11, 2026, and the preservation number is GDMCC No: 68815.The camphor ganoderma fruiting body cultivated by the method has a unique morphology, there is a clear swelling bulge at the connection between the cap and the stem, and the camphor ganoderma is thick and has a lacquer-like luster, is rich in high-concentration polysaccharides and specific triterpenoids, and has outstanding advantages in in-vitro antioxidant, immunomodulatory or anti-inflammatory biological activities, is significantly superior to ordinary commercially available conventional ganoderma, and has extremely high medicinal, functional health food and great health deep processing development and utilization value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a Ganoderma lucidum strain L7402 and its cultivation method. Background Technology

[0002] Reishi mushroom has a history of over two thousand years in traditional Chinese medicine, and is hailed as the "immortal herb," ​​officially included in the Pharmacopoeia of the People's Republic of China. It contains abundant bioactive components, mainly triterpenoids and polysaccharides, which possess significant immunomodulatory, anti-tumor, sedative, sleep-promoting, and anti-inflammatory activities.

[0003] Karsten formally established the genus *Ganoderma* (P. Karst.) in 1881, based on morphological characteristics. Donk established the family Ganodermataceae (Donk) in 1948, its core identifying feature being the presence of biwalled basidiospores with intercellular struts. At that time, this family comprised only two genera: *Ganoderma*, with a lacquer-like sheen on the cap and truncate basidiospore apex; and *Amauroderma* Murrill, with spherical to elliptical basidiospores lacking a truncate apex. Building upon this basic classification, Steyaert examined specimens from herbaria worldwide and integrated distribution data from Asia, Africa, and the Americas, undertaking a comprehensive revision of the classification of *Ganoderma* and its closely related groups. He discovered significant anatomical differences among species traditionally classified under the Ganoderma genus, and based on this, he established three new genera: Humphreya Steyaert, Haddowia Steyaert, and Magoderma Steyaert.

[0004] Despite these advances, taxonomic ambiguities within the Ganodermataceae family persist due to historical nomenclature inconsistencies and insufficient study of type specimens. To address these issues and establish a more authoritative classification system, Moncalvo and Ryvarden proposed a framework centered on reliable and stable morphological characteristics. The cornerstone of this framework is the unique double-walled structure of the basidiospores: a pigmented inner wall adorned with columnar or ridged patterns, and a smooth, colorless, and transparent outer wall—a feature established as the defining characteristic of the family. Furthermore, the structure of the cap cortex and the hyphal system are also used as other important morphological features. Based on this framework, the Ganodermataceae family includes fourteen accepted genera: *Amauroderma*, *Amaurodermellus* Costa-Rezende (Drechsler-Santos & Góes-Neto), *Cristataspora* Robledo & Costa-Rezende, *Foraminispora* Robledo (Costa-Rezende & Drechsler-Santos), *Furtadomyces* Leonardo-Silva (Cotrim & Xavier-Santos), *Ganoderma*, *Haddowia*, *Humphreya*, *Magoderma*, *Neoganoderma* BK Cui & YF Sun, *Sanguinoderma* YF Sun (DH Costa & BK Cui), and *Sinoganoderma* BK Cui (JH Xing & YF...). The genera *Sun*, *Tomophagus* Murrill, and *Trachydermella* BK Cui & YF Sun.

[0005] Among these genera, *Ganoderma* is characterized by stalked or sessile basidiospores with glossy or non-glossy caps; a trisomic hyphal system consisting of reproductive hyphae, skeletal hyphae, and twining hyphae; and elliptical, truncate-apex, brown, non-starchy basidiospores. Historically, the classification of *Ganoderma* was based on morphological characteristics, dividing the genus into two main groups: the glossy group represented by *Ganoderma lucidum (Curtis) P. Karst. complex*, and the non-glossy group represented by *Ganoderma applanatum (Pers.) Pat. complex*. These two divisions correspond to the subgenus *Ganoderma* and the subgenus *Elfvingia P. Karst.*, respectively. As of now, there are 501 records in Index Fungorum and 573 records in MycoBank. However, a significant number of these records were later reclassified as synonyms, a taxonomic issue particularly prominent in the genera *Ganoderma* and *Amauroderma*. To resolve these taxonomic ambiguities, reliable molecular and phylogenetic analyses have confirmed the existence of 191 valid *Ganoderma* species. Currently, over 40 *Ganoderma* species are known in China.

[0006] Ganoderma is a genus of fungi that thrives in mesophilic and thermophilic environments. It is widely distributed across all continents, with wild populations found in tropical and temperate regions of Africa, the Americas, Asia, Europe, and Oceania. China's suitable climate, diverse vegetation, rich species, distinct vertical climate differentiation, and diverse habitats provide excellent conditions for the growth of wild Ganoderma, resulting in abundant wild Ganoderma resources. Yunnan Province, located in southwestern inland China, combines low latitude with high altitude, boasting extremely high biodiversity and particularly rich wild Ganoderma resources. Based on this, researchers have conducted in-depth investigations into the diversity of the Ganoderma genus in Yunnan, and have successively reported several new species, including Ganoderma alpinum BK Cui, JH Xing & YF Sun, G. chuxiongense BK Cui, JH Xing & YF Sun, G. dianzhongense J. He, Hong Y. Su & Shu H. Li, G. puerense BK Cui, JH Xing & YF Sun, G. subangustisporum BK Cui, JH Xing & YF Sun, and G. weixiense Karun. & JC Xu.

[0007] However, in the field of Ganoderma lucidum germplasm resource development, utilization, and artificial cultivation technology, the existing technologies still have the following significant shortcomings: (1) The main cultivated varieties are singular and severely degenerated, lacking breakthrough and unique new germplasm resources: Currently, the number of Ganoderma species cultivated on a large scale in my country is extremely limited, with the vast majority concentrated on a few traditional species such as Ganoderma lucidum and Ganoderma sinense. Due to long-term asexual reproduction and continuous cropping, existing main cultivated strains generally suffer from problems such as species degeneration, narrow genetic background, weakened resistance to adverse conditions and contaminating fungi, and declining mycelial viability. Although Yunnan and other southwestern regions possess abundant wild Ganoderma resources, the vast majority of wild-specific new species remain undeveloped and require modern taxonomic identification, purification and rejuvenation, and systematic domestication to discover new species strains with excellent agronomic traits and high medicinal value.

[0008] (2) The content of active substances in traditional varieties is approaching a bottleneck, limiting deep processing and functional development: With the increasing demands for the efficacy and quality of Ganoderma lucidum in the modern pharmaceutical and health industries, traditional cultivated Ganoderma lucidum varieties have struggled to achieve significant breakthroughs in the accumulation of core active ingredients such as polysaccharides and total triterpenes. Furthermore, they lack unique secondary metabolite characteristics and flavor qualities, making it difficult to meet the needs of high-value-added drug development, specialty health products, and in-depth development of functional cosmetics. Discovering and identifying new Ganoderma species rich in highly active medicinal components and possessing specific metabolites is crucial to breaking through the current homogeneous competition in the Ganoderma lucidum industry.

[0009] (3) It is difficult to domesticate wild new species to produce fruiting products, and there is a lack of suitable special high-yield cultivation techniques: Wild Ganoderma lucidum species often possess unique ecological adaptability and physiological nutritional preferences. When directly using conventional Ganoderma lucidum substrate formulas (such as standard broadleaf tree sawdust or standard temperature and light conditions) for substrate cultivation, technical bottlenecks commonly arise, including slow mycelial germination, sparse growth, difficulty in primordia differentiation, uneven or even deformed fruiting bodies, and extremely low bioconversion rates. Currently, there is no systematic and clearly defined large-scale artificial cultivation method for the wild Ganoderma lucidum species, specifying its nutritional requirements, mycelial biological characteristics, and dedicated fruiting management parameters. This severely hinders the industrial-scale artificial cultivation and application of this unique new species.

[0010] Therefore, isolating and screening a new strain of Ganoderma lucidum with an independent genetic background and high active ingredients, and overcoming the challenges of developing a dedicated culture medium formula and efficient artificial cultivation method, is of great practical significance and industrial value for enriching the diversity of Ganoderma lucidum varieties in my country, improving the medicinal value of Ganoderma lucidum, and promoting the high-quality development of the specialty edible fungi industry. Summary of the Invention

[0011] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Ganoderma lucidum strain L7402 and its cultivation method.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A *Ganoderma camphorae* strain L7402, classified as *Ganoderma camphorae*, was deposited on August 11, 2026, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 68815).

[0013] This invention also provides a cultivation method for the above-mentioned Ganoderma lucidum strain L7402, comprising the following steps: Step (1), propagation of mother culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L7402 were inoculated onto the mother culture PDA medium and placed in an incubator at 24℃-26℃ for 7-10 days. The aforementioned mother culture PDA medium comprises the following raw materials by weight: 15-17 parts agar, 19-21 parts glucose, 4.5-5.5 parts potato starch, 1.9-2.1 parts yeast powder, 1.9-2.1 parts ammonium sulfate, 0.19-0.21 parts potassium dihydrogen phosphate, 0.19-0.21 parts calcium chloride, and 990-1010 parts distilled water; Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a culture room at 22℃-25℃ and culture it in the dark for 25-30 days to obtain the original seed; The original culture medium in the original culture bottle comprises the following raw materials by weight: 19-21 parts hardwood sawdust, 68-72 parts buckwheat grains, 7.5-8.5 parts wheat bran, 0.9-1.1 parts sucrose, and 0.9-1.1 parts gypsum powder; pH value 7-8, moisture content 55-60%; Step (3), preparation of spawn: Inoculate the original spawn prepared in step (2) into the spawn container and place it in a constant temperature dark culture room at 22℃-25℃ for 35-40 days. After the mycelium has fully grown in the spawn container, the spawn is obtained. The culture medium in the cultivation container comprises the following raw materials by weight: 76-78 parts sawdust, 14.5-15.5 parts wheat bran, 4.8-5.2 parts soybean meal, 0.9-1.1 parts gypsum, 0.9-1.1 parts white sugar, and 0.9-1.1 parts lime; pH value 7-8, moisture content 55-60%; Step (4), inoculation of cultivation bags: transfer the spawn into the cultivation bags and place them in a culture room at 22℃-25℃ and 60%-70% relative humidity for 40-45 days until the mycelium has fully grown in the bags; The cultivation medium in the cultivation bags comprises the following raw materials by weight: 76-80 parts broadleaf tree sawdust, 19-21 parts wheat bran, 0.9-1.1 parts gypsum powder, and 0.9-1.1 parts lime powder; pH value 8-9, moisture content 55-60%; Step (5), soil covering cultivation: After the mycelium in the cultivation bag from step (4) has fully grown, transport it to the cultivation base and continue to ripen under shade for 7-10 days. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. When the white growth ring on the edge of the cap disappears, harvest the fruiting bodies.

