Genetically engineered yeast and methods of construction and use thereof

Abstract

The present application relates to a kind of genetically engineered yeast and its construction method and application, belong to microbial technology field.The genetically engineered yeast includes overexpression ino1 Gene of Candida orientalis.The present application carries out in-depth analysis to the acid production process of Candida orientalis fermentation, designs genetic modification strategy based on transcriptome data, overexpresses ino1 Gene in Candida orientalis, and the acid production capacity of the obtained genetically engineered bacteria is high and stable, can adapt to industrial production environment, can be effectively applied in industrial production.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to a genetically engineered yeast, its construction method, and its application. Background Technology

[0002] Succinic acid, also known as succinic acid, is a naturally occurring dicarboxylic acid found in living organisms and an important intermediate in biological metabolism. Succinic acid is one of the few platform chemicals with both bio-based and petroleum-based production pathways. Its molecular structure contains two carboxyl groups, making it readily adaptable to various chemical reactions such as esterification, polymerization, and reduction. It can be used to synthesize numerous high-value-added derivatives. It is non-toxic, biodegradable, and aligns with green chemistry and sustainable development principles. Traditional succinic acid production relies heavily on petrochemical routes, resulting in environmental pollution and high energy consumption. Biochemical synthesis of succinic acid offers advantages such as renewable raw materials, mild process conditions, and environmental friendliness, making it a research hotspot in green biomanufacturing.

[0003] Yeast, as an important type of industrial microorganism, possesses advantages such as tolerance to low pH and high osmotic pressure, and ease of genetic manipulation, making it particularly suitable for the production of organic acids. Compared to bacterial hosts, yeast's ability to grow under low pH conditions gives it a significant advantage in succinic acid production, reducing the use of neutralizing agents, greatly simplifying downstream extraction processes, and lowering production costs. For example, CN118389307A discloses a yeast strain that synthesizes succinic acid based on the aspartic acid pathway. Using Yersinia lipolytica, a low-pH-tolerant and strictly aerobic yeast, as the host, it demonstrates the ability to synthesize fumarate via the Asp pathway in yeast by enhancing endogenous aspartic acid synthesis and heterologously expressing aspartate lyase. Further heterologous expression of NADH-dependent fumarate reductase further achieves succinic acid synthesis. However, the genetic modification of this engineered strain is cumbersome, the strain experiences high metabolic stress, and its production capacity and genetic stability may be difficult to meet the demands of industrial production.

[0004] In conclusion, developing effective strategies to enhance yeast's acid-producing capacity remains one of the pressing issues in the field of organic acid biosynthesis. Summary of the Invention

[0005] To address the shortcomings of existing technologies and practical needs, this invention provides a genetically engineered yeast, its construction method, and its applications. This invention develops a genetic modification strategy to enhance the acid-producing capacity of yeast, aiming to achieve efficient preparation of organic acids.

[0006] To achieve this objective, the present invention adopts the following technical solution: In a first aspect, the present invention provides a genetically engineered yeast, said genetically engineered yeast comprising overexpression ino1 The genes of Isaac yeast from the East.

[0007] This invention provides an in-depth analysis of the acid production process during the fermentation of *Issa mesasura*, and designs a genetic modification strategy based on transcriptome data to overexpress the gene in *Issa mesasura*. ino1 The genetically engineered bacteria obtained from these genes have high acid production capacity and stable performance, can adapt to industrial production environments, and can be effectively applied to industrial production.

[0008] Optionally, the ino1 The nucleic acid sequence of the gene includes the sequence shown in SEQ ID NO.1.

[0009] Optionally, the ino1 The nucleic acid sequence of the gene promoter includes any one of the sequences shown in SEQ ID NO.3, SEQ ID NO.23 or SEQ ID NO.24, and the nucleic acid sequence of the terminator includes the sequence shown in SEQ ID NO.4.

[0010] Optionally, the starting strain of the genetically engineered yeast is Pichia kudriavzevii M1285-7.

[0011] Secondly, the present invention provides a method for constructing the genetically engineered yeast described in the first aspect, the method comprising: […]. ino1 The gene was introduced into Isaac's orientalis for expression, resulting in genetically engineered yeast.

