Recombinant saccharomyces cerevisiae strains and their use in the production of ethanol by fermentation of raw materials

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to a recombinant Saccharomyces cerevisiae strain and its application in preparation of ethanol by raw material fermentation. The present application constructs an engineering strain capable of efficiently utilizing uncooