Saccharomyces cerevisiae engineering bacteria for producing anemoside B4 and construction method and application thereof

Abstract

The present application belongs to the technical field of biotechnology, and solves the technical problem of biosynthesis of anemarrhena aspera saponin B4, and discloses a saccharomyces cerevisiae engineering bacterium for producing anemarrhena aspera saponin B4, a construction method and application thereof, and a gene modification mode of the saccharomyces cerevisiae engineering bacterium, which comprises integration of a white birch acid skeleton synthesis module, a pathway optimization module, a sugar donor synthesis module, a CYP module and a UGT module. The present application reconfigures a synthesis pathway of anemarrhena aspera saponin B4 in saccharomyces cerevisiae based on a modular synthetic biology strategy, and realizes synthesis of the complex five-ring triterpenoid saponin anti-inflammatory active compound anemarrhena aspera saponin B4 in an environmentally friendly and pollution-free manner.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to engineered Saccharomyces cerevisiae strains that produce Pulsatilla saponin B4, their construction methods, and applications. Background Technology

[0002] Pulsatilla chinensis is a perennial herbaceous plant belonging to the genus Pulsatilla of the family Ranunculaceae. Pulsatilla chinensis The dried root of *Bunge* Regel has the effects of clearing heat and detoxifying, cooling blood and stopping dysentery. Its main active ingredients are Anemoside B4 (AB4) and Anemoside B5 (Hederacoside C). Modern pharmacological studies have shown that AB4 has significant anti-inflammatory, antiviral, immunomodulatory, and antitumor pharmacological activities.

[0003] Currently, the raw material for AB4 is entirely obtained through extraction from the underground parts of perennial Pulsatilla chinensis medicinal plants, leading to a waste of above-ground resources and a heavy dependence on land resources and growth cycles. More seriously, in addition to Pulsatilla chinensis, the problem of mixed source materials and adulteration with counterfeit products is severe, resulting in unstable AB4 production and increased raw material production costs. Constructing an efficient cell factory for synthesizing Pulsatilla chinensis saponin B4 using synthetic biology methods to achieve a stable supply is fundamental to meeting clinical needs and ensuring the sustainable utilization of Pulsatilla chinensis resources.

[0004] However, to date, there have been no reports of microbial strains that produce Pulsatilla saponin B4. Summary of the Invention

[0005] The present invention addresses the technical problem of the lack of microbial strains for producing puerarin B4 in the prior art. The purpose of the present invention is to provide an engineered Saccharomyces cerevisiae strain that produces puerarin B4, its construction method and application. Based on a modular synthetic biology strategy, the synthetic pathway of puerarin B4 in Saccharomyces cerevisiae is reconstructed, realizing the synthesis of the complex pentacyclic triterpenoid saponin anti-inflammatory compound puerarin B4 in an environmentally friendly and pollution-free manner.

[0006] The first objective of this invention is to provide an engineered strain of Saccharomyces cerevisiae that produces Pulsatilla saponin B4.

[0007] To achieve the first objective, the present invention adopts the following technical solution: The engineered Saccharomyces cerevisiae strain that produces Pseudobulbus saponin B4, which is genetically modified from Saccharomyces cerevisiae, has the following characteristics 1) to 5): 1) Expressing one or more copies of codon-optimized exogenous genes from *Saccharomyces cerevisiae*: olive ( Olea europaea The gene encoding lupin alcohol cyclase, OeOEW, and rosemary ( Rosmarinus officinalisThe gene RoCYP01 encoding lupeol C-28 cytochrome P450 monooxygenase in Arabidopsis thaliana ( Arabidopsis thaliana The genes encoding cytochrome P450 reductase, ATR1 and ATR2, are present in the cytochrome P450 reductase.

[0008] 2) Express one or more copies of the gene and knock out the regulatory factors.

[0009] The copied genes include any one or both of the following: yeast endogenous genes and exogenous genes with codon optimization from Saccharomyces cerevisiae.

[0010] Yeast endogenous genes include: ScERG10 (encoding acetyl-CoA thiolytic enzyme), ScERG13 (encoding HMG-CoA synthase), ScERG12 (encoding mevalonate kinase), ScERG8 (encoding mevalonate phosphate kinase), ScERG19 (encoding mevalonate diphosphate decarboxylase), ScIDI1 (encoding isopentenyl pyrophosphate isomerase), ScERG20 (encoding farnesyl pyrophosphate synthase), ScERG9 (encoding squalene synthase), ScERG1 (encoding squalene epoxidase), and Sc... The following are one or more of the following genes: tHMG1 and ScHMG2, ScZWF1 (encoding glucose-6-phosphate dehydrogenase), ScGND1 (encoding 6-phosphate gluconate dehydrogenase), ScTAL1 (encoding transaldolase in the non-oxidative phase), ScTKL1 (encoding transketolase), ScPOS5 (encoding NADPH kinase), ScMPC1 and ScMPC3 (encoding pyruvate transporter protein), ScYHM2 (encoding citrate transporter protein), ScCTP1 (encoding citrate transporter protein), and ScPTC7 (encoding protein phosphatase).

[0011] Exogenous genes with codon optimization in Saccharomyces cerevisiae include: Rhodotorula buergerianum ( Rhodosporidium toruloides The gene encoding citrate synthase, RtCIT1, is found in Aspergillus nidulans. Aspergillus nidulans The genes encoding highly efficient citrate lyases AnACLa and AnACLb, and olive ( Olea europaea The gene encoding lupin alcohol cyclase, OeOEW, and rosemary ( Rosmarinus officinalis Any one or more of the gene RoCYP01 encoding lupeol C-28 cytochrome P450 monooxygenase.

[0012] The knockout regulatory factors include: ScROX1, a yeast endogenous oxygen-sensitive transcriptional regulator.

[0013] 3) Expression of one or more copies of yeast endogenous genes: the gene encoding glucose-phosphogluconate scPGM1, the gene encoding UDP-glucose pyrophosphorylase scUGP1, and codon-optimized exogenous genes from Saccharomyces cerevisiae: Arabidopsis thaliana ( Arabidopsis thaliana The gene encoding UDP-glucose dehydrogenase 1 (AtUGD1), UDP-glucuronide decarboxylase 3 (AtUXS3), UDP-glucose 4-epomerase 1 (AtUGE1), UDP-xylose 4-epomerase (AtUXE), and UDP-rhamnose synthase 2 (AtRHM2) are listed in the dataset.

[0014] 4) Expressing one or more copies of the exogenous gene for codon-optimized cytochrome P450 monooxygenase from Saccharomyces cerevisiae: PcCYP2, which encodes the C-23 hydroxylase of lupinane-type pentacyclic triterpenoids from Pulsatilla chinensis.

[0015] 5) Expression of one or more copies of codon-optimized exogenous glycosyltransferase genes from Saccharomyces cerevisiae: PcUGT1 and PcUGT2, which encode the C-3 glycosyltransferase, and PcUGT3, PcUGT4, and PcUGT5, which encode the C-28 glycosyltransferase.

[0016] Represented by GenBank gene numbers, OeOEW is AB025343.1, RoCYP01 is QIH97372.1, ATR1 is NM_118585.4, ATR2 is OAO96828.1, ScERG10 is 856079, ScERG13 is 854913, ScERG12 is 855248, ScERG8 is 855260, ScERG19 is 855779, ScIDI1 is 855986, ScERG20 is 853272, ScERG9 is 856597, ScERG1 is 853086, SCTHMG1 is 854900, SCTHMG2 is 851171, ScZWF1 is 855480, ScGND1 is 856589, and ScTAL... ScTKL1 is 851068, ScTKL1 is 856188, ScPOS5 is 855913, ScMPC1 is 852800, ScMPC3 is 853158, ScYHM2 is 855282, ScCTP1 is 852594, ScPTC7 is 856475, AnACLa is XM_654947.2, AnACLb is XM_654948.2, ScROX1 is 856178, ScPGM1 is 853732, ScUGP1 is 853830, AtUGD1 is OAP14742.1, AtUXS3 is OAO91769.1, AtUGE1 is NP_172738.1, AtUXE is CAA90941.1, and AtRHM2 is OAP13336.1.

[0017] The nucleotide sequence of the PcCYP2 is shown in SEQ ID NO: 1.

[0018] The nucleotide sequence of RtCIT1 is shown in SEQ ID NO: 2.

[0019] The nucleotide sequence of PcUGT1 is shown in SEQ ID NO: 3.

[0020] The nucleotide sequence of the PcUGT2 is shown in SEQ ID NO: 4.

[0021] The nucleotide sequence of the PcUGT3 is shown in SEQ ID NO: 5.

[0022] The nucleotide sequence of PcUGT4 is shown in SEQ ID NO: 6.

[0023] The nucleotide sequence of the PcUGT5 is shown in SEQ ID NO: 7.

[0024] Preferably, the starting strain is obtained by expressing the Cas9 protein in Saccharomyces cerevisiae CEN.PK113-11C and knocking out the GAL80 gene (the construction method has been disclosed in patent application with publication number CN 116333900 A).

[0025] Preferably, each gene in features 1) and 3) has one copy number.

[0026] Preferably, the copy number of each gene in feature 2) is 1 to 2.

[0027] More preferably, feature 2) includes: expressing one copy of ScERG10, ScERG13, ScERG12, ScERG8, ScERG19, ScIDI1, ScERG20, ScERG9, SCTHMG1, ScZWF1, ScGND1, ScTAL1, ScTKL1, ScPOS5, ScMPC1 and ScMPC3, ScYHM2, ScCTP1, ScPTC7, RtCIT1, AnACLa and AnACLb, expressing two copies of ScERG1, SCHMG2, OeOEW, RoCYP01, while knocking out the regulatory factor ScROX1.

[0028] More preferably, feature 2) includes: expressing one copy of ScERG1 and ScERG9, expressing one copy of ScERG20 and ScIDI1, expressing one copy of ScERG13, ScERG8, ScERG12, and ScERG19, expressing two copies of SCHMG2, and expressing one copy of SCHMG1 and ScERG10, expressing one copy of OeOEW and RoCYP01, and expressing one copy of a flexible linker peptide chain -(GGGS)3-linked OeOEW and S The fusion expression gene of cERG1 expresses 1 copy of RoCYP01, 1 copy of ScZWF1, ScGND1, ScPOS5, 1 copy of ScTAL1, ScTKL1, 1 copy of ScMPC1, ScMPC3, ScYHM2, 1 copy of RtCIT1, ScCTP1, 1 copy of the flexible linker peptide chain-(GGGS)3-linked fusion expression gene of AnACLa and AnACLb, and 1 copy of SPTC7.

[0029] Preferably, the copy number of each gene in feature 4) is 1 to 4, and the copy number of each gene in feature 5) is 2.

[0030] More preferably, feature 4) has 4 copies of each gene.

[0031] The second objective of this invention is to provide engineered Saccharomyces cerevisiae strains that produce betulinic acid, sugar donors, and 23-hydroxybetulinic acid.

[0032] To achieve the second objective, the present invention adopts the following technical solution: The engineered Saccharomyces cerevisiae that produces betulinic acid has the aforementioned characteristics 1) and 2) compared to the original Saccharomyces cerevisiae strain.

[0033] The engineered Saccharomyces cerevisiae, which is the sugar donor, has the above-mentioned characteristics 1) to 3) compared with the original Saccharomyces cerevisiae strain.

[0034] The engineered Saccharomyces cerevisiae producing 23-hydroxybetulinic acid has the characteristics 1) to 4) mentioned above compared with the original Saccharomyces cerevisiae strain.

[0035] A third objective of this invention is to provide a cytochrome P450 monooxygenase involved in the biosynthesis of Pulsatilla saponin B4.

[0036] To achieve the third objective, the present invention adopts the following technical solution: The cytochrome P450 monooxygenase involved in the biosynthesis of Pulsatilla saponin B4 is composed of the exogenous gene PcCYP2.

[0037] The exogenous gene PcCYP2 of cytochrome P450 monooxygenase can synthesize 23-hydroxybetulinic acid using betulinic acid as a substrate.

[0038] The fourth objective of this invention is to provide a method for constructing engineered Saccharomyces cerevisiae strains that produce betulinic acid, sugar donors, 23-hydroxybetulinic acid, or Pulsatilla saponin B4.

[0039] To achieve the fourth objective, the present invention adopts the following technical solution: A method for constructing engineered Saccharomyces cerevisiae strains that produce betulinic acid, sugar donors, 23-hydroxybetulinic acid, or strychnine B4, comprising integrating at least two of the following modules: betulinic acid backbone synthesis module, pathway optimization module, sugar donor synthesis module, CYP module, and UGT module.

[0040] The betulinic acid backbone synthesis module includes expressing the gene in characteristic 1) on the starting strain of *Saccharomyces cerevisiae* to construct a primary cell factory for betulinic acid; the pathway optimization module includes expressing the gene in characteristic 2) on the primary cell factory for betulinic acid and knocking out the regulatory factor in characteristic 2) to construct an engineered strain of *Saccharomyces cerevisiae* that produces betulinic acid; the sugar donor synthesis module includes expressing the gene in characteristic 3) on the engineered strain of *Saccharomyces cerevisiae* that produces betulinic acid to construct an engineered strain of *Saccharomyces cerevisiae* that produces sugar donors; the CYP module includes expressing the gene in characteristic 4) on the engineered strain of *Saccharomyces cerevisiae* that produces sugar donors to construct an engineered strain of *Saccharomyces cerevisiae* that produces 23-hydroxybetulinic acid; the UGT module includes expressing the gene in characteristic 5) on the engineered strain of *Saccharomyces cerevisiae* that produces 23-hydroxybetulinic acid to construct an engineered strain of *Saccharomyces cerevisiae* that produces strychnine saponin B4.

[0041] Preferably, the method for constructing engineered Saccharomyces cerevisiae strains that produce betulinic acid, sugar donors, 23-hydroxybetulinic acid, or strychnine saponin B4 specifically includes at least two of the following steps: (1) Integrating the betulinic acid backbone synthesis module: expressing the gene in feature 1) on the starting strain of Saccharomyces cerevisiae to construct a primary cell factory for betulinic acid; (2) Integrating the betulinic acid backbone synthesis module and pathway optimization module: expressing the gene in feature 2) on the betulinic acid primary cell factory obtained in step (1) to construct a betulinic acid-producing Saccharomyces cerevisiae engineered strain; (3) Integrate the betulinic acid backbone synthesis module, pathway optimization module, and sugar donor synthesis module: construct a sugar donor-producing Saccharomyces cerevisiae engineered strain by using the genes in feature 3) on the betulinic acid-producing Saccharomyces cerevisiae engineered strain obtained in step (2); (4) Integrate the betulinic acid backbone synthesis module, pathway optimization module, sugar donor synthesis module, and CYP module: express the gene in characteristic 4) on the Sacchariformis engineered strain that produces sugar donor in step (3) to construct an Sacchariformis engineered strain that produces 23-hydroxybetulinic acid; (5) Integrate the betulinic acid backbone synthesis module, pathway optimization module, sugar donor synthesis module, CYP module and UGT module: express the gene in feature 5) on the 23-hydroxybetulinic acid-producing Saccharomyces cerevisiae engineered strain obtained in step (4) to construct an Saccharomyces cerevisiae engineered strain that produces Pulsatilla saponin B4.

[0042] More preferably, the method for constructing engineered Saccharomyces cerevisiae strains that produce betulinic acid, sugar donors, 23-hydroxybetulinic acid, or strychnine saponin B4 includes at least two of the following steps: (1) Integration of betulinic acid backbone synthesis module: One copy of ATR1, ATR2, OeOEW, and RoCYP01 were expressed in the starting strain of Saccharomyces cerevisiae to construct the betulinic acid primary cell factory HX2; (2) Integrating the betulinic acid backbone synthesis module and pathway optimization module: In the betulinic acid primary cell factory HX2 obtained in step (1), one copy of SciRG10, SciRG13, SciRG12, SciRG8, SciRG19, SciRG11, SciRG20, SciRG9, SciRG1, SciRG1, SciRG2, SciRG1 ... (3) Integrating the betulinic acid skeleton synthesis module, pathway optimization module, and sugar donor synthesis module: On the betulinic acid-producing Saccharomyces cerevisiae engineered strain HX113 obtained in step (2), express one copy of ScPGM1 and ScUGP1 to construct the synthesis pathway of sugar donor UDP-Glc (glucose), express one copy of AtUDG1, AtUXS3, AtUGE1 and AtUXE to construct the synthesis pathway of sugar donor UDP-Ara (arabinose), express one copy of AtRHM2 to construct the synthesis pathway of sugar donor UDP-Rha (rhamnose), and construct the sugar donor-producing Saccharomyces cerevisiae engineered strain HX131; (4) Integrating the betulinic acid backbone synthesis module, pathway optimization module, sugar donor synthesis module, and CYP module: expressing 4 copies of PcCYP2 on the Saccharomyces cerevisiae engineered strain HX131 that produces sugar donors obtained in step (3) to construct the Saccharomyces cerevisiae engineered strain HX138B that produces 23-hydroxybetulinic acid; (5) Integrating the betulinic acid backbone synthesis module, pathway optimization module, sugar donor synthesis module, CYP module and UGT module: Two copies of glycosyltransferases PcUGT1, PcUGT2, PcUGT3, PcUGT4 and PcUGT5 (which can synthesize Pulsatilla saponin B4 using 23-hydroxybetulinic acid as a substrate) were expressed on the Saccharomyces cerevisiae engineered strain HX138B obtained in step (4) to construct the Saccharomyces cerevisiae engineered strain HX157A that produces Pulsatilla saponin B4.

[0043] Preferably, in step (1), the integration site of ATR1 and ATR2 is I2; the integration site of OeOEW and RoCYP01 is X2.

[0044] Preferably, in step (2), the site where ScERG1 and ScERG9 are integrated simultaneously is XI3; The site where ScERG20 and ScIDI1 are simultaneously integrated is XII1; The site where ScERG13, ScERG8, ScERG12, and ScERG19 are simultaneously integrated is XI1; The site where ScHMG2, SctHMG1, and ScERG10 are simultaneously integrated is III2; The site where OeOEW and RoCYP01 are simultaneously integrated is III1; OeOEW and ScERG1 were linked by the amino acid sequence GGGS of a flexible linker peptide chain fused with three consecutive protein groups to obtain OeOEW-(GGGS)3-ScERG1. The integration site of OeOEW-(GGGS)3-ScERG1 is V3. The RoCYP01 integration site is XI2; The site where ScZWF1, ScGND1, and ScPOS5 are simultaneously integrated is XII2; The site where ScTAL1 and ScTKL1 are simultaneously integrated is IX2; The site where ScMPC3, ScMPC1, and ScYHM2 are simultaneously integrated is XV3; The site where ScCTP1 and RtCIT1 are simultaneously integrated is X3; AnACLb and AnACLa were linked by the amino acid sequence GGGS of a flexible linker peptide chain fused with three consecutive protein groups to obtain AnACLb-(GGGS)3-AnACLa. The integration site of AnACLb-(GGGS)3-AnACLa is IV5. The ScPTC7 integration site is VII-4.

[0045] Preferably, in step (3), the site where ScPGM1, ScUGP1, and AtRHM2 are simultaneously integrated is II1; The site where AtUGD1, AtUXE, AtUGE1, and AtUXS3 are simultaneously integrated is XII5.

[0046] Preferably, in step (4), the sites of PcCYP2 integration are XII3 and IX1.

[0047] Preferably, in step (5), the site where PcUGT1 is integrated is XII4; The integration site of PcUGT2 is VI1; The integration site of PcUGT3 is XI7; The integration site of PcUGT4 is VI3; The site of PcUGT5 integration is XI8.

[0048] The fifth objective of this invention is to provide the application of engineered Saccharomyces cerevisiae strains that produce Pulsatilla saponin B4 in the production of Pulsatilla saponin B4.

[0049] The sixth objective of this invention is to provide the application of engineered Saccharomyces cerevisiae that produces betulinic acid in the production of betulinic acid.

[0050] The seventh objective of this invention is to provide the application of engineered Saccharomyces cerevisiae, a sugar donor, in the production of sugar donors UDP-Glc (glucose), UDP-Ara (arabinose), and UDP-Rha (rhamnose).

[0051] The eighth object of the present invention is to provide the application of engineered Saccharomyces cerevisiae that produces 23-hydroxybetulinic acid in the production of 23-hydroxybetulinic acid.

[0052] The ninth object of the present invention is to provide a method for producing betulinic acid, 23-hydroxybetulinic acid, a sugar donor, or pulsatilla saponin B4, comprising at least one of the following steps: A. In a culture medium with 10-20 g / L glucose as the carbon source, inoculate the engineered Saccharomyces cerevisiae that produces betulinic acid, carry out fermentation, and extract the fermentation product to obtain betulinic acid.

[0053] B. In a culture medium with 10-20 g / L glucose as the carbon source, inoculate the engineered Saccharomyces cerevisiae that produces 23-hydroxybetulinic acid, carry out fermentation, and extract the fermentation product to obtain 23-hydroxybetulinic acid.

[0054] C. In a culture medium with 10-20 g / L glucose as the carbon source, inoculate the engineered Saccharomyces cerevisiae containing the sugar donors, carry out fermentation, and extract the fermentation products to obtain the sugar donors UDP-Glc, UDP-Ara, and UDP-Rha.

[0055] D. In a culture medium with 10-20 g / L glucose as the carbon source, inoculate the engineered Saccharomyces cerevisiae that produces Pulsatilla saponin B4, carry out fermentation, and extract the fermentation product to obtain Pulsatilla saponin B4.

[0056] Preferably, in steps A, B, C, and D, the initial inoculation OD of the engineered Saccharomyces cerevisiae producing betulinic acid, the engineered Saccharomyces cerevisiae producing 23-hydroxybetulinic acid, the engineered Saccharomyces cerevisiae producing sugar donors, and the engineered Saccharomyces cerevisiae producing anesthetic saponin B4 is... 600 It is 0.05~0.5.

[0057] Preferably, in steps A, B, C, and D, the fermentation conditions include: temperature 28~30℃, rotation speed 220~280rpm, time 72~120 h, and liquid volume (15~20) mL / 100 mL conical flask.

[0058] Preferably, in steps A, B, C, and D, the method for extracting the fermentation product includes extraction using any one or a mixture of several of methanol, ethanol, acetonitrile, and water in any proportion.

[0059] Technical effects of the present invention: 1. This invention utilizes microorganisms to synthesize strychnine B4. Compared with traditional plant extraction and chemical synthesis, it is not limited by geographical or climatic conditions, and overcomes the technical challenges of unknown pathways and low modification efficiency in the heterologous synthesis of complex natural products over long routes. This invention achieves de novo heterologous total synthesis of strychnine B4. The engineered Saccharomyces cerevisiae strain for producing strychnine B4 constructed in this invention can efficiently and stably produce the anti-inflammatory active ingredient strychnine B4, providing a strong research and application foundation for the subsequent large-scale biosynthesis of strychnine B4.

[0060] 2. This invention provides a cytochrome P450 monooxygenase, PcCYP2, for the biosynthesis of Pulsatilla saponins, capable of synthesizing 23-hydroxybetulinic acid using betulinic acid as a substrate; and glycosyltransferases, PcUGT1, PcUGT2, PcUGT3, PcUGT4, and PcUGT5, which synthesize Pulsatilla saponin B4 using 23-hydroxybetulinic acid as a substrate. The cytochrome P450 monooxygenase PcCYP2 and glycosyltransferases of this invention provide an efficient biosynthetic method for Pulsatilla saponin B4 and lay the foundation for the artificial synthesis of Pulsatilla saponins and their derivatives.

[0061] 3. This invention also constructed an engineered Saccharomyces cerevisiae strain that produces betulinic acid, 23-hydroxybetulinic acid, and sugar donors, and achieved the microbial synthesis of betulinic acid, 23-hydroxybetulinic acid, and sugar donors UDP-Glc, UDP-Ara, and UDP-Rha. Attached Figure Description

[0062] Figure 1 This is a schematic diagram of the biosynthesis pathway of Pulsatilla saponin B4 in engineered Saccharomyces cerevisiae according to the present invention; Figure 2 PCR images of strain HX2 transformed into RoCYP01 and OeOEW; Figure 3 PCR bacterial detection image of strain HX113 with ScROX1 knocked out; Figure 4 PCR images of strain HX131 transformed into AtUGD1, AtUXE, AtUGE1, and AtUXS3; Figure 5 PCR bacterial detection image of strain HX138B transformed into PcCYP2; Figure 6This is a graph showing the yield of 23-hydroxybetulinic acid from the CYP module of this invention. Figure 7 This is a PCR image of strain HX157A transformed into PcUGT5. Figure 8 The above is the synthetic pathway of pulmonar saponin B4 of the UGT module of this invention (top) and the liquid chromatogram (bottom) (★ and gray bands represent the chromatographic peak of pulmonar saponin B4, ▲ and gray bands represent the chromatographic peak of 23-hydroxybetulinic acid). Figure 9 The mass spectra of the synthesized Pulsatilla saponin B4 and the standard are compared. Detailed Implementation

[0063] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0064] Unless otherwise specified in the following examples, the implementation conditions are generally those in routine experiments or those recommended in the manufacturer's instructions, and the raw materials are all commercially available or prepared by conventional methods in the art.

[0065] The PCR amplification methods, fusion methods of different fragments, gene knockout and overexpression methods used in the following examples can employ common techniques in the art, such as fusion PCR, homologous recombination, and CRISPR-Cas9 technology.

[0066] The starting strain in the following examples was obtained by expressing the Cas9 protein and knocking out the GAL80 gene in Saccharomyces cerevisiae CEN.PK113-11C (the construction method and specific strain have been disclosed in patent application CN 116333900 A). In this invention, the starting strain is named CEN.PK113-11C*, which is the same as strain A0 in patent application CN 116333900 A.

[0067] Among them, the brewing yeast CEN.PK113-11C comes from Euroscarf (Oberursel, Germany) (MATaMAL2-8c SUC2 his3Δ1ura3-52).

[0068] The enzymes involved in the synthesis pathway, whether plant- or microbial-derived, can be obtained by finding the corresponding amino acid or gene sequences through the National Center for Biotechnology Information (NCBI) in the United States. Alternatively, the sequences can be obtained by cloning and sequencing plant cDNA, and finally, a gene synthesis company can be commissioned to optimize and fully synthesize the Saccharomyces cerevisiae source.

[0069] In this invention, all exogenous genes are codon-optimized exogenous genes from Saccharomyces cerevisiae.

[0070] The gene names (first letter of species origin + gene), origins and gene numbers (or sequence numbers) involved in this invention are shown in Table 1 below.

[0071] Table 1 Gene Information

[0072] Note: For the gene RtCIT1, please refer to reference 1 (Yu T et al., Reprogramming Yeast Metabolism from Alcoholic Fermentation to Lipogenesis[J], Cell, 2018, 174(6), 1549–1558.). For the gene AtUXE, please refer to reference 2 (Liu Y et al., Complete biosynthesis of QS-21 in engineered yeast[J], Nature, 2024, 629(8013), 937–944.).

[0073] Example 1: Cloning of the PcCYP2 gene Fresh *Pulsatilla chinensis* plant samples were collected, washed, and flash-frozen in liquid nitrogen. Total RNA was extracted from the aboveground and underground parts of *Pulsatilla chinensis* using the Trizol method. cDNA was obtained by reverse transcription using a one-step gDNA and first-strand cDNA removal and first-strand cDNA synthesis reverse transcription kit (Beijing TransGen Biotech). PCR amplification of the target gene (PcCYP2) was performed using Takara high-fidelity enzyme and / or Novizan high-fidelity enzyme.

[0074] Primers for amplifying the target gene were designed based on the upstream, downstream, and nearby UTR regions of the full-length open reading frame (ORF). The specific primer sequences are as follows: PcCYP2-F (forward primer): ATGGAAATGATCGCAAAAGCAATACTC (SEQ ID NO: 8); PcCYP2-R (reverse primer): TCAGAGCTTGTGCAACACAATCTG (SEQ ID NO: 9).

[0075] The primers mentioned above were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0076] The obtained cDNA was used as a template for amplification using the aforementioned forward and reverse primers. A specific band appeared at 1.5 kb on agarose gel electrophoresis of the amplified product. The target band was excised and recovered from the gel. The recovered product was ligated into a TA cloning and blunt-end cloning kit (Novizan), and subsequently transformed into *E. coli* DH5α. Positive clones were selected for sequencing (Sangon Biotech (Shanghai) Co., Ltd.). The PcCYP2 gene clone with the correct sequence was selected and preserved, thus obtaining the cytochrome P450 monooxygenase gene PcCYP2, which is involved in the synthesis pathway of Pseudobulbus saponin B4. This gene was then used for the construction of subsequent expression vectors. Sequencing results showed that the full-length open reading frame (ORF) of PcCYP2 is 1551 bp in length, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0077] Example 2: Construction, optimization, and functional verification of strains producing Pulsatilla saponin B4 Using gene editing tools and metabolic engineering techniques, a cell factory for the synthesis of strychnine B4 was constructed in Saccharomyces cerevisiae. The specific synthetic pathway is detailed in [link to relevant documentation]. Figure 1 .

[0078] This invention uses CEN.PK113-11C* as the starting strain of Saccharomyces cerevisiae, and transforms yeast using lithium acetate chemical transformation through a series of donor DNA fragments and corresponding sgRNA plasmid expression vectors for gene editing and strain modification.

[0079] All sgRNA plasmid expression vectors used in this invention are identical except for a 20bp target sequence. The specific construction method (refer to patent applications with publication numbers CN 116333900 A or CN 116262930 A) includes: first, amplifying the vector backbone S1 from the pgRNA-GAL80 plasmid using primer 6005; then, amplifying sgRNA-1 and sgRNA-2 respectively for editing and inserting foreign genes targeting yeast genomic sites, wherein sgRNA-1 uses primers p1 and pX1, and sgRNA-2 uses primers p2 and pX2, wherein pX1 integrates a replaceable 20bp target sequence M. 20 pX2 integrates a replaceable 20bp targeting sequence N 20 Finally, the sgRNA-1 and sgRNA-2 fragments and the vector backbone S1 fragment were cloned and ligated using the Gibson Assembly method. The recombinant vector was then applied after sequencing was completely accurate.

[0080] In this invention, the primers 6005, pgRNA-GAL80 plasmid, primers p1 and pX1, and primers p2 and pX2 involved in the construction of the sgRNA plasmid expression vector are identical to those in patent applications with publication numbers CN 116333900 A or CN 116262930 A. The only difference is the replaceable 20bp target sequence in primers pX1 and pX2. The vector names and replaceable 20bp target sequences M of a series of sgRNA expression vectors are also described. 20 N 20 See Table 2.

[0081] For the donor DNA, 500bp sequences upstream and downstream of the sgRNA vector target site were amplified as homologous arms. Then, expression cassettes carrying promoters, target genes, and terminators were assembled between the homologous arms by fusion PCR to obtain donor DNA fragments containing promoters, target genes, terminators, and upstream and downstream homologous recombination sequences.

[0082] Table 2 Carrier Information

[0083] The biosynthesis of Pulsatilla saponin B4 can be divided into a betulinic acid backbone synthesis module, a pathway optimization module, a sugar donor synthesis module, a betulinic acid C-23 hydroxylation module encoded by the CYP gene (referred to as the CYP module), and a glycosylation module encoded by the UGT gene (referred to as the UGT module). Using glucose as the carbon source and combining metabolic engineering techniques, highly efficient heterologous synthesis of Pulsatilla saponin B4 was effectively achieved. The integration (targeting) sites of the target gene in the strain, as well as the sgRNA expression vector and donor DNA information in the different modules of this invention, are shown in Table 3. The sequences of the promoters and terminators involved in Table 3 are shown in Table 4.

[0084] Table 3. Integration sites, sgRNA expression vectors, and donor DNA information for different modules.

[0085] Table 3 (Continued) Integration sites, sgRNA expression vectors, and donor DNA information for different modules

[0086] Note: "+" indicates that multiple genes are expressed in a single experiment; "-(GGGS)3-" indicates that the amino acid sequence of the flexible linker peptide chain of the protein fusion is three consecutive groups of GGGS (G for glycine, S for serine). "Δ" indicates that the corresponding gene was expressed twice. "Δ" indicates that the gene was knocked out. The number of times a gene appears in the Donor information represents its copy number. If the same site appears more than once, it means that the experiment was parallel.

[0087] Table 4. Sequences of promoters and terminators

[0088] 1. Betulinic acid skeleton synthesis module The betulinic acid skeletal synthesis module includes a biosynthetic pathway from 2,3-squalene oxide to betulinic acid.

[0089] (1) Construction of betulinic acid primary cell factory Referring to Tables 3 and 4, using CEN.PK113-11C* as the starting strain, 500 ng of sgRNA plasmid expression vector and 500 ng of Donor fragment were transformed using the lithium acetate chemical transformation method according to the following transformation method to obtain yeast strains HX1 and HX2, respectively.

[0090] The PCR results of strain HX2 during the final gene transformation (transformation into RoCYP01 and OeOEW) are shown below. Figure 2 Prove that the donor (T) PRM9 -RoCYP01-P GAL10 / 1 -OeOEW-T ENO2 The corresponding X2 site has been successfully inserted, and the genome integration is correct.

[0091] (2) Specific conversion methods ① Select the starting strain of Saccharomyces cerevisiae (CEN.PK113-11C*) and clone it into 3 mL of yeast extract peptone glucose medium (YPD medium), and incubate overnight at 30℃ and 220 rpm for 16 h.

[0092] ② The overnight cultured seed culture was inoculated into a 100 mL shake flask containing 20 mL of YPD medium. The initial OD of the culture was... 600 =0.1~0.2, incubate at 30℃ in a constant temperature shaker at 220 rpm for 4~6 h to allow the bacterial culture OD to reach a certain level. 600 It reaches 0.6~1.0.

[0093] ③ Transfer the bacterial culture to a 50 mL sterile centrifuge tube, centrifuge at 2000 g at room temperature for 5 min, discard the supernatant, collect the bacterial cells, add 1 mL of pre-chilled LiAc solution (0.1 M) to resuspend and wash the cells, and transfer to a 2 mL sterile centrifuge tube. Centrifuge at 2000 g at room temperature for 2 min, discard the supernatant, collect the cells, resuspend in 200 μL of pre-chilled LiAc (0.1 M), place on ice to obtain competent cells for later use.

[0094] ④ Prepare the transformation solution system according to Table 5. Mix the sgRNA plasmid expression vector, Donor fragment and sterile water for each transformation system to a total volume of 37 μL. Then add 143 μL of a mixture of polyethylene glycol 3500 (PEG3500), 1.0 M LiAc and salmon sperm DNA (Beijing Solarbio Science & Technology Co., Ltd., ssDNA) (pre-denatured at 100℃ for 5 min before use, then immediately placed on ice for 10 min). Finally, add 25 μL of competent cells and gently aspirate to mix.

[0095] ⑤ Place the conversion system in a preheated 30℃ water bath for 30 min, then transfer it to a preheated 42℃ water bath for heat shock for 15 min, and immediately place it on ice for 2 min after the heat shock.

[0096] ⑥ Screening of auxotrophic yeast transformants: Centrifuge the transformation system at 2000 g for 2 min, remove the supernatant and collect the cells, wash once with 500 μL of sterile water, centrifuge again at 2000 g for 2 min, remove the supernatant and collect the cells, resuspend the cells in 100-200 μL of sterile water and plate them on SD plates supplemented with histidine (His) (20 g / L glucose, 6.7 g / L amino acid-free yeast nitrogen source (YNB) medium, supplemented with 0.02 g / L histidine).

[0097] ⑦ Invert the container and incubate at 30℃ for 2-4 days until yeast transformants appear.

[0098] ⑧ Take 4 single-clone yeast transformants and put them into SD liquid medium supplemented with histidine. Incubate for 12-16 h, take 100-200 μL of culture medium for genome extraction, and perform PCR detection on the colonies.

[0099] Table 5. Preparation of Conversion Fluid System

[0100] (3) Experiment on the production of betulinic acid Fermentation was carried out in a basic culture medium with 20 g / L glucose as the carbon source (ammonium sulfate 2.5 g / L, potassium dihydrogen phosphate 14.4 g / L, magnesium sulfate heptahydrate 0.5 g / L, histidine 0.04 g / L, uracil 0.06 g / L, vitamin solution 1 mL, trace metal solution 2 mL, the vitamin and trace metal solutions were prepared according to the method disclosed in patent application CN 116333900 A), and strains CEN.PK113-11C*, HX1, and HX2 were inoculated respectively. 600The concentration was 0.1. Fermentation conditions: 20 mL / 100 mL Erlenmeyer flask, 30℃, 220 rpm, total fermentation time 96 h. After fermentation, the fermentation product was extracted and the betulinic acid yield (titer) was measured.

[0101] The specific steps for extracting fermentation products and detecting betulinic acid were as follows: 500 μL of fermentation product was taken, and 500 μL of ethyl acetate was added. The mixture was then vortexed thoroughly for 10 min. After centrifugation at 15000 g for 10 min, 150 μL of the upper ethyl acetate solution was transferred to a 1.5 mL centrifuge tube and centrifuged at room temperature for 15-20 min to evaporate the solvent. The product was then reconstituted with methanol and vortexed for another 5 min. After centrifugation at 15000 g for 10 min, the supernatant was filtered through a 0.22 μm microporous membrane to obtain the betulinic acid sample. The detection was performed using a Shimadzu LC-2030 chromatographic column (Poroshell 120EC-C18 (Agilent) chromatographic column, 3 mm × 100 mm, 2.7 μm), at a flow rate of 0.5 mL / min. Mobile phase A consisted of H₂O + 0.1% HCOOH, and mobile phase B consisted of ACN (acetonitrile) + 0.1% HCOOH. The detection wavelength was 205 nm. The mobile phase gradient, expressed as the volume percentage change of mobile phase A at different elution times, is as follows: 80%A~80%A (0~3 min), 80%A~60%A (3~5 min), 60%A~30%A (5~7 min), 30%A~23%A (7~8 min), 23%A~23%A (8~15 min), 5%A~5%A (15.01~16 min), and 5%A~80%A (16~18 min).

[0102] The results are shown in Table 6. It can be seen that only yeast strain HX2 can produce betulinic acid, therefore strain HX2 is the primary cell factory for betulinic acid.

[0103] Table 6. Betulinic acid production status of the betulinic acid skeleton synthesis module.

[0104] Note: "+" indicates the copy number of the gene in the corresponding strain, and "\" indicates that there are no gene copies in the corresponding strain.

[0105] 2. Path Optimization Module The pathway optimization module includes optimizing the biosynthetic pathway from 2,3-squalene oxide to betulinic acid.

[0106] (1) Construction of engineered Saccharomyces cerevisiae producing betulinic acid Using HX2 as the primary cell factory for betulinic acid, the corresponding genes were sequentially introduced according to the gene expression status listed in Table 7 and the aforementioned betulinic acid backbone synthesis module transformation method. The sgRNA vector and Donor were selected according to Table 3, and betulinic acid-producing Saccharomyces cerevisiae engineered strains HX8, HX11A, HX28C, HX65, HX71B, HX89G, HX102, and HX113 were obtained respectively.

[0107] The PCR bacterial detection results of HX113 during the final gene transformation step (ScROX1 knockout) are shown below. Figure 3 This proves that the donor Donor (ScROX1Δ) has been successfully inserted into the corresponding ScROX1 site, and the genome integration is correct.

[0108] (2) Experiment on the production of betulinic acid Strains HX2, HX8, HX11A, HX28C, HX65, HX71B, HX89G, HX102, and HX113 were fermented respectively. After fermentation, the fermentation products were extracted and the betulinic acid yield (titer) was detected. The steps were the same as those in the betulinic acid skeleton synthesis module.

[0109] The results are shown in Table 7. Different strains were able to produce betulinic acid to varying degrees, with strain HX113 showing the highest betulinic acid yield.

[0110] Table 7. Betulinic acid production status of the pathway optimization module.

[0111] Note: "-(GGGS)3-" indicates that the amino acid sequence of the flexible linker peptide chain in protein fusion is three consecutive GGGS groups (G for glycine and S for serine). "Δ" indicates that the corresponding gene is expressed twice, "Δ" indicates that the gene is knocked out, "+" indicates the number of gene copies in the corresponding strain, and "\" indicates that there are no gene copies in the corresponding strain.

[0112] 3. Sugar donor synthesis module The sugar donor synthesis module includes constructing a biosynthetic pathway for sugar donors (UDP-glucose donor, UDP-arabinose donor, and UDP-rhamnose donor) based on the engineered Saccharomyces cerevisiae strain HX113, which produces betulinic acid.

[0113] (1) Construction of engineered Saccharomyces cerevisiae as sugar donor In the chassis of the betulinic acid-producing Saccharomyces cerevisiae engineered strain HX113, sugar donor synthesis genes ScPGM1, ScUGP1, AtUGD1, AtUXS3, AtUGE1, AtUXE and AtRHM2 were sequentially introduced into the betulinic acid backbone synthesis module according to the aforementioned transformation method. The sgRNA vector and Donor were selected according to Table 3 to construct the sugar donor-producing Saccharomyces cerevisiae engineered strain HX131.

[0114] The PCR results of HX131 during the final gene transformation step (transformation into AtUGD1, AtUXE, AtUGE1, and AtUXS3) are shown below. Figure 4 Prove that the donor is Donor[(T)] PRM9 -AtUGD1-P GAL10 / 1 -AtUXE-T HIS3 )+(T PRM9 -AtUGE1-P GAL10 / 1 -AtUXS3-T DIT1 The corresponding XII5 site has been successfully inserted, and the genome integration is correct.

[0115] In this context, the donor, being a complete DNA fragment, only needs to be verified to confirm the successful insertion of all genes in the donor into the corresponding site during PCR verification of three or more genes. For example, verifying the target gene directly linked upstream or downstream of the insertion site is sufficient to demonstrate that all genes in the donor have been successfully inserted into the corresponding site. Figure 4 In this case, it is only necessary to verify AtUGD1 and AtUXS3, which are directly connected to the upstream or downstream of the site.

[0116] 4. CYP module The CYP module includes a biosynthetic pathway from betulinic acid to 23-hydroxybetulinic acid, based on the betulinic acid and sugar donor-producing strain HX131.

[0117] (1) Construction of engineered Saccharomyces cerevisiae producing 23-hydroxybetulinic acid To screen the copy number of the target gene PcCYP2 expressed in Saccharomyces cerevisiae, according to the gene expression status, Donor information, and the aforementioned betulinic acid backbone synthesis module transformation method listed in Table 8, 1, 2, 3, and 4 copies of the target gene PcCYP2 were transformed into strain HX131 (sgRNA vector and Donor were selected according to Table 3), resulting in strains HX136A, HX136B, HX138A, and HX138B, respectively.

[0118] The PCR bacterial detection results of HX138B during the final gene transformation (transformation into PcCYP2) are shown below. Figure 5 Prove that the donor (T) PRM9 -PcCYP2-P GAL10 / 1-PcCYP2-T SPG5 The corresponding IX1 site has been successfully inserted, and the genome integration is correct.

[0119] (2) Experiment on the production of 23-hydroxybetulinic acid Strains HX131, HX136A, HX136B, HX138A, and HX138B were fermented separately. After fermentation, the fermentation products were extracted and the yields (titers) of betulinic acid and 23-hydroxybetulinic acid were measured. The steps were the same as those in the betulinic acid skeleton synthesis module.

[0120] The results are shown in Table 8 and Figure 6 Compared with HX131, strains transformed with PcCYP2 of different copy numbers were able to achieve the conversion of betulinic acid to 23-hydroxybetulinic acid to varying degrees. Among them, strain HX138B had a higher yield of 23-hydroxybetulinic acid when the PcCYP2 copy number was 4.

[0121] Table 8. Production status of betulinic acid and 23-hydroxybetulinic acid in the CYP module.

[0122] Note: "+" in the table indicates the copy number of the gene in the corresponding strain, and "\" indicates that there are no gene copies in the corresponding strain.

[0123] 5. UGT module The UGT module includes a biosynthetic pathway from 23-hydroxybetulinic acid to Pulsatilla saponin B4, based on strain HX138B which produces 23-hydroxybetulinic acid and sugar donors.

[0124] (1) Construction of engineered Saccharomyces cerevisiae producing Pulsatilla saponin B4 Based on HX138B, two copies of the exogenous glycosyltransferase genes PcUGT1, PcUGT2, PcUGT3, PcUGT4, and PcUGT5 were transformed using the aforementioned betulinic acid backbone synthesis module transformation method. The sgRNA vector and Donor were selected according to Table 3 to obtain strain HX157A.

[0125] The PCR bacterial detection results of HX157A during the final gene transformation (transformation into PcUGT5) are shown below. Figure 7 Prove that the donor (T) DIT1 -PcUGT5-P GAL10 / 1 - PcUGT5-T PRM9 The corresponding IX8 site has been successfully inserted, and the genome integration is correct.

[0126] (2) Experiment on the production of Pulsatilla saponin B4 Strains HX138B and HX157A were fermented separately, following the same fermentation steps as the betulinic acid skeleton synthesis module.

[0127] After fermentation, the fermentation product was extracted and the yield (titer) of Pulsatilla saponin B4 was measured. The steps were as follows: Take 0.2 mL of 1 mm diameter glass beads into a 2 mL EP tube, add 0.5 mL of fermentation culture (i.e., the above fermentation product) + 0.5 mL of methanol (HPLC grade), vortex thoroughly at 1600 rpm for 10 min, centrifuge at 15000 g for 10 min, and take the supernatant for direct HPLC and LC-MS detection. The titer of Pulsatilla saponin B4 is shown in Table 9, and the HPLC detection results are shown in [Table 9]. Figure 8 The mass spectrometry identification results are shown below. Figure 9 .

[0128] The results showed that when the copy numbers of PcUGT1, PcUGT2, PcUGT3, PcUGT4, and PcUGT5 were 2, the yield of Pulsatilla saponin B4 in strain HX157A was relatively high.

[0129] Table 9 Production of Pulsatilla saponin B4 in the UGT module

[0130] Note: "+" in the table indicates the copy number of the gene in the corresponding strain, and "\" indicates that there are no gene copies in the corresponding strain.

[0131] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An engineered strain of *Saccharomyces cerevisiae* that produces anesthetic saponin B4, characterized in that: The starting strain was obtained by expressing the Cas9 protein and knocking out the GAL80 gene in *Saccharomyces cerevisiae* CEN.PK113-11C. Compared with the starting strain, the engineered *Saccharomyces cerevisiae* strain has the following characteristics 1) to 5): 1) Expressing one or more copies of the exogenous genes ATR1, ATR2, OeOEW, and RoCYP01; 2) Express one or more copies of the gene and knock out the regulatory factor ScROX1; The copied genes include: yeast endogenous genes ScERG10, ScERG13, ScERG12, ScERG8, ScERG19, ScIDI1, ScERG20, ScERG9, ScERG1, SctHMG1, ScHMG2, ScZWF1, ScGND1, ScTAL1, ScTKL1, ScPOS5, ScMPC1, ScMPC3, ScYHM2, ScCTP1 and ScPTC7, and exogenous genes RtCIT1, AnACLa, AnACLb, OeOEW and RoCYP01; 3) Expressing one or more copies of the yeast endogenous genes ScPGM1, ScUGP1 and exogenous genes AtUGD1, AtUXS3, AtUGE1, AtUXE and AtRHM2; 4) Expressing one or more copies of the exogenous gene PcCYP2, a cytochrome P450 monooxygenase; 5) Expressing one or more copies of the exogenous glycosyltransferase genes PcUGT1, PcUGT2, PcUGT3, PcUGT4, and PcUGT5; Represented by GenBank gene numbers, OeOEW is AB025343.1, RoCYP01 is QIH97372.1, ATR1 is NM_118585.4, ATR2 is OAO96828.1, ScERG10 is 856079, ScERG13 is 854913, ScERG12 is 855248, ScERG8 is 855260, ScERG19 is 855779, ScIDI1 is 855986, ScERG20 is 853272, ScERG9 is 856597, ScERG1 is 853086, SCTHMG1 is 854900, SCTHMG2 is 851171, ScZWF1 is 855480, ScGND1 is 856589, and ScTAL... 1 is 851068, ScTKL1 is 856188, ScPOS5 is 855913, ScMPC1 is 852800, ScMPC3 is 853158, ScYHM2 is 855282, ScCTP1 is 852594, ScPTC7 is 856475, AnACLa is XM_654947.2, AnACLb is XM_654948.2, ScROX1 is 856178, ScPGM1 is 853732, ScUGP1 is 853830, AtUGD1 is OAP14742.1, AtUXS3 is OAO91769.1, AtUGE1 is NP_172738.1, AtUXE is CAA90941.1, AtRHM2 is OAP13336.1; The nucleotide sequence of the PcCYP2 is shown in SEQ ID NO: 1; The nucleotide sequence of RtCIT1 is shown in SEQ ID NO: 2; The nucleotide sequence of PcUGT1 is shown in SEQ ID NO: 3; The nucleotide sequence of the PcUGT2 is shown in SEQ ID NO: 4; The nucleotide sequence of the PcUGT3 is shown in SEQ ID NO: 5; The nucleotide sequence of the PcUGT4 is shown in SEQ ID NO: 6; The nucleotide sequence of the PcUGT5 is shown in SEQ ID NO:

7.

2. The engineered brewer's yeast strain according to claim 1, characterized in that: In features 1) and 3), each gene has 1 copy; in feature 2), each gene has 1 to 2 copies; in feature 4), each gene has 1 to 4 copies; and in feature 5), each gene has 2 copies.

3. The engineered brewer's yeast strain according to claim 1, characterized in that: The genetic modification of the engineered Saccharomyces cerevisiae includes the integration of a betulinic acid backbone synthesis module, a pathway optimization module, a sugar donor synthesis module, a CYP module, and a UGT module. The betulinic acid backbone synthesis module includes expressing the gene in characteristic 1) on the starting strain of *Saccharomyces cerevisiae* to construct a primary cell factory for betulinic acid; the pathway optimization module includes expressing the gene in characteristic 2) on the primary cell factory for betulinic acid and knocking out the regulatory factor in characteristic 2) to construct an engineered strain of *Saccharomyces cerevisiae* that produces betulinic acid; the sugar donor synthesis module includes expressing the gene in characteristic 3) on the engineered strain of *Saccharomyces cerevisiae* that produces betulinic acid to construct an engineered strain of *Saccharomyces cerevisiae* that produces sugar donors; the CYP module includes expressing the gene in characteristic 4) on the engineered strain of *Saccharomyces cerevisiae* that produces sugar donors to construct an engineered strain of *Saccharomyces cerevisiae* that produces 23-hydroxybetulinic acid; the UGT module includes expressing the gene in characteristic 5) on the engineered strain of *Saccharomyces cerevisiae* that produces 23-hydroxybetulinic acid to construct an engineered strain of *Saccharomyces cerevisiae* that produces strychnine saponin B4.

4. A *Saccharomyces cerevisiae* engineered strain producing betulinic acid, a *Saccharomyces cerevisiae* engineered strain producing a sugar donor, or a *Saccharomyces cerevisiae* engineered strain producing 23-hydroxybetulinic acid, characterized in that: Compared with the starting strain of *Saccharomyces cerevisiae*, the engineered strain of *Saccharomyces cerevisiae* producing betulinic acid has features 1) and 2) of claim 1, the engineered strain of *Saccharomyces cerevisiae* producing sugar donor has features 1) to 3) of claim 1, and the engineered strain of *Saccharomyces cerevisiae* producing 23-hydroxybetulinic acid has features 1) to 4) of claim 1.

5. A cytochrome P450 monooxygenase involved in the biosynthesis of Pulsatilla saponin B4, characterized in that: The cytochrome P450 monooxygenase is composed of the exogenous gene PcCYP2 as described in claim 1.

6. A method for constructing the engineered Saccharomyces cerevisiae according to claim 1, characterized in that: Includes the following steps: (1) Genes in characteristic 1) were expressed in the starting strain of Saccharomyces cerevisiae to construct a betulinic acid primary cell factory; (2) Express the gene in feature 2) on the betulinic acid primary cell factory obtained in step (1) to construct a betulinic acid-producing Saccharomyces cerevisiae engineered strain; (3) The betulinic acid-producing Saccharomyces cerevisiae engineered strain obtained in step (2) expresses the gene in characteristic 3) to construct a sugar-producing Saccharomyces cerevisiae engineered strain; (4) The Sacchariformis engineered strain that produces 23-hydroxybeta-lactone was constructed by expressing the gene in characteristic 4) on the sugar-producing donor obtained in step (3). (5) The gene in characteristic 5) is expressed on the Saccharomyces cerevisiae engineered strain that produces 23-hydroxybeta-lactone obtained in step (4) to construct an Saccharomyces cerevisiae engineered strain that produces Pulsatilla saponin B4.

7. The construction method according to claim 6, characterized in that: Includes the following steps: (1) One copy of ATR1, ATR2, OeOEW and RoCYP01 were expressed on the starting strain of Saccharomyces cerevisiae to construct the betulinic acid primary cell factory HX2. (2) One copy of SciERG10, SciERG13, SciERG12, SciERG8, SciERG19, SciIDI1, SciERG20, SciERG9, SciTHMG1, SciZWF1, SciGND1, SciTAL1, SciTKL1, SciPOS5, SciMPC1, SciMPC3, SciYHM2, SciCTP1, SciPTC7, RtCIT1, AnACLa and AnACLb were expressed on the betulinic acid primary cell factory HX2 obtained in step (1), and two copies of SciERG1, SciHMG2, OeOEW and RoCYP01 were expressed. At the same time, the regulatory factor SciROX1 was knocked out to construct the betulinic acid-producing Saccharomyces cerevisiae engineered strain HX113. (3) One copy of ScPGM1, ScUGP1, AtUGD1, AtUXS3, AtUGE and AtRHM2 were expressed on the betulinic acid-producing Saccharomyces cerevisiae engineered strain HX113 obtained in step (2) to construct the sugar-producing Saccharomyces cerevisiae engineered strain HX131; (4) Four copies of PcCYP2 were expressed on the engineered Saccharomyces cerevisiae HX131, the sugar-producing donor obtained in step (3), to construct the engineered Saccharomyces cerevisiae HX138B that produces 23-hydroxybetulinic acid; (5) Two copies of PcUGT1, PcUGT2, PcUGT3, PcUGT4 and PcUGT5 were expressed on the 23-hydroxybetulinic acid-producing Saccharomyces cerevisiae engineered strain HX138B obtained in step (4) to construct the Saccharomyces cerevisiae engineered strain HX157A that produces Pseudobulbus saponin B4.

8. The use of the engineered Saccharomyces cerevisiae of claim 1 in the production of Pulsatilla saponin B4, or the use of the engineered Saccharomyces cerevisiae of claim 4 in the production of betulinic acid, 23-hydroxybetulinic acid, or sugar donors UDP-Glc, UDP-Ara, UDP-Rha.

9. A method for producing betulinic acid, 23-hydroxybetulinic acid, a sugar donor, or pulsatilla saponin B4, characterized in that: Includes at least one of the following steps: A. In a culture medium with glucose as the carbon source, inoculate the engineered Saccharomyces cerevisiae that produces betulinic acid as described in claim 4, carry out fermentation, and extract the fermentation product to obtain betulinic acid. B. In a culture medium with glucose as the carbon source, inoculate the engineered Saccharomyces cerevisiae that produces 23-hydroxybetulinic acid as described in claim 4, carry out fermentation, and extract the fermentation product to obtain 23-hydroxybetulinic acid. C. In a culture medium with glucose as the carbon source, inoculate the engineered Saccharomyces cerevisiae of the sugar donors described in claim 4, carry out fermentation, and extract the fermentation products to obtain the sugar donors UDP-Glc, UDP-Ara, and UDP-Rha. D. In a culture medium with glucose as the carbon source, inoculate the engineered Saccharomyces cerevisiae that produces Pulsatilla saponin B4 as described in claim 1, carry out fermentation, and extract the fermentation product to obtain Pulsatilla saponin B4.

10. The production method according to claim 9, characterized in that: In steps A, B, C, and D, the initial inoculation OD of the engineered Saccharomyces cerevisiae producing betulinic acid, the engineered Saccharomyces cerevisiae producing 23-hydroxybetulinic acid, the engineered Saccharomyces cerevisiae producing sugar donors, and the engineered Saccharomyces cerevisiae producing anesthetic saponin B4 is... 600 It is 0.05~0.5; Fermentation conditions include: temperature 28~30℃, rotation speed 220~280 rpm, time 72~120 h, and liquid volume (15~20) mL / 100 mL; Methods for extracting fermentation products include extraction using any one or a mixture of several of methanol, ethanol, acetonitrile, and water in any proportion.

Images