[0012] Optionally, the construction method specifically includes: using the CRIPPR-Cas editing system to... ino1 The gene was inserted into the genome of *Issa mesasura* for expression.

[0013] Optionally, the nucleic acid sequence of the donor DNA homologous arm in the CRIPPR-Cas editing system includes the sequences shown in SEQ ID NO.2 and SEQ ID NO.5.

[0014] Optionally, the nucleic acid sequence of the sgRNA in the CRIPPR-Cas editing system includes the sequence shown in SEQ ID NO.22.

[0015] In this invention, a specific CRIPPR-Cas editing scheme is designed to achieve stable and efficient overexpression in *Issa mesasura*. ino1 Gene.

[0016] Thirdly, the present invention provides the application of the genetically engineered yeast described in the first aspect in the production of succinic acid.

[0017] Fourthly, the present invention provides a biological agent comprising the genetically engineered yeast described in the first aspect.

[0018] In this invention, biological agents can be developed based on genetically engineered yeast, such as fermentation strain preparations for industrial production. The genetically engineered yeast can be in the form of freeze-dried powder or preserved in a strain preservation solution.

[0019] Fifthly, the present invention provides a method for producing succinic acid, the method comprising fermenting with the genetically engineered yeast described in the first aspect, purifying the fermentation broth to obtain succinic acid.

[0020] It is understood that succinic acid can be produced using the genetically engineered yeast of this invention, and by employing fermentation culture and product purification methods commonly used in the field.

[0021] Compared with the prior art, the present invention has at least the following beneficial effects: This invention designs a novel genetic modification strategy, using the original *Issa mesasura* species. ino1 As a target, it was overexpressed to obtain genetically engineered yeast with good acid-producing performance and stable performance, which has broad prospects for industrial application. Attached Figure Description

[0022] Picture 1 Overexpression of three different promoters on M1285-7 ino1 Image showing the results of gene transformant identification.

[0023] In this invention, yeast Pichia kudriavzevii M1285-7 was deposited on March 30, 2026 at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), with accession number GDMCC No: 68014, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510070, China. Detailed Implementation

[0024] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0025] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0026] In a specific embodiment of the present invention, the shake flask seed, the tank seed, and the fermentation medium are all YPD medium, wherein the initial sugar content of the shake flask seed and tank seed medium is 50 g / L, and the initial sugar content of the fermentation medium is approximately 105-110 g / L.

[0027] YPD medium: Weigh 50 g glucose, 20 g peptone, and 10 g yeast powder, and bring the volume to 1 L with pure water. Autoclave at 115℃ for 20 min. Shake-flask seed culture: Dissolve the glycerol tube, take 100 μL of bacterial culture and spread it on a solid YPD plate (YPD medium with 2% agar added), and incubate at 30℃ for 24 h; inoculate the cultured cells into a 500 mL Erlenmeyer flask containing 100 mL YPD using an inoculation loop, and incubate at 30℃ and 200 rpm for 18-20 h; Seed culture in a seed tank: The cultured seed culture from shake flasks was inoculated into a 5 L seed tank at an inoculation volume of 300 mL. The tank was incubated for 10-12 h under aeration conditions of 1 L / min, rotation speed of 500 rpm, and temperature of 33℃ to allow OD to develop. 600 =20 minutes later, transfer to a fermentation tank; Fermentation culture: The cultured seed culture was inoculated into a 5 L fermenter with an inoculation volume of 300 mL. Fermentation culture was started under the conditions of 1 L / min aeration, 300 rpm, 33℃ temperature and pH 2.8.

[0028] The detection method for succinic acid includes high-performance liquid chromatography (HPLC). The HPLC procedure (differential detector) is as follows: column: ICSep Coregel 107H; mobile phase: 2.43 mmol / L H2SO4; flow rate: 0.5 mL / min; injection volume: 10 μL; column temperature: 45℃; detector: RID (Refractive Index Detector); analysis time: 15 min. After centrifuging the fermentation broth at 12000 rpm for 2 min, 100 μL of the supernatant was added to 900 μL of mobile phase; the mixture was filtered through a 0.22 μm filter membrane; the concentration of each substance was calculated based on the corresponding standard curve formula and the peak area of ​​each substance in the chromatogram of the fermentation broth (note that the final result should be multiplied by the dilution factor).

[0029] Single colony isolation: The domesticated strain was streaked on YPD medium to isolate single colonies for 2-3 generations, and different single colonies were verified by fermentation shake flask.

[0030] Example 1 This embodiment constructs an acid-producing genetically engineered yeast.

[0031] With yeast Pichia kudriavzevii M1285-7 was the initial strain in which endogenous genes were overexpressed. ino1 Gene (nucleic acid sequence as shown in SEQ ID NO.1).

[0032] SEQ ID NO.1:

[0033] The specific construction method is as follows: (1) Construct a donor DNA fragment for homologous recombination, the fragment including the left arm of Jen2-1 (SEQ ID NO.2) and the Psed1 promoter (SEQ ID NO.3). ino1 The Donor DNA construction process, including the gene (SEQ ID NO.1), Tgal2 terminator (SEQ ID NO.4), and Jen2-1 right arm (SEQ ID NO.5), is as follows: ① Using M1285-7 yeast genomic DNA as a template, the left and right homologous arms of Jen2-1 were amplified using primers Jen2-1-up-F / Jen2-1-up-R, Psed1-F / Psed1-R, INO-F / INO-R, Tgal2-F / Tgal2-R, and Jen2-1-down-F / Jen2-1-down-R. ino1 as well as ino1 The promoter and terminator segments used; SEQ ID NO.2 (Jen2-1 left arm): 。

[0034] SEQ ID NO.3(Psed1): acaacaatactgcttttgactccaaatagtactgtagcatgtagtgatattgtttattatatcttctactaatatattaattatgtcttctgctaacatattaattatgtcattacacctaaaacattttaagaattaatcccgttgagaaataaacaaaaagtatccctcaatactactcaattaggtaaattagcacccgttgcagccttaccattgccatggccagatgcacgataatgtatatagaaggacaaacttgcattagtaccaccaaggcaataagaacaccagccactgtagacgatctacacttacaaggggcaattgctaataagtaatggcaaataagcaataagcggcgaacaacgagatactattcatggagaaccttcggcaatacacgagagattatagcaatacacgagaaaccataagatactaagataaatcatggcaaatcatattaactattgacctctgacaaacagttatggccctttaaagaaggtaaaacgtgggaagccttgggacaggaaaaaaaaaaaaaaaccttctctctcaatgagccaacttttcattacatcatcatcatccacgatttaattggacaataggaaaatgcaaaacaaataaagctgagtaaagagcggcaaaaatatgcaaaagagacaaagatttgccaaagaggcaaagatctgcagaaatgggaaaaaaaacttcataaattgcaaaacgcgcttctatttttagtacattcgacagcggccgtgctgtttatcttttgccgcttacggaaggcgcgcgccgccggtggctgttttctggtaaagtgactcttccacggggggaagctataaaaagcgtgaaatccctcccacattttctaatcccagtggtaaccccaacttcttttctatattttttttttgctttattctttctcacttatcaacttttatcgttcatagtctctcgcttacaaactaacacaataaaa。

[0035] SEQ ID NO.4 (Tgal2): atcactttctgtcaattgtcttaattattttaatatggtatttttatttgaaatactaaagcacattttcctttccacatttaatttcttaatgaactttatttctttatgatttctagatctatatttctatttgtcaactaactagattaattttaacacttacatttcttttttaaaactatgaatcataacatgcttgatagctcttatttgttttttttttacagatcaaaaaacaccttttgtagaagtaattggtctggtttgtatgtgacattaatactattttctttggaaggccgtatacatggaactaaatattttacctaacacataaaattttatttttccaaccaaagaaaaggctgaaacggatattttcttcacgttatcgaaaaataaaagcctagttaaaattgataatgaatcctgaaacgtaatcataaatagtttagaatactagctaaatcggtatcgc。

[0036] SEQ ID NO.5 (Jen2-1 right arm): .

[0037] ② Using pUC19 plasmid as a template, the vector fragment was amplified using primers pUC19-F and pUC19-R; ③ The concentration of each fragment was measured, and after the concentration was measured, the promoter Psed1 and the gene were... ino1 The terminator Tgal2 was used to fuse fragments using primers Psed1-F / Tgal2-R, and the target band was recovered by electrophoresis gel. ④ The amplified fragments were ligated using the homologous recombinase C115 (Novizan) and transformed into DH5α competent cells. After single colonies grew, single colonies with normal morphology and size were selected, and after shaking, they were sent for sequencing. ⑤ Then amplify the Donor DNA using Jen2-1-up-F / Jen2-1-down-R, and recover the Donor DNA using electrophoresis gel. The primers are shown in Table 1.

[0038] Table 1 (2) Construct the Cas9-gRNA fusion plasmid pIO-CAS1.0-jen2-1 for editing the JEN2-1 gene.

[0039] The editing plasmid contains Cas9 and sgRNA elements; only the sgRNA sequence needs to be changed for different targets. An sgRNA sequence (SEQ ID NO.22: TTACGCATTTGGTTATTTGT) was designed for the jen2-1 target, and its editing plasmid was constructed via homologous recombination. The specific method is as follows: The plasmid was amplified using pIO-CAS1.0 (derived from CN118910116A) as a template and primers JEN-sg-F / JEN-sg-R. Phantazyme was used as the DNA polymerase, and the reaction procedure was as follows: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension for 60 s, repeated 30 times (denaturation-annealing-extension cycle), followed by a second extension at 68℃ for 7 min, and finally storage at 12℃.

[0040] After the reaction was completed, the template was digested with DpnI enzyme (37℃, 2 h), and then stored in a 4℃ refrigerator for later use.

[0041] Take 10 μL of the digestion product, transform it into DH5α competent cells, and after single colonies grow, select single colonies with normal morphology and size, shake them, and then send them for sequencing.

[0042] The Donor DNA fragment and plasmid pIO-CAS1.0-jen2-1 were simultaneously transformed into M1285-7. Specifically, a single colony of M1285-7 cultured on YPD solid medium was inoculated into YPD liquid medium and incubated overnight at 30°C and 220 rpm. Then, the bacterial culture was inoculated into 50 mL of YPD liquid medium, and the initial OD was controlled. 600 The value was 0.3. The cells were incubated at 0°C and 200 rpm until the OD reached [value missing]. 600The concentration was 1.2-1.5. Take 40 mL of bacterial culture, centrifuge to collect the bacterial cells, wash twice with sterile deionized water, and resuspend in LDST solution (1 L of solution is prepared by dissolving 182 g sorbitol, 1.21 g Tris, 1.54 g dithiothreitol, and 6.6 g lithium acetate in water and filtering through a 0.22 μM filter). Incubate at 30℃ for 30 min. After incubation, centrifuge at 5000 rpm for 3 min in a refrigerated centrifuge. Discard the supernatant and wash the bacterial cells three times with 5 mL of sterile water (5000 rpm, 3 min). After the final wash, resuspend the bacterial cells in 400 μL of sorbitol and aliquot into 1.5 mL EP tubes (80 μL / tube) to obtain competent M1285-7 cells. The edit plasmid pIO-CAS1.0-jen2-1 corresponding to the site and the corresponding Donor DNA fragment were added to competent M1285-7 cells, gently mixed, and transferred to a pre-ice-bathed electroporation cuvette, which was then placed on ice for 5 min. The electroporator was set to 1.5 kV, 200 Ω, and 25 mF, with the electroporation mode set to fungal mode, and the mixture was electroporated. 1 M pre-chilled sorbitol was added, and the mixture was transferred to a sterile 1.5 mL EP tube and incubated at 30 °C for 1.5 h. After centrifugation, part of the supernatant was discarded, and the bacterial resuspended on a disposable spreader and plated onto yeast-deficient SD-Ura solid medium for screening positive transformants.

[0043] Following the above method, different promoters were used to construct the strains, replacing the Psed1 promoter with the Ppdc1 promoter (SEQ ID NO.23) or the Padh3 promoter (SEQ ID NO.24).

[0044] SEQ ID NO.23 (Ppdc1):

[0045] SEQ ID NO.24(Padh3):

[0046] Positive transformants were obtained by screening on SD-Ura medium and identified using primers Jen2-1-yz-F / Jen2-1-yz-R. The results are as follows: Picture 1 As shown, M is the standard marker. The strain using the Psed1 promoter is named M1285-7-ino1-1 (lane 1), the strain using the Ppdc1 promoter is named M1285-7-ino1-2 (lane 2), and the strain using the Padh3 promoter is named M1285-7-ino1-3 (lane 3).

[0047] Example 2 This embodiment involves fermentation testing.

[0048] Fermentation experiments were conducted on M1285-7, M1285-7-ino1-1, M1285-7-ino1-2 and M1285-7-ino1-3 in 5L tanks. The fermentation experiment protocol was the same as in Example 1. Fermentation broth was collected at 0 h and 72 h for HPLC analysis.

[0049] HPLC detection method: Fermentation broth at different time points was analyzed using HPLC. Specifically, 1000 μL of fermentation broth was taken and analyzed at 12000 rpm·min. -1 Centrifuge for 2 min, collect the supernatant, dilute the supernatant 10-fold, and filter through a 0.22 μm aqueous membrane to remove impurities. Use 2.5 mM H₂SO₄ as the mobile phase, inject at a flow rate of 0.6 mL / min, maintain a column temperature of 40℃, inject 10 μL, and use a differential detector at 40℃. Differential detectors were used to analyze glucose and succinic acid.

[0050] The specific fermentation results are shown in Table 2, with different promoter overexpression... ino1 The three transformants, under controlled pH=2.8 conditions, consumed all the sugar in 72 h, and the three overexpression groups... ino1 The yield of transformants was increased compared to the starting strain M1285-7, with M1285-7-ino1-3 exhibiting the best fermentation performance, indicating that overexpression... ino1 The gene can further enhance the ability of recombinant bacteria to produce succinic acid, and further designing expression using a specific promoter can further improve the fermentation performance of the strain.

[0051] Table 2. Fermentation results of each transformant at 72 h In summary, this invention employs a novel genetic modification strategy to overexpress *Issa mesasura* in *Issa mesasura*. ino1 Genes can enhance the acid-producing capacity of strains, providing new ideas for the industrial production of Oriental Isaac yeast fermentation.

[0052] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A genetically engineered yeast, characterized in that, The genetically engineered yeast includes overexpression... ino1 The genes of Isaac yeast from the East.

2. The genetically engineered yeast according to claim 1, characterized in that, The ino1 The nucleic acid sequence of the gene includes the sequence shown in SEQ ID NO.

1.

3. The genetically engineered yeast according to claim 1 or 2, characterized in that, The ino1 The nucleic acid sequence of the gene promoter includes any one of the sequences shown in SEQ ID NO.3, SEQ ID NO.23 or SEQ ID NO.24, and the nucleic acid sequence of the terminator includes the sequence shown in SEQ ID NO.

4.

4. The method for constructing genetically engineered yeast according to any one of claims 1-3, characterized in that, The construction method includes: ino1 The gene was introduced into Isaac's orientalis for expression, resulting in genetically engineered yeast.

5. The method for constructing genetically engineered yeast according to claim 4, characterized in that, The construction method specifically includes: using the CRIPPR-Cas editing system to... ino1 The gene was inserted into the genome of *Issa mesasura* for expression.

6. The method for constructing genetically engineered yeast according to claim 5, characterized in that, The nucleic acid sequences of the donor DNA homologous arms in the CRIPPR-Cas editing system include the sequences shown in SEQ ID NO.2 and SEQ ID NO.

5.

7. The method for constructing genetically engineered yeast according to claim 5 or 6, characterized in that, The nucleic acid sequence of the sgRNA in the CRIPPR-Cas editing system includes the sequence shown in SEQ ID NO.

22.

8. The use of the genetically engineered yeast according to any one of claims 1-3 in the production of succinic acid.

9. A biological agent, characterized in that, The biological agent includes the genetically engineered yeast of claim 1.

10. A method for producing succinic acid, characterized in that, The method includes fermenting the genetically engineered yeast according to claim 1, purifying the fermentation broth to obtain succinic acid.

Images