[0014] Furthermore, in step (4), the specifications of the cultivation bag are 17cm×35cm×0.05mm.

[0015] Furthermore, in step (5), the cultivation base is a greenhouse (temperature controllable, relatively sealed), a shade shed (shading rate of 70%-80%, high ventilation) or under the forest.

[0016] Furthermore, in step (5), the spacing between cultivation bags should be 10-15cm when placing the bags, and the soil covering thickness should be 3-5cm.

[0017] Furthermore, in step (5), after covering with soil, the plants can be harvested after 68-72 days.

[0018] Furthermore, in step (5), the fruiting management includes the bud induction stage, the fruiting body growth stage, and the fruiting body maturation stage; During the budding stage, the temperature should be controlled at 22℃-26℃; the relative humidity of the air should be 85%-90%; and the light intensity should be 1000-2000 lx. During the fruiting body growth stage, the temperature should be 22℃-26℃, the relative humidity of the air should be 80%-95%, and the light intensity should be 1000-2000lx. During the fruiting body maturation stage, the temperature should be 24℃-28℃, the relative humidity should be 75%-85%, and the light intensity should be 1000-2000 lx.

[0019] This invention, based on a wild Ganoderma lucidum specimen collected from Yunnan Province, China, and its isolated and purified strain L7402, confirms and publishes a new species of Ganoderma—*Ganoderma camphorata*. Combining macroscopic and microscopic morphological evidence, and multi-site phylogenetic analysis based on internal transcribed spacer (ITS), large ribosomal subunit gene (nrLSU), translation elongation factor 1-α (TEF1-α), and RNA polymerase II second large subunit (RPB2) sequence data, confirms that the specimen represented by this strain represents a previously undescribed independent taxa within the Ganoderma genus. This invention provides a systematic description of this strain. Phylogenetic analysis results show that this strain forms an independent clade with known species of the Ganoderma genus, with extremely high clade support (maximum likelihood bootstrapping support 99% / Bayesian posterior probability 0.99). The core morphological characteristics of the fruiting bodies of *Ganoderma lucidum* strain L7402 are as follows: Basidiocarps are sessile and fan-shaped; the cap has a lacquer-like luster, ranging in color from brown to reddish-brown, with concentric rings and radial wrinkles on the surface; the flesh is corky, with black or melanin-like lines distributed inside; the cap cortex is a shell-like hymenium type. Basidiocarps are oval to nearly spherical, colorless, thin-walled, with 2-4 pedicels, measuring 17-21 × 11-16 µm; young basidia are similar in morphology to basidia, also colorless and thin-walled, measuring 11-20 × 7-15 µm; basidiospores are oval to obovate, with a truncate apex, measuring 9.1-12.4 × 6.5-8.8 μm.

[0020] This invention was supported by the following projects: the "Xingdian Elite Talent Program" Industrial Innovation Talent Cultivation Project of Li Shuhong, Research and Application of Key Technologies for the Cultivation of Characteristic Edible and Medicinal Fungi under Forests (JTST-HBS-KYXM-2026-01), and the Joint Agricultural Project (No.: 202301BD070001-021).

[0021] Compared with the prior art, the beneficial effects of this invention are as follows: (1) This invention breaks through the bottleneck of homogenization and degeneration of traditional cultivated Ganoderma lucidum germplasm, and discovers and establishes a new species of Ganoderma lucidum with independent intellectual property rights: The invention isolated and purified a new species of Ganoderma lucidum strain L7402 from wild resources in Yunnan. Through morphological characteristics and multi-site molecular phylogenetic analysis of four genes (ITS, nrLSU, TEF1-α, and RPB2), it was confirmed that it belongs to an independent new taxonomic group of the Ganoderma genus that has not been reported before. This strain has an independent genetic background, vigorous mycelial activity and is not prone to degeneration, which greatly enriches the germplasm resource bank of rare wild Ganoderma lucidum in my country and provides a groundbreaking parental material and core strategic germplasm for the breeding of superior Ganoderma lucidum varieties; (2) Overcoming the shortcomings of difficult fruiting and low conversion rate of wild new species domestication, a high-efficiency large-scale artificial cultivation technology system for Ganoderma lucidum camphora has been established: In view of the physiological and nutritional needs of wild Ganoderma lucidum camphora mycelium and the primordium differentiation characteristics, this invention optimizes and screens a special culture medium formula and management procedures for temperature, humidity, light, ventilation and soil covering for fruiting, which significantly improves the mycelial growth rate and primordium induction rate, effectively solves the technical bottlenecks of slow mycelial growth, uneven fruiting, high deformity rate and low biological conversion rate when wild Ganoderma lucidum is directly domesticated, and realizes high uniformity fruiting and high and stable yield of Ganoderma lucidum camphora, providing standardized process guarantee for the industrial-scale cultivation and demonstration of this new species; (3) It endows the product with unique biological activity and secondary metabolite characteristics, and expands the medicinal and deep processing application value of high-quality Ganoderma lucidum products: The Ganoderma lucidum fruiting bodies obtained by the method of this invention are not only regular in shape, thick in flesh, and full of lacquer-like luster, but also rich in high concentrations of polysaccharides and specific triterpenoids. They show outstanding advantages in in vitro antioxidant, immunomodulatory or anti-inflammatory biological activities, which are significantly better than ordinary commercially available Ganoderma lucidum. They have extremely high medicinal, functional health food and health deep processing development and utilization value. Attached Figure Description

[0022] Figure 1 The phylogenetic tree is constructed; nodes are labeled in "ML / PP" format, showing only values ​​with a maximum likelihood bootstrap support ≥70% and a Bayesian posterior probability (PP) ≥0.90. Newly described species are indicated in bold black font. Figure 2 Morphological images of Ganoderma lucidum strain L7402 are shown below. A represents its wild growing habitat and location on living camphor trees; B represents wild fruiting bodies growing on the trunks of living camphor trees; C represents the upper surface of the cap of the fruiting body; D represents the dorsal side of the cap; E represents a longitudinal section of the cap (showing the flesh and tubes); F represents a magnified view of a portion of the pore surface; G represents cap cortical cells; HI represents pure culture hyphae; J represents flesh skeleton hyphae; K represents flesh-connecting hyphae; L represents tube reproductive hyphae; M represents basidia; N represents pseudo-basidiospores; O represents clusters of basidiospores under an optical microscope; P and Q represent single basidiospores under an optical microscope; R represents the ultrastructure of basidiospores under a scanning electron microscope. Scale bars: 5 cm for CD; 1 cm for E and HI; 1 mm for F; 20 μm for O; 10 μm for G and JN; 5 μm for PR. Figure 3 Figures showing mycelial growth rates under different carbon source conditions; Figure 4 Graphs showing mycelial growth rates under different nitrogen source conditions; Figure 5 Graphs showing mycelial growth rates under different inorganic salt conditions; Figure 6 Graphs showing mycelial growth rates under different temperature conditions; Figure 7 Graphs showing mycelial growth rates under different pH conditions; Figure 8 Images of Ganoderma lucidum strain L7402 at various growth stages are shown below; A is the primordium stage, B is the stipe elongation stage, C is the cap differentiation stage, and D is the maturity stage. Figure 9 Photo of mushroom cultivation of Ganoderma lucidum strain L7402; Figure 10 Photo of mushroom cultivation of Ganoderma lucidum strain L7402.

[0023] This invention relates to the Ganoderma camphorae strain L7402, which is classified as Ganoderma camphorae. It was deposited on August 11, 2026, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No. 68815), located at the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. Detailed Implementation

[0024] The present invention will now be described in further detail with reference to the embodiments.

[0025] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0026] Example 1

[0027] A *Ganoderma camphorae* strain L7402, classified as *Ganoderma camphorae*, was deposited on August 11, 2026, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 68815).

[0028] The cultivation method of the *Ganoderma lucidum* strain L7402 includes the following steps: Step (1), propagation of mother culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L7402 were inoculated onto the mother culture PDA medium and placed in a 25℃ incubator for 8 days. The mother culture PDA medium comprises the following raw materials by weight: 16 parts agar, 20 parts glucose, 5 parts potato starch, 2 parts yeast powder, 2 parts ammonium sulfate, 0.2 parts potassium dihydrogen phosphate, 0.2 parts calcium chloride, and 1000 parts distilled water. Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 23℃ culture room for constant temperature dark culture for 28 days to obtain the original seed; The original culture medium in the original culture bottle comprises the following raw materials by weight: 20 parts hardwood sawdust, 70 parts buckwheat grains, 8 parts wheat bran, 1 part sucrose, and 1 part gypsum powder; pH value 7.5, moisture content 58%; Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn container and placed in a 23℃ incubation room for constant temperature and dark culture for 38 days. After the mycelium has fully grown in the spawn container, the spawn is obtained. The culture medium in the cultivation container comprises the following raw materials by weight: 77 parts sawdust, 15 parts wheat bran, 5 parts soybean meal, 1 part gypsum, 1 part white sugar, and 1 part lime; pH value 7.5, moisture content 57%; Step (4), inoculation of cultivation bags: transfer the spawn into the cultivation bags and place them in a culture room at 23°C and 65% relative humidity for 42 days until the mycelium has fully colonized the bags; The cultivation medium in the cultivation bag comprises the following raw materials by weight: 78 parts broadleaf tree sawdust, 20 parts wheat bran, 1 part gypsum powder, and 1 part lime powder; pH value 8.5, moisture content 56%; Step (5), soil covering cultivation: After the mycelium in the cultivation bag from step (4) has fully grown, transport it to the cultivation base and continue to ripen for 8 days under shaded conditions. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. When the white growth ring on the edge of the cap disappears, harvest the fruiting bodies.

[0029] Example 2

[0030] A *Ganoderma camphorae* strain L7402, classified as *Ganoderma camphorae*, was deposited on August 11, 2026, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 68815).

[0031] The cultivation method of the *Ganoderma lucidum* strain L7402 includes the following steps: Step (1), propagation of mother culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L7402 were inoculated onto the mother culture PDA medium and placed in a 24℃ incubator for 7 days; The mother culture PDA medium comprises the following raw materials by weight: 15 parts agar, 19 parts glucose, 4.5 parts potato starch, 1.9 parts yeast powder, 1.9 parts ammonium sulfate, 0.19 parts potassium dihydrogen phosphate, 0.19 parts calcium chloride, and 990 parts distilled water. Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 22℃ culture room for constant temperature dark culture for 25 days to obtain the original seed; The original culture medium in the original culture bottle comprises the following raw materials by weight: 19 parts hardwood sawdust, 68 parts buckwheat grains, 7.5 parts wheat bran, 0.9 parts sucrose, and 0.9 parts gypsum powder; pH value 7, water content 55%; Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn container and placed in a 22℃ incubation room for constant temperature and dark culture for 35 days. After the mycelium has fully grown in the spawn container, the spawn is obtained. The culture medium in the cultivation container comprises the following raw materials by weight: 76 parts sawdust, 14.5 parts wheat bran, 4.8 parts soybean meal, 0.9 parts gypsum, 0.9 parts white sugar, and 0.9 parts lime; pH value 7, moisture content 55%; Step (4), inoculation of cultivation bags: transfer the spawn into the cultivation bags and place them in a culture room at 22℃ and 60% relative humidity for 40 days until the mycelium has fully grown in the bags; The cultivation medium in the cultivation bag comprises the following raw materials by weight: 76 parts broadleaf tree sawdust, 19 parts wheat bran, 0.9 parts gypsum powder, and 0.9 parts lime powder; pH value 8, moisture content 55%; Step (5), soil covering cultivation: After the mycelium in the cultivation bag from step (4) has fully grown, transport it to the cultivation base and continue to ripen for 7 days under shaded conditions. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. When the white growth ring on the edge of the cap disappears, harvest the fruiting bodies.

[0032] In step (4), the specifications of the cultivation bag are 17cm×35cm×0.05mm.

[0033] In step (5), the cultivation base is a greenhouse.

[0034] In step (5), the spacing between cultivation bags should be 10cm when placing the bags, and the soil covering thickness should be 3cm.

[0035] In step (5), after covering with soil, the plants can be harvested after 68 days.

[0036] In step (5), fruiting management includes the bud induction stage, the fruiting body growth stage, and the fruiting body maturation stage; During the budding stage, the temperature should be controlled at 22℃-26℃; the relative humidity of the air should be 85%-90%; and the light intensity should be 1000-2000 lx. During the fruiting body growth stage, the temperature should be 22℃-26℃, the relative humidity of the air should be 80%-95%, and the light intensity should be 1000-2000lx. During the fruiting body maturation stage, the temperature should be 24℃-28℃, the relative humidity should be 75%-85%, and the light intensity should be 1000-2000 lx.

[0037] Example 3

[0038] A *Ganoderma camphorae* strain L7402, classified as *Ganoderma camphorae*, was deposited on August 11, 2026, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 68815).

[0039] The cultivation method of the *Ganoderma lucidum* strain L7402 includes the following steps: Step (1), propagation of mother culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L7402 were inoculated onto the mother culture PDA medium and placed in a 26℃ incubator for 10 days. The mother culture medium for PDA comprises the following ingredients by weight: 17 parts agar, 21 parts glucose, 5.5 parts potato starch, 2.1 parts yeast powder, 2.1 parts ammonium sulfate, 0.21 parts potassium dihydrogen phosphate, 0.21 parts calcium chloride, and 1010 parts distilled water. Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 25℃ culture room for constant temperature dark culture for 30 days to obtain the original seed; The original culture medium in the original culture bottle comprises the following raw materials by weight: 21 parts hardwood sawdust, 72 parts buckwheat grains, 8.5 parts wheat bran, 1.1 parts sucrose, and 1.1 parts gypsum powder; pH value 8, moisture content 60%; Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn container and placed in a 25℃ incubation room for constant temperature and dark culture for 40 days. After the mycelium has fully grown in the spawn container, the spawn is obtained. The culture medium in the cultivation container comprises the following raw materials by weight: 78 parts sawdust, 15.5 parts wheat bran, 5.2 parts soybean meal, 1.1 parts gypsum, 1.1 parts white sugar, and 1.1 parts lime; pH value 8, moisture content 60%; Step (4), inoculation of cultivation bags: transfer the spawn into the cultivation bags and place them in a culture room at 25℃ and 70% relative humidity for 45 days until the mycelium has fully grown in the bags; The cultivation medium in the cultivation bag comprises the following raw materials by weight: 80 parts broadleaf tree sawdust, 21 parts wheat bran, 1.1 parts gypsum powder, and 1.1 parts lime powder; pH value 9, moisture content 60%; Step (5), soil covering cultivation: After the mycelium in the cultivation bag from step (4) has fully grown, transport it to the cultivation base and continue to ripen for 10 days under shaded conditions. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. When the white growth ring on the edge of the cap disappears, harvest the fruiting bodies.

[0040] In step (4), the specifications of the cultivation bag are 17cm×35cm×0.05mm.

[0041] In step (5), the cultivation base is a shade shed.

[0042] In step (5), the spacing between cultivation bags should be 15cm and the soil covering thickness should be 5cm.

[0043] In step (5), after covering with soil, the plants can be harvested after 72 days.

[0044] In step (5), fruiting management includes the bud induction stage, the fruiting body growth stage, and the fruiting body maturation stage; During the budding stage, the temperature should be controlled at 23℃-25℃; the relative humidity of the air should be 85%-90%; and the light intensity should be 1200-1800 lx. During the fruiting body growth stage, the temperature should be 23℃-25℃, the relative humidity of the air should be 80%-95%, and the light intensity should be 1200-1800lx. During the fruiting body maturation stage, the temperature should be 23℃-27℃, the relative humidity should be 75%-85%, and the light intensity should be 1200-1800lx.

[0045] Example 4

[0046] A *Ganoderma camphorae* strain L7402, classified as *Ganoderma camphorae*, was deposited on August 11, 2026, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 68815).

[0047] The cultivation method of the *Ganoderma lucidum* strain L7402 includes the following steps: Step (1), propagation of mother culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L7402 were inoculated onto the mother culture PDA medium and placed in a 25℃ incubator for 8 days. The mother culture PDA medium comprises the following raw materials by weight: 16 parts agar, 20 parts glucose, 5 parts potato starch, 2 parts yeast powder, 2 parts ammonium sulfate, 0.2 parts potassium dihydrogen phosphate, 0.2 parts calcium chloride, and 1000 parts distilled water. Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a 24℃ culture room for constant temperature dark culture for 28 days to obtain the original seed; The original culture medium in the original culture bottle comprises the following raw materials by weight: 20 parts hardwood sawdust, 70 parts buckwheat grains, 8 parts wheat bran, 1 part sucrose, and 1 part gypsum powder; pH value 7.5, moisture content 58%; Step (3), preparation of spawn: the original spawn prepared in step (2) is inoculated into the spawn container and placed in a 25℃ incubation room for constant temperature and dark culture for 38 days. After the mycelium has fully grown in the spawn container, the spawn is obtained. The culture medium in the cultivation container comprises the following raw materials by weight: 77 parts sawdust, 15 parts wheat bran, 5 parts soybean meal, 1 part gypsum, 1 part white sugar, and 1 part lime; pH value 7.5, moisture content 57%; Step (4), inoculation of cultivation bags: transfer the spawn into the cultivation bags and place them in a culture room at 23°C and 65% relative humidity for 42 days until the mycelium has fully colonized the bags; The cultivation medium in the cultivation bag comprises the following raw materials by weight: 78 parts broadleaf tree sawdust, 20 parts wheat bran, 1 part gypsum powder, and 1 part lime powder; pH value 8.5, moisture content 58%; Step (5), soil covering cultivation: After the mycelium in the cultivation bag from step (4) has fully grown, transport it to the cultivation base and continue to ripen for 9 days under shaded conditions. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. When the white growth ring on the edge of the cap disappears, harvest the fruiting bodies.

[0048] In step (4), the specifications of the cultivation bag are 17cm×35cm×0.05mm.

[0049] In step (5), the cultivation base is under the forest.

[0050] In step (5), the spacing between cultivation bags should be 12cm when placing the bags, and the soil covering thickness should be 4cm.

[0051] In step (5), after covering with soil, the plants can be harvested 70 days later.

[0052] In step (5), fruiting management includes the bud induction stage, the fruiting body growth stage, and the fruiting body maturation stage; During the budding stage, the temperature should be controlled at 22℃-26℃; the relative humidity of the air should be 85%-90%; and the light intensity should be 1000-2000 lx. During the fruiting body growth stage, the temperature should be 22℃-26℃, the relative humidity of the air should be 80%-95%, and the light intensity should be 1000-2000lx. During the fruiting body maturation stage, the temperature should be 24℃-28℃, the relative humidity should be 75%-85%, and the light intensity should be 1000-2000 lx.

[0053] Application Examples 1. Sample collection and culture separation Wild Ganoderma lucidum specimens were collected from the trunks of camphor trees in Yuxi City, Yunnan Province, China. At the collection site, the habitat and intact specimens were photographed and recorded. Then, the target basidiosperm was detached from the host using a stainless steel harvesting knife sterilized with 75% (v / v) ethanol. The collected basidiosperm were placed in mesh bags for transport. In the laboratory, after completing the morphological recording of the specimens, a pure culture of strain L7402 was obtained using a tissue isolation method. Specifically, the surface of the basidiosperm was disinfected with cotton balls soaked in 75% (v / v) ethanol. Then, using a sterile scalpel, a small, uncontaminated piece of fresh tissue (2mm × 2mm) was aseptically cut from the fresh flesh at the junction of the cap and stipe. The tissue piece was inoculated into the center of an enrichment PDA plate and incubated in the dark at 26℃ for 5-7 days.

[0054] After white mycelia sprouted around the tissue block, the tips of vigorous and robust young mycelia at the edge of the colony were taken using a 5mm punch and transferred to a new enriched PDA plate for purification culture using a sterile scalpel. This purification process was repeated 2-3 times until a pure culture with uniform colony morphology and no contamination was obtained; this is the *Ganoderma lucidum* strain L7402. The purified strain was transferred and stored on enriched PDA slant medium at 4°C for later use. The remaining specimen material was thoroughly dried at 40°C, sealed in a plastic bag containing anhydrous silica gel, and preserved in the Herbarium of the Kunming Institute of Botany, Chinese Academy of Sciences.

[0055] The formulation for enriched PDA plates is as follows: 5g potato extract powder, 20g glucose, 2g ammonium sulfate, 2g yeast powder, 0.2g potassium dihydrogen phosphate (KH2PO4), 0.2g calcium chloride (CaCl2), 16g agar, and distilled water to a final volume of 1000mL, pH 8-9; autoclave at 121℃ for 20min.

[0056] The formula for PDA enrichment slant culture medium is as follows: 5g potato extract powder, 20g glucose, 2g ammonium sulfate, 2g yeast powder, 0.2g potassium dihydrogen phosphate (KH2PO4), 0.2g calcium chloride (CaCl2), 16g agar, and distilled water to a final volume of 1000mL, pH 8-9; autoclave at 121℃ for 20min.

[0057] 2. Morphological studies Macroscopic morphological characteristics were described based on detailed photographs of field records and fresh specimens, with color descriptions standardized according to the Methuen Color Manual. For microscopic morphological studies, sections were cut from dried specimens and stained with 5% potassium hydroxide (KOH), Melzer's reagent (IKI), and cotton blue (CB) to prepare temporary slides. These slides were then observed under a Leica DM6B upright fluorescence microscope equipped with phase contrast illumination at a maximum magnification of 1000×. Key structures such as basidiospores, basidiospores, and hyphal systems were recorded and photographed to obtain information on their morphology, color, and size.

[0058] During scanning electron microscopy (SEM) observation, basidiospores were obtained by gently scraping the surface of the hymenium of the dried basidiospore fruit with a sterile needle. The spores were then attached to an aluminum sample stage with double-sided conductive carbon tape, allowed to dry naturally at room temperature, and then sputter-coated with gold. The resulting SEM images were observed using a Hitachi SU-8100 scanning electron microscope (Hitachi High Technology Co., Ltd., Tokyo, Japan). The obtained SEM images were used to observe and record the surface ornamentation of the basidiospores.

[0059] To elucidate the characteristics of the hyphal system, thin sections were prepared from the flesh and tubes of dried basidiospores. Skeletal and entwined hyphae were observed and photographed in the flesh, while reproductive hyphae were observed and photographed in the tubes. All measurements were performed using ImageFrame Work (IFW) v.0.9.7 software. To reasonably reflect the size variation of basidiospores, the extreme values ​​were discarded at both ends, with extreme values ​​indicated in parentheses.

[0060] The abbreviations used in this invention are as follows: IKI = Melzer reagent, IKI- = neither starch nor dextrin-like reaction, KOH = 5% potassium hydroxide, CB = cotton blue, CB + = Cyanophilous reaction. The notation [n / m / p] indicates that the measurement data comes from "n" basidiospores on "m" basidiospores in "p" specimens. Basidiospore size is given in the form (a)b-av-c(d), where "a" and "d" are the minimum and maximum extreme values ​​of all measurements, respectively, and "bc" is the distribution range of 95% of the measurements. L = average spore length (arithmetic mean of all spores), W = average spore width (arithmetic mean of all spores). Q is the basidiospore length-to-width ratio, Qm represents the average of n measured basidiospores, SD is the standard deviation, and the results are presented as Q = Qm ± SD.

[0061] Main mode: - China. Tonghai County, Yuxi City, Yunnan Province, 24.108056°N, 102.755000°E, altitude 1842m, growing on the trunk of a camphor tree, Li Exian, August 10, 2025, L7402 (HKAS 154144).

[0062] Etymology: - The specific epithet "camphorae" refers to the host tree of the type specimen: camphor tree (Cinnamomum camphora).

[0063] Distinguishing features: - Basidiocarp annual, sessile, fan-shaped; cap surface glossy, brown to reddish-brown, with concentric rings and radial wrinkles; flesh corky, with black melanin lines; cap cortex is palisade-type, composed of club-shaped to cylindrical cells, 30-59×11-20μm in size; basidiospores (8.9) 9.1-12.4 (12.6) × (6.5) 6.5-8.8 (9.7) μm, ovoid to obovoid.

[0064] Morphological Description: The color descriptions of various parts of the fruiting body of the *Ganoderma lucidum* strain L7402 of this invention, as well as the color codes in parentheses (such as 7D7, 6F8, etc.), are standardized and defined according to the color chart in the *Methuen Color Manual*. Specific morphological characteristics are as follows: Basidiocarp: Annual, sessile, texture ranging from corky to woody-hard. Cap: Solitary, fan-shaped, 15.5-26.0 × 7.5-16.0 cm, 3-4 cm thick at the base. Cap surface: Weak to strong gloss, with shallow concentric grooves and radial wrinkles, forming concentric rings. Cap color ranges from light brown (7D7), brown (7E7) to reddish-brown (8E7) or dark brown (8F7), deepening in color after drying. Edge: Reddish-gold (6C7), slightly blunt. Flesh: 2-3 cm thick, composed of loose fibers, corky, brown (5F5) to dark gold (5D4). The tubes are 0.3-0.9 cm long, hard and woody, dark brown (6F4), and not layered. The pores are round to polygonal, 4-6 per millimeter; the pore walls are thin with a slightly thicker thickness and entire. The pore surface is light brown (5D5) to brownish-gray (6C2) when fresh, turning dark brown (6F8) when dried.

[0065] Pure Culture: After culturing the pure culture of Ganoderma lucidum on enriched PDA plates at 24°C for 14 days, the mycelium grew rapidly, covering the entire surface of the petri dish. The colonies were round with regular edges and clear boundaries. The mycelium was dense, and the colony surface had a felt-like texture. The colony center was dense, and the mycelial density remained uniform towards the periphery. The color on the back of the petri dish remained unchanged.

[0066] The mycelial structure is divided into three systems: reproductive hyphae, 2.5–3.2 μm in diameter, colorless, thin-walled, with clamp connections. skeletal hyphae, 4.7–8.7 μm in diameter, thick-walled to nearly solid, without septa, moderately to abundantly branched, pale orange (5A4) to dark gold (5D4). Connecting hyphae, sparse, 1.3–3.0 μm in diameter, thick-walled, branched, colorless to pale orange (5A4). All hyphae are IKI- and CB+; the tissue darkens in KOH solution.

[0067] Basidia and pseudo-Basidia: Basidia are oval to nearly spherical, colorless, with 2-4 stalks, thin-walled, 17-21 × 11-16 µm; pseudo-Basidia are similar in shape to Basidia, colorless, thin-walled, 11-20 × 7-15 µm.

[0068] Basidiospores: usually oval to obovate when mature, with a truncate apex. Light brown (5D5) to brown (5F5), IKI-, CB+. Spores are biwalled, with a smooth outer wall and a rough, spiny inner wall; (62 / 2 / 2)(8.9)9.1-10.8-12.4(12.6)×(6.5)6.5-7.9-8.8(9.7)μm, L=10.77μm, W=7.85μm, Q=(1.2)1.2-1.4-1.6(1.7), Qm=1.38±0.12 (including the sticky spore wall).

[0069] Cap cortex cells: composed of regularly arranged palisade-like cells, 30-59 × 11-20 μm, club-shaped to cylindrical, occasionally with swollen tips, thick-walled ( Figure 2 (G in the text). Some cells have granular structures at their apex, while others do not. The color ranges from light orange (5A4) to dark gold (5D4), exhibiting a moderate starch reaction when mature.

[0070] 3. DNA extraction, PCR amplification and sequencing Total genomic DNA was extracted from fresh basidiomycete tissue using the FlaPure Plant DNA Extraction Kit (Genesand Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. The following four gene regions were amplified by polymerase chain reaction (PCR): internal transcribed spacer (ITS), large ribosomal subunit gene (nrLSU), translation elongation factor 1-alpha (TEF1-α), and RNA polymerase II second large subunit gene (RPB2). Primers used for amplification and sequencing are detailed in Table 1.

[0071] Table 1 Primers used for PCR amplification and sequencing in this invention

[0072] The four gene regions were amplified using separate 25 μL PCR reaction systems. Each 25 μL PCR reaction system for a gene region contained: 12.5 μL of 2×T5 Super PCR Mix (Qingke Biotechnology Co., Ltd., Hubei, China), 1 μL of the corresponding upstream primer (10 μmol / L), 1 μL of the corresponding downstream primer (10 μmol / L), 1 μL of DNA template (20-50 ng / μL), and ddH2O was added to bring the total volume to 25 μL (i.e., 9.5 μL of ddH2O was added).

[0073] The PCR amplification procedures for each gene fragment are as follows: The ITS amplification program consists of a 5-minute pre-denaturation at 94°C, followed by 38 cycles, each consisting of 30 seconds of denaturation at 94°C, 30 seconds of annealing at 53°C, 50 seconds of extension at 72°C, and a final extension at 72°C for 10 minutes.

[0074] The nrLSU amplification program is as follows: pre-denaturation at 94°C for 5 min; followed by 38 cycles, each cycle consisting of denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 1 min; and final extension at 72°C for 10 min.

[0075] The TEF1-α amplification program is as follows: pre-denaturation at 94°C for 5 min; followed by 38 cycles, each cycle consisting of denaturation at 94°C for 30 s, annealing at 52°C for 1 min, extension at 72°C for 1 min, and final extension at 72°C for 10 min.

[0076] The RPB2 amplification program is as follows: pre-denaturation at 94°C for 5 min; followed by 38 cycles, each cycle consisting of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min; and final extension at 72°C for 10 min.

[0077] PCR products were analyzed by 1% agarose gel electrophoresis (ethidium bromide staining) and then detected under UV light. Purification and sequencing of the PCR products were performed by Qingke Biotechnology Co., Ltd. (Hubei, China). The original DNA sequence was spliced ​​and edited using BioEdit v.7, and the spliced ​​sequence has been submitted to GenBank.

[0078] The ITS sequence is: ttgactgggttgtagctggccttccgaggcatgtgcacaccctgctcatccactctacacctgtgcacttactgtgggcttcaggttgtgaagcgggctctttacggagcttgtgggcgtgtctgtgcctgcgtttatcacaaactctataaagtattagaatgtgtattgcgatgtaacgcatctatatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgtttgagtgtcataaaatcttcaacttacagacctttgcggtttgtaggcttggacttggaggcttgtcggccgttttcggttggctcctctcaaatgtattagcttgattccttgcggatcggctctcggtgtgataatgtctacgccgcgaccgtgaagcttttggcgagcttctaaccgtctcgtt (SEQ ID NO.9).

[0079] The nrLSU sequence is: tcccctagtaactgcgagtgaagcgggaaaagctcaaatttaaaatctggcggtcttcggccgtccgagttgtagtctggagaagtgctttccgcgctggaccgtgtataagtctcttggaacagagcgtcatagagggtgagaatcccgtctttgacacggactaccagtgctttgtgatgcgctctcaaagagtcgagttgtttgggaatgcagctcaaaatgggtggtgaattccatctaaagctaaatattggcgagagaccgatagcgaacaagtaccgtgagggaaagatgaaaagcactttggaaagagagttaaacagtacgtgaaattgctgaaagggaaacgcttgaagtcagtcgcgttgtccggaactcagccttgctttcgcttggtgcactttccggatgacgggtcagcatcgattttgaccgtcggaaaagggctggagtaatgtggcacctccgggtgtgttatagactctggtcgcatacggcggttgggatcgaggaacgcagcgcgccgcaaggcaggggttcgcccactttcgygcttaggatgctggcataatggctttaaacgacccgtcttgaaacacggaccaaggagtctaacatacctgcgagtgtttgggtggaaaacccgagcgcgtaatgaaagtgaaagttgagatccctgtcgtggggagcatcgacgcccggacctgacgttctctgacggatccgcggtagagcatgtatgttgggacccgaaagatggtgaactatgcctgaatagggtgaagccagaggaaactctggtggaggctcgtagcgattctgacgtgcaaatcgatcgtcaaatttgggtat (SEQ ID NO. 10).

[0080] The TEF1-α sequence is: atcctcatcatcgccgctggtaccggtgagttcgaggctggtatctccaaggatggccagacccgcgagcacgccctccttgccttcaccctcggtgtcaggcagctcatcgttgccgtcaacaagatggacaccacgaaggttcgttgtcacgtgcgtcgtcatgcgttgatgtcctgacttggagctcgcagtggtccgaggaccgtttcaacgaaatcatcaaggagacctccacctttatcaagaaggtcggttacaaccccaaggccgttgcgttcgtccccatctctggctggcacggcgacaacatgttggaggagtccaccaagtgagtctatgcgcaaacttgtttgatgattcgttgccctgaccttgttgcttcagcatgccctggtacaagggctggaccaaggagacgaaggctggtgtcgttaagggcaagacccttttggacgctatcgatgccatcgagccccccgtccgtccctccgacaagcccctccgtctccccctccaggatgtctacaagatcggt (SEQ ID NO.11).

[0081] The RBP2 sequence is: (SEQ ID NO.12).

[0082] 4. Phylogenetic analysis and confirmation of new species A multigene phylogenetic tree was constructed using maximum likelihood (ML) and Bayesian inference (BI) methods based on a combined dataset of ITS, nrLSU, TEF1-α, and RPB2 sequences. The specific process is as follows: (1) Sequence Acquisition and Dataset Construction: In this invention, four target gene fragments (ITS, nrLSU, TEF1-α, and RPB2) of the Ganoderma camphorata strain L7402 were amplified and sequenced, resulting in four new sequences, which have been submitted to GenBank. Based on the BLAST alignment results of the above sequences in the NCBI database, four gene fragment reference sequences of known species related to the Ganoderma genus were downloaded from GenBank, and the homologous gene sequence of Sanguinoderma rugosum (specimen number Cui 9011) was downloaded from GenBank as an outgroup. All sequences were subjected to multiple alignment using MAFFT v.7, and after correction in BioEdit, the four gene alignment matrices were spliced ​​together using SequenceMatrix to form a multi-gene joint dataset.

[0083] (2) Phylogenetic tree construction method: Maximum likelihood analysis (ML) was performed on the CIPRES scientific gateway using RAxML-HPC2 software. The GTR+G model was used for each gene partition, and 1000 bootstrap iterations were performed to calculate the maximum likelihood support (ML-BS). Bayesian analysis (BI) was performed using MrBayes v3.2 software. MrModeltest 2.3 was used to evaluate the optimal nucleotide substitution model for each partition, and Markov chain Monte Carlo (MCMC) was run for 10 million generations to calculate the posterior probability (BPP). The resulting phylogenetic tree was visualized using FigTree software.

[0084] (3) Phylogenetic analysis results and morphological synthesis confirmation: The results of multigene combined phylogenetic analysis are as follows: Figure 1 As shown (the topological structures obtained from ML and BI analyses are consistent): the *Ganoderma camphorata* strain L7402 independently clustered into a monophyletic clade with extremely high statistical support (ML-BS=99%, BPP=0.99), and is a sister group to *Ganoderma austroafricanum* (support rate 92% / 1.00). Sequence alignment results showed that *Ganoderma camphorata* and *Ganoderma austroafricanum* have fixed characteristic nucleotide differences in the ITS (12 substitutions), nrLSU (3 substitutions), and RPB2 (6 substitutions) regions.

[0085] In terms of morphological identification characteristics: *Ganoderma camphorata* has a trihyphae system, and its basidiospores are relatively large and oval to obovate (9.1-12.4 × 6.5-8.8 μm, with rough, spiny ornamentation on the inner spore wall), which is clearly distinguishable from *Ganoderma septemlobus* (dihyphae system, spores nearly spherical with fine warty ornamentation, 8-11 × 5.5-7 μm), *Ganoderma sessile*, and *Ganoderma polychromum*. Furthermore, the basidiospores of *Ganoderma camphorata* are sessile and fan-shaped, and the flesh has characteristic black, melanin-like lines, which also significantly distinguishes it from *Ganoderma multipileum*, *Ganoderma tropicum*, and *Ganoderma resinaceum*.

[0086] In summary, both multigene phylogenetic analysis and morphological identification characteristics clearly confirm that the tested strain L7402 belongs to an undescribed independent new species of the Ganoderma genus, and is formally named Ganoderma camphorae.

[0087] 5. Growth and development conditions of Ganoderma lucidum (Cinnamomum camphora) *Ganoderma camphorata* is a large, saprophytic fungus found in wood. Wild resources were collected from Kunming and Yuxi in Yunnan Province. Artificial cultivation experiments have shown that it can be grown in bags and by covering with soil in many areas of Yunnan. The growth and development process of *Ganoderma camphorata* mainly includes the mycelial vegetative growth stage and the fruiting body reproductive growth stage. During the mycelial stage, it mainly grows inside the culture medium, absorbing and transforming lignocellulose nutrients; the fruiting body stage is characterized by primordia formation, stipe elongation, cap expansion, fruiting body maturation, and spore release.

[0088] The mycelium of Ganoderma lucidum camphora exhibits good utilization of lignocellulose substrates. For artificial cultivation, broadleaf wood chips (preferably oak) are the primary cultivation material, supplemented with wheat bran, gypsum, and other auxiliary materials to replenish organic nitrogen sources and mineral elements, and improve the pore structure of the culture medium. The particle size of the wood chips should be controlled between 1-5 mm to ensure good air permeability and water retention. This avoids both excessively fine particles (<1 mm) leading to poor aeration and excessively coarse particles (>5 mm) affecting the compactness of the bags and the uniform feeding of the mycelium.

[0089] During the mycelial culture stage of Ganoderma lucidum, the ambient temperature should be controlled at 24℃-26℃, and the relative humidity should be maintained at 55%-65%. The mycelium should be kept in a dark, light-protected environment (light intensity <50 lx) for constant temperature growth. During the fruiting stage, environmental control should be implemented in stages: bud induction, fruiting body growth, and fruiting body maturation. For the bud induction stage, the temperature should be controlled at 22-26℃, relative humidity at 85%-90%, and light intensity at 1000-2000 lx. For the fruiting body growth stage, the temperature should be 22-26℃, relative humidity at 80%-95%, and light intensity at 1000-2000 lx. For the fruiting body maturation stage, the temperature should be 24-28℃, relative humidity at 75%-85%, and light intensity at 1000-2000 lx. Simultaneously, timely ventilation should be maintained to keep the CO2 concentration <0.1% to induce efficient primordia differentiation and robust fruiting body growth.

[0090] In summary, the key to the artificial cultivation of Ganoderma lucidum is to coordinate nutrition, temperature, water, light, and ventilation. During the mycelial growth stage, the goal is to promote rapid, uniform, and robust mycelial growth; during the fruiting body development stage, the goal is to promote uniform primordia formation, normal cap expansion, and full fruiting body maturation.

[0091] 5.1 Temperature The cultivation of Ganoderma lucidum mycelium should be carried out under medium-temperature conditions. From inoculation to the stage of mycelial recovery, the temperature of the cultivation room should be maintained at 24℃-26℃. After the mycelium enters the rapid growth phase, care should be taken to prevent heat accumulation inside the bags. When the cultivation room temperature is too high or the bags are stacked too densely, the bags should be loosened in time and ventilation should be strengthened to lower the temperature. After the mycelium has fully colonized the bags, the cultivation temperature can be appropriately reduced to 21℃-23℃ to allow the mycelium to further mature and stabilize. During the fruiting body formation and development stages, temperature management should be carried out in stages according to the primordia induction stage, the fruiting body growth stage, and the fruiting body maturation stage: the temperature should be controlled at 22℃-26℃ during the primordia induction stage, 22℃-26℃ during the fruiting body growth stage, and 24℃-28℃ during the fruiting body maturation stage. If the temperature is too low during the primordia formation period, it will delay the emergence of Ganoderma lucidum; if the temperature is too high, especially under high humidity and poor ventilation conditions, it is easy to induce contamination and diseases. In production, the temperature should be flexibly adjusted according to the season and local climate conditions.

[0092] 5.2 Moisture and Air Humidity The moisture content of the substrate for Ganoderma lucidum cultivation should be moderate. During the mycelial cultivation stage, the moisture content of the substrate should generally be controlled at 55%-60%, and the relative humidity of the air in the cultivation room should be maintained at 60%-70%. To judge the moisture content, the hand-holding method can be used: squeeze the substrate tightly in your hand; if there is water residue between your fingers but not continuous dripping, and the substrate clumps disperse or slightly clump together after releasing your hand, it is in a suitable state. If the moisture content is too low, the mycelium will consume the substrate slowly and grow sparsely; if the moisture content is too high, the aeration of the substrate will decrease, easily causing mycelial growth to be hindered or contaminated. The relative humidity during the fruiting stage should be higher than that during the mycelial cultivation stage. Management should be carried out in stages according to the bud induction stage, the fruiting body growth stage, and the fruiting body maturation stage: the relative humidity should be maintained at 85%-90% during the bud induction stage; 80%-95% during the fruiting body growth stage; and 75%-85% during the fruiting body maturation stage. Watering management should focus on spatial misting, ground moisturizing, and soil covering to retain moisture, avoiding direct water spraying onto the tender primordia and cap surfaces. If the humidity inside the greenhouse is insufficient, the frequency of misting should be increased; if the humidity inside the greenhouse is consistently too high, ventilation should be strengthened to prevent waterlogging of fruiting bodies and the occurrence of diseases.

[0093] 5.3 pH Ganoderma lucidum thrives in a slightly neutral to slightly alkaline environment. In actual production, since the pH of the culture medium may decrease after sterilization, the initial pH can be adjusted to 8-9 when mixing the medium.

[0094] Lime and gypsum are commonly used in production to adjust the pH of the culture medium and improve its structure. The amount of lime added should not be too high, as an excessively high pH will affect mycelial germination and normal growth. After mixing, the medium should be mixed as evenly as possible to avoid excessively high alkalinity in any localized areas.

[0095] 5.4 Light The mycelium of Ganoderma lucidum does not require strong light during its growth period; dark or low-light cultivation (light intensity controlled below 50 lx) is recommended. A certain amount of diffused light (light intensity controlled between 1000-2000 lx) is needed during the fruiting body formation and development stages. Appropriate light is beneficial for primordia formation, cap differentiation, color development, and normal fruiting body development.

[0096] The growing area should be kept under evenly diffused light, avoiding strong direct sunlight. When cultivating outdoors or under trees, light can be regulated by using shade nets, adjusting the canopy density, and using greenhouse film. Insufficient light can easily lead to excessively long stipes, small caps, or poor cap differentiation; excessive light can cause localized high temperatures, decreased humidity, and cracked cap edges.

[0097] 5.5 Air Ganoderma lucidum is an aerobic fungus, requiring sufficient oxygen for both mycelial growth and fruiting body development. Ventilation can be reduced appropriately during the early stages of mycelial cultivation to maintain stable temperature and humidity; proper ventilation is necessary during the middle and later stages of mycelial growth to prevent the accumulation of carbon dioxide in the cultivation chamber and heat buildup inside the cultivation bags.

[0098] Ventilation is crucial during the fruiting body development stage. Maintain a CO2 concentration below 0.1% in the growing environment. Insufficient ventilation can lead to excessive stipe growth, poor cap development, and deformed fruiting bodies. Ventilation management should prioritize air circulation and stable humidity, avoiding direct drafts on the fruiting bodies to prevent dehydration of the cap edges or cessation of growth.

[0099] 6. Solid culture characteristics Following the PDA medium formula: 200g potato, 20g glucose, 20g agar, and 1000mL water, the PDA medium was prepared and mixed thoroughly, then sterilized at 121℃ and 0.103MPa for 30min. The mixture was then poured into 90mm petri dishes to prepare plates. The preserved *Ganoderma lucidum* strain L7402 was activated and then transferred to the petri dishes. Once the mycelium had fully colonized the petri dishes, it was ready for use.

[0100] Mycelial blocks of *Ganoderma lucidum* strain L7402 were inoculated into the center of various conditioned mediums using a 0.5 cm diameter punch. Except for the temperature gradient experiment, all other single-factor conditions were incubated at 26℃. Each treatment was replicated five times. Colony diameter was measured every 24 hours using the streak method. Mycelial morphology and growth potential were observed and recorded. Data were compared using the Duncan method in SPSS 20.0 software to determine statistical significance (P < 0.05). Finally, the data were statistically analyzed using Excel 2021 and SPSS 20.0.

[0101] The formula for mycelial growth rate (V) is: Growth rate (V) = In the formula: R: Colony radius (mm); T: Number of days of cultivation (d); 5: The diameter of the inoculated bacterial block is 5mm.

[0102] Basic culture medium: 20g glucose, 2g yeast extract, 0.2g potassium dihydrogen phosphate, 16g agar, 1L distilled water.

[0103] 6.1 Single-factor screening experiment for carbon sources Using a basal culture medium without added glucose as a blank control, five carbon sources were set up as treatment groups: glucose, maltose, lactose, sucrose, and fructose, all at a concentration of 20 g / L.

[0104] The effects of different carbon sources on mycelial growth rate are shown in the following results. Figure 3 .

[0105] Depend on Figure 3 It was found that when glucose was used as a carbon source, the mycelial growth rate was the fastest, at (4.21±0.09) mm / d. There was no significant difference between this and that of maltose (3.59±0.10) mm / d and fructose (3.59±0.05) mm / d, but significant differences were observed compared to sucrose (2.99±0.20) mm / d, the blank control (1.91±0.09) mm / d, and lactose (0.81±0.04) mm / d (P<0.05). Lactose was the slowest carbon source, significantly slower than all other carbon sources. Although the growth rate of the blank control (1.91±0.09) mm / d was higher than that of lactose, it was still significantly lower than that of glucose, maltose, fructose, and sucrose.

[0106] 6.2 Single-factor screening experiment for nitrogen sources Using a basal culture medium without added yeast powder as a blank control, five nitrogen sources were set up as treatment groups: peptone, soybean meal, urea, yeast powder, and ammonium sulfate, all with a concentration of 2 g / L.

[0107] The effects of different nitrogen sources on mycelial growth rate are shown in the following results. Figure 4 .

[0108] Depend on Figure 4 It was found that the mycelial growth rate was fastest when ammonium sulfate was used as the nitrogen source, at (5.73±0.15) mm / d, which was significantly different from the yeast powder, peptone, blank control, and urea treatment groups, but not significantly different from the soybean meal treatment group. When urea was used as the nitrogen source, the mycelium did not grow, and there were significant differences between the treatment groups and other nitrogen source treatment groups (P<0.05).

[0109] 6.3 Inorganic Salt Single-Factor Screening Experiment Using a basal medium without potassium dihydrogen phosphate as a blank control, five inorganic salts were added to the PDA basal medium: potassium dihydrogen phosphate, magnesium sulfate, calcium chloride, sodium carbonate, and zinc sulfate as treatment groups, with a concentration of 0.2 g / L for each group.

[0110] The effects of different inorganic salts on mycelial growth rate are shown in the results. Figure 5 .

[0111] Depend on Figure 5 It was found that the mycelial growth rate was fastest when calcium chloride was used as the inorganic salt, at (5.63±0.07) mm / d, and there was no significant difference between this treatment and the blank control, potassium dihydrogen phosphate, magnesium sulfate, and sodium carbonate treatment groups. The mycelial growth rate was slowest when zinc sulfate was used as the inorganic salt, at (3.94±0.46) mm / d, and there were significant differences between this treatment and other treatment groups (P<0.05).

[0112] 6.4 Temperature Single-Factor Screening Experiment Mycelial blocks of Ganoderma lucidum strain L7402 were inoculated into the basal culture medium, and the culture dishes were placed in constant temperature incubators at 5℃, 10℃, 15℃, 20℃, 22℃, 24℃, 26℃, 28℃, 30℃, 32℃ and 35℃ respectively for cultivation.

[0113] The effects of different temperatures on mycelial growth rate are shown in the following results. Figure 6 .

[0114] Depend on Figure 6 It can be seen that as the temperature gradually increases, the mycelial growth rate shows a trend of first increasing and then decreasing. The fastest mycelial growth rate is observed at 26℃, which is (4.13±0.25) mm / d. There is no significant difference between this rate and the 24℃ treatment group, but significant differences exist between this rate and the other temperature treatment groups. At 5℃, 32℃, and 35℃, mycelial growth completely ceases, with a growth rate of (0.00±0.00) mm / d, which is significantly different from the other temperature treatment groups (P<0.05).

[0115] 6.5 pH Single-Factor Screening Test The initial pH of the basal culture medium was adjusted using 1.0 mol / L hydrochloric acid and 1.0 mol / L sodium hydroxide solution, with six initial pH gradients set: 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0.

[0116] The effects of different pH conditions on mycelial growth rate are shown in the figure. Figure 7 .

[0117] Depend on Figure 7 It can be seen that the growth rate was fastest at pH 9, which was (4.27±0.13) mm / d, and there was a significant difference between the pH 5, 6 and 7 treatment groups, but no significant difference between the pH 8 and 10 treatment groups; the growth rate was slowest at pH 5, which was (2.32±0.18) mm / d, and there was a significant difference between the pH 9 treatment group and all other pH treatment groups (P<0.05).

[0118] Ultimately, the inventors determined the optimal formula and conditions as follows: the carbon source is glucose, the nitrogen source is ammonium sulfate, the inorganic salt is calcium chloride, the temperature is 26℃, and the pH is 9.

[0119] 7. Camphor Tree Ganoderma lucidum Spawn Production Technology 7.1. Microbial culture preparation process The production of Ganoderma lucidum spawn generally includes three stages: mother culture, primary culture, and cultivation culture. The production process is as follows: fresh fruiting bodies or preserved strains → tissue isolation or transfer purification → mother culture → primary culture → cultivation culture → cultivation bag.

[0120] 7.2 Preparation of Mother Culture Medium The formula for the mother culture PDA medium is as follows: 16g agar, 20g glucose, 5g potato extract, 2g yeast extract, 2g ammonium sulfate, 0.2g potassium dihydrogen phosphate, 0.2g calcium chloride, and distilled water to a final volume of 1000mL. After preparation, adjust the pH to natural or approximately 6.0-7.0, autoclave at 121℃ for 20 minutes, and prepare plates or slants after cooling.

[0121] 7.3 Separation and Culture of Mother Culture The mother culture of Ganoderma lucidum can be obtained using tissue isolation. The isolated material should be fresh, robust, free from disease and pests, and have typical morphology. The procedure is as follows: Clean the surface of the fruiting body of mud and impurities; wipe the surface of the fruiting body with 75% (v / v) alcohol; perform aseptic operation in a clean bench; cut the fruiting body with a sterile blade; take a small piece of clean tissue from the junction of the cap and stipe or from inside the fruiting body; inoculate the tissue piece into the center of the mother culture PDA medium; incubate at 24℃-26℃; observe mycelial germination and contamination daily; promptly remove any contaminated cultures; select cultures with clean, uniform, and vigorous mycelial growth for purification and preservation. Unnecessary transfers should be minimized during the mother culture process to prevent strain degeneration. Mycelial viability and purity should be checked before production use.

[0122] 7.4 Original Seed Production 7.4.1 Original Seed Culture Medium Formula The original culture medium can be formulated as follows: 20% broadleaf tree sawdust, 70% buckwheat grains, 8% wheat bran, 1% sucrose, and 1% gypsum powder. Adjustments can be made according to actual raw material conditions, but the culture medium should be loose, well-aerated, nutritionally balanced, and free from mold.

[0123] 7.4.2 Preparation of original culture medium Pre-wet the broadleaf tree sawdust and buckwheat grains (to ensure the buckwheat grains fully absorb water and swell without a white core); accurately weigh each raw material according to the formula; thoroughly mix all components; add water to adjust the moisture content to 55%-60%; control the initial pH at 8.0-9.0; use 12cm×30cm×0.05mm polyethylene bags as mushroom bags, filling each bag with 500g of material, and seal with a cap ring. Autoclave at 121℃ for 2 hours; after sterilization, allow to cool naturally to below 30℃ for later use.

[0124] 7.4.3. Primary strain inoculation and culture Before vaccination, the vaccination room, clean bench, and vaccination tools should be disinfected. Personnel should wear work clothes, masks, and gloves, and vaccination tools should be sterilized by flame before use.

[0125] During inoculation, the mother culture block is inoculated into the original culture medium, sealed quickly, and labeled with the strain number and inoculation date. The inoculated original culture is then placed in the dark at 24℃-26℃ (with relative humidity maintained at 55%-65%).

[0126] Regular checks should be conducted during the cultivation period. A normal primary culture exhibits pure white, dense mycelium, uniform growth, no discoloration, and no off-odor. Primary cultures found to be contaminated or showing abnormal growth should be promptly removed from the cultivation room.

[0127] 7.5. Preparation of Cultivation Seeds The cultivation substrate formula is as follows: 77% broadleaf tree sawdust, 15% wheat bran, 5% soybean meal, 1% gypsum, 1% white sugar, and 1% lime. The moisture content should be controlled at 55%-60%, and the pH should be controlled at 8.0-9.0.

[0128] The steps for preparing the spawn are as follows: Pre-moisten broadleaf tree sawdust with water; accurately weigh wheat bran, soybean meal, gypsum, sugar, and lime according to the specified proportions; thoroughly dry-mix all raw materials, then add water and stir to adjust the moisture and pH; portion into spawn containers (polypropylene plastic spawn bags, 12cm×24cm×0.05mm) and seal with rings; sterilize by high-pressure steam at 121℃ for 2 hours; allow to cool naturally to below 30℃ after sterilization; inoculate with the original spawn under aseptic conditions in a clean bench; incubate in the dark at 24℃-26℃ and 55%-65% relative humidity; once the mycelium has fully colonized the bag and reached physiological maturity, it can be used for inoculation of spawn bags. The spawn must have robust mycelium, be uniformly colonized, free from contamination, and odorless. Aged, contaminated, or unevenly grown spawn must not be used for production.

[0129] 7.6 Preparation of cultivation bags 7.6.1 Cultivation substrate formula The cultivation medium in the cultivation bags uses the following basic formula: 78% broadleaf tree sawdust, 20% wheat bran, 1% gypsum powder, and 1% lime powder. During production, the formula should be appropriately optimized based on local raw material sources, mycelial growth, contamination rate, and fruiting body development.

[0130] 7.6.2 Raw material processing Broadleaf tree sawdust should be pre-moistened before use to ensure it is fully hydrated and free of dry core. The wheat bran, gypsum powder, and lime powder used should be dry, fresh, free of lumps, and free of mold.

[0131] When mixing the substrate, first thoroughly mix the pre-moistened broadleaf tree sawdust with wheat bran, gypsum powder, and lime powder. Then gradually add water while stirring. The moisture content of the substrate should be controlled at 55%-60%. After mixing, the substrate should be bagged as soon as possible to avoid prolonged storage, which can lead to spoilage or the growth of miscellaneous bacteria.

[0132] 7.6.3 Bagging Polyethylene or polypropylene bags with dimensions of 17cm×35cm×0.05mm can be used. When filling the bags, ensure they are neither too tight nor too loose, and that the bags are filled evenly with the substrate, without any damage to the bag walls. Filling the bags too loosely can lead to shrinkage and uneven mycelial growth later on; filling them too tightly will result in poor ventilation and hinder mycelial growth.

[0133] After bagging, clean the bag opening, add a ring, cap, or seal the bag, and check for any damage. Sterilize the bags as soon as possible after bagging is complete.

[0134] 7.6.4 Sterilization Cultivation bags can be sterilized by autoclaving or atmospheric pressure. When autoclaving, ensure all cold air is removed; sterilization conditions can be controlled at 121℃ for 2 hours. For atmospheric pressure sterilization, maintain the temperature at 100℃ for 10-14 hours. After sterilization, transfer the bags to a clean cooling room and allow them to cool naturally to below 30℃ before inoculation.

[0135] 7.7 Inoculation and Mycelium Management 7.7.1 Vaccination Inoculation should be performed in a clean bench, inoculation box, or sterilized inoculation room. Before inoculation, the space, work surface, and tools should be disinfected. Operators should wear masks and gloves, and wipe their hands and the outer wall of the inoculum bags with 75% (v / v) alcohol.

[0136] Inoculation should be performed quickly and accurately to minimize the exposure time of the open bag. After inoculation, seal the bag promptly and label it with the strain number, inoculation date, formula, and batch number.

[0137] 7.7.2. Mycelial Culture After inoculation, the mushroom bags should be placed in a clean, dark or low-light incubation room. The incubation conditions are as follows: temperature 24℃-26℃; relative humidity 60%-70%; light source: keep dark or low light; ventilation should be minimal in the early stages and moderate in the later stages. Check the bags at least once a week during the incubation process, and prevent high temperatures from burning the mycelium. The mushroom bags should not be stacked too densely; sufficient space should be left for ventilation and heat dissipation. Any contaminated bags should be removed promptly to prevent further spread.

[0138] Normal mycelial growth is characterized by white, uniform, and dense hyphae that gradually expand into the substrate. If green mold, black mold, yellow spots, a sour odor, a wet and rotten surface, or if mycelial growth ceases, the affected material should be removed immediately.

[0139] 7.7.3 Post-ripening management Once the mycelium has fully colonized the bag, continue cultivation for 7-10 days to allow the mycelium to mature further. During the post-ripening period, maintain a suitable temperature and ventilation, and avoid high temperature, high humidity, and mechanical damage.

[0140] The mushroom can be managed when the following conditions are met: the mycelium has fully grown in the bag; the mycelium is white; the substrate is tightly bound; the bag is free from contamination by other microorganisms; there is no odor; and the mycelium has good vitality.

[0141] 8. Selection and treatment of cultivation site 8.1 Site Selection Camphor tree Ganoderma can be cultivated in greenhouses, shade houses, or under forest cover. The cultivation site should be flat or elevated, well-drained, well-ventilated, and have sufficient shade and water supply. Sites that are low-lying and waterlogged, exposed to direct sunlight, have severe pest and disease problems, or are close to pollution sources should be avoided.

[0142] 8.2 Site Preparation Before cultivation, weeds, dead branches, discarded mushroom bags, and contaminants should be removed. The soil can be tilled and sun-dried in advance. If necessary, an appropriate amount of lime can be applied for site disinfection. Drainage ditches, 20-30cm deep, should be set up around greenhouses, shade houses, or under-forest cultivation plots to prevent water accumulation during the rainy season.

[0143] Beds can be set up inside the shed. The width of the beds is generally 0.9-1.2m, and a 40-50cm working path is reserved between the beds to facilitate watering, ventilation, observation and harvesting.

[0144] 9. Methods of germination and soil covering management 9.1. Covering the bagged material with soil and excavating the mushrooms. Ganoderma lucidum can be grown using a bag-covered soil method. The process is as follows: mycelium growth in the bag is complete → post-ripening → transfer to the growing area → make a small opening of 2cm in diameter on the shoulder of the bag → place the bag at a 45-degree angle with the opening facing upwards → cover with soil → retain moisture to promote bud formation → grow and manage the Ganoderma lucidum.

[0145] When placing the bags, maintain a spacing of 10-15cm between them to facilitate ventilation and fruiting body development. The soil covering should generally be 3-5cm thick, preferably loose, clean soil with moderate water retention. After covering, water thoroughly to moisten the soil, but avoid waterlogging. For the fruiting results of Ganoderma lucidum strain L7402 with soil covering, see [link to relevant documentation]. Figure 9 .

[0146] 9.2. Understory cultivation Understory cultivation can be carried out in broad-leaved forests or mixed coniferous and broad-leaved forests, requiring moderate shading, good ventilation, and convenient drainage. After the mushroom bags are placed in the soil, cover them with 3-5cm of forest soil and cover them with a small amount of decaying leaves or straw mats to retain moisture. During the rainy season, pay attention to drainage to prevent waterlogging, which can lead to rotting of the mushroom bags or the occurrence of diseases.

[0147] 10. Export Management The management of Ganoderma lucidum after mulching with soil mainly includes the bud induction stage, the fruiting body growth stage, and the fruiting body maturation stage: 10.1 Bud Induction Management After the substrate bags are covered with soil, the bud induction stage begins. During this stage, the soil should be kept moist, the air humidity high, the ventilation moderate, and diffused light provided. Management conditions are as follows: temperature controlled at 22℃-26℃; relative humidity 85%-90%; light intensity controlled at 1000-2000 lx; ​​regular daily ventilation; moist soil, but not waterlogged. Under suitable conditions, the mycelium will gradually form primordia. In the early stages of primordia formation, avoid heavy watering; misting is preferred.

[0148] 10.2 Fruiting body growth stage After the primordia appear, the environment should be kept stable. If the primordia are too dense, they can be thinned appropriately according to the product target, retaining the robust and well-positioned young Ganoderma lucidum to promote the full development of the fruiting bodies. During this stage, attention should be paid to: temperature control at 22℃-26℃, relative humidity maintained at 80%-95%; avoiding direct sunlight, controlling light intensity at 1000-2000 lx; ​​preventing strong winds from drying out the young Ganoderma lucidum; strengthening ventilation to prevent carbon dioxide accumulation leading to deformities; and promptly treating any deformed, weak, or contaminated primordia. The morphology of the primordia stage, stipe elongation stage, and cap differentiation stage of the Ganoderma lucidum strain L7402 is shown in [reference needed]. Figure 8 .

[0149] 10.3. Maturation Stage of Sub-entities As the fruiting bodies mature, humidity should be appropriately reduced, direct watering should be minimized, and ventilation should be strengthened. The temperature should be controlled at 24℃-28℃, the relative humidity reduced to 75%-85%, and the light intensity maintained at 1000-2000 lx. During this stage, close observation of the cap edge, color changes, pore layer development, and spore release is crucial. The management goal during the maturation period is to promote full lignification of the fruiting bodies, stabilize their color, maintain their morphology, and reduce mold and pests. The morphology of the mature Ganoderma lucidum strain L7402 is shown in the figure. Figure 8 .

[0150] 11. Harvesting 11.1 Harvesting Criteria The fruiting bodies of Ganoderma lucidum should be harvested promptly after they mature. Maturity can be determined based on the following characteristics: the cap has basically stopped expanding; the light-colored growth ring at the edge of the cap gradually disappears; the color of the fruiting body deepens and tends to stabilize; the texture of the cap hardens and gradually becomes leathery; the pore layer is fully developed; and spore release or spore powder is visible.

[0151] Since the color of the fruiting bodies may vary depending on the strain and cultivation environment, a comprehensive judgment should be made based on the edge of the cap, texture, pore layer, and spore release during harvesting.

[0152] 11.2 Harvesting Methods When harvesting, use a sharp knife to cut from the base of the stipe, keeping the fruiting body as intact as possible. After harvesting, promptly remove the soil, substrate, and impurities from the base, and discard any diseased, pest-infested, or rotten specimens.

[0153] If it is necessary to continue cultivating subsequent batches, the remaining roots should be cleaned up after harvesting, the covering soil should be kept moist, and ventilation should be strengthened to allow the mycelium to resume growth.

[0154] 12. Drying and Storage 12.1 Drying After harvesting, Ganoderma lucidum should be dried promptly to prevent mold. Natural air drying, sun drying, or low-temperature drying at 40℃ can be used. The drying temperature should be controlled between 35℃ and 60℃. Ventilation should be maintained during the drying process to avoid stuffiness. Dry until the fruiting body is hard, free of moisture, and not easily bent.

[0155] If the sample is used for subsequent component determination, the drying temperature, time, and method should be recorded to ensure comparability between different batches of samples.

[0156] 12.2 Storage After drying, camphor-infused Ganoderma lucidum should be graded and packaged, and stored in a cool, dry, and dark place. Packaging materials should be clean, dry, and well-sealed. During storage, it should be protected from moisture, mold, and insects.

[0157] 12.3. Preservation of microbial strains The strain can be preserved at low temperature using PDA slant culture. Short-term preservation temperature can be controlled at 4-5℃. During production, the number of consecutive subculturing generations should be reduced. If mycelial growth weakens, contamination rate increases, or fruiting characteristics become unstable, the preserved strain should be rejuvenated or reused promptly.

[0158] 13. Large-scale cultivation process of Ganoderma lucidum strain L7402 Prepare cultivation bags according to the method in Section 7.6, sterilize and cool them, and then inoculate them with the spawn prepared according to the method in Section 7.5. After inoculation, the bags are cultured for mycelium growth under the conditions in Section 7.7.2 (temperature 22-26℃, relative humidity 60%-70%, dark) for 40-45 days. After the mycelium has fully colonized the bags, continue post-ripening for 7-10 days. Transfer the post-ripened bags to the cultivation site treated according to the method in Section 8, and cultivate them at a 45° angle with soil covering, 3-5 cm thick, and 10-15 cm between bags, as described in Section 9.1. After covering with soil, manage the fruiting bodies in stages according to Sections 10.1-10.3 (budding stage: 22-26℃, 85%-90%, 1000-2000 lx; ​​fruiting body growth stage: 22-26℃, 80%-95%, 1000-2000 lx; ​​fruiting body maturation stage: 24-28℃, 75%-85%, 1000-2000 lx), maintaining a CO2 concentration <0.1%. Harvest the fruiting bodies according to Section 11 after they mature, and dry and store them according to Section 12.

[0159] 14. Morphological characteristics of sub-entities 14.1 Main agronomic traits The fruiting bodies of cultivated Ganoderma lucidum have a unique morphology, similar in appearance to common Ganoderma lucidum and Ganoderma sinense, but with distinctive differences. Specifically, the caps are all reddish-brown or yellowish-brown, and the stipes are dark reddish-brown. However, Ganoderma lucidum has a distinctive protrusion at the junction of the stipe and cap, especially during the cap differentiation period, where the protrusion swells and becomes prominent (see...). Figure 8 The cap is flat, broad, and round, with an average length of 132.44 mm and a width of 101.74 mm, exhibiting a relatively regular shape. The average flesh thickness is 14.47 mm, with a firm and dense texture. The stipe is of moderate length and typically grows laterally or eccentrically. In terms of yield, the average yield per bag is 61.4 g, with a biological efficiency of 12.88%, indicating that the formula and cultivation conditions can effectively meet the nutritional conversion requirements of *Ganoderma lucidum*, possessing good commercial potential. The fruiting performance of mature fruiting bodies of *Ganoderma lucidum* strain L7402 is shown in [the table / document / reference needed]. Figure 10 .

[0160] Table 2. Main morphological characteristics and yield of Ganoderma lucidum fruiting bodies.

[0161] 14.2 Nutritional Quality and Active Ingredient Analysis The dried fruiting bodies were subjected to quality testing, and the nutritional and active ingredient contents are shown in Table 3. Nutritionally, *Ganoderma lucidum* has a protein content as high as 17.8 g / 100g and a fat content of only 2.5 g / 100g, making it a typical high-protein, low-fat health food resource. Regarding active ingredients, its triterpenoid and sterol content reaches 2.68%, and its polysaccharide content is 1.64%. Both of these indicators meet the content determination requirements for Ganoderma lucidum medicinal materials in the *Pharmacopoeia of the People's Republic of China* (2025 edition), demonstrating good medicinal development value.

[0162] Table 3. Statistical Table of Camphor Tree and Ganoderma Lucidum Components

[0163] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A *Ganoderma lucidum* strain L7402, characterized in that, The strain L7402 of Ganoderma camphorae was classified and deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 11, 2026, with accession number GDMCC No: 68815.

2. The cultivation method of the Ganoderma lucidum strain L7402 according to claim 1, characterized in that, Includes the following steps: Step (1), propagation of mother culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L7402 were inoculated onto the mother culture PDA medium and placed in an incubator at 24℃-26℃ for 7-10 days. The aforementioned mother culture PDA medium comprises the following raw materials by weight: 15-17 parts agar, 19-21 parts glucose, 4.5-5.5 parts potato starch, 1.9-2.1 parts yeast extract, 1.9-2.1 parts ammonium sulfate, 0.19-0.21 parts potassium dihydrogen phosphate, 0.19-0.21 parts calcium chloride, and 990-1010 parts distilled water; Step (2), original seed preparation: Take the mother seed cultured in step (1) and inoculate it into the original seed culture bottle, place it in a culture room at 22℃-25℃ and culture it in the dark for 25-30 days to obtain the original seed; The original culture medium in the original culture bottle comprises the following raw materials by weight: 19-21 parts hardwood sawdust, 68-72 parts buckwheat grains, 7.5-8.5 parts wheat bran, 0.9-1.1 parts sucrose, and 0.9-1.1 parts gypsum powder; pH value 7-8, moisture content 55-60%; Step (3), preparation of spawn: Inoculate the original spawn prepared in step (2) into the spawn container and place it in a constant temperature dark culture room at 22℃-25℃ for 35-40 days. After the mycelium has fully grown in the spawn container, the spawn is obtained. The culture medium in the cultivation container comprises the following raw materials by weight: 76-78 parts sawdust, 14.5-15.5 parts wheat bran, 4.8-5.2 parts soybean meal, 0.9-1.1 parts gypsum, 0.9-1.1 parts white sugar, and 0.9-1.1 parts lime; pH value 7-8, moisture content 55-60%; Step (4), inoculation of cultivation bags: transfer the spawn into the cultivation bags and place them in a culture room at 22℃-25℃ and 60%-70% relative humidity for 40-45 days until the mycelium has fully grown in the bags; The cultivation medium in the cultivation bags comprises the following raw materials by weight: 76-80 parts broadleaf tree sawdust, 19-21 parts wheat bran, 0.9-1.1 parts gypsum powder, and 0.9-1.1 parts lime powder; pH value 8-9, moisture content 55-60%; Step (5), soil covering cultivation: After the mycelium in the cultivation bag from step (4) has fully grown, transport it to the cultivation base and continue to ripen under shade for 7-10 days. Then, open the bag with small holes and cover it with soil at a 45° angle for planting. When the white growth ring on the edge of the cap disappears, harvest the fruiting bodies.

3. The cultivation method of Ganoderma lucidum strain L7402 according to claim 2, characterized in that, In step (4), the specifications of the cultivation bag are 17cm×35cm×0.05mm.

4. The cultivation method of Ganoderma lucidum strain L7402 according to claim 2, characterized in that, In step (5), the cultivation base is a greenhouse, a shade shed, or under a forest.

5. The cultivation method of Ganoderma lucidum strain L7402 according to claim 2, characterized in that, In step (5), the spacing between cultivation bags should be 10-15cm, and the soil covering thickness should be 3-5cm.

6. The cultivation method of Ganoderma lucidum strain L7402 according to claim 2, characterized in that, In step (5), after covering with soil, the plants can be harvested after 68-72 days.

7. The cultivation method of Ganoderma lucidum strain L7402 according to claim 2, characterized in that, In step (5), fruiting management includes the bud induction stage, the fruiting body growth stage, and the fruiting body maturation stage; During the budding stage, the temperature should be controlled at 22℃-26℃; the relative humidity of the air should be 85%-90%; and the light intensity should be 1000-2000 lx. During the fruiting body growth stage, the temperature should be 22℃-26℃, the relative humidity of the air should be 80%-95%, and the light intensity should be 1000-2000lx. During the fruiting body maturation stage, the temperature should be 24℃-28℃, the relative humidity should be 75%-85%, and the light intensity should be 1000-2000 lx.

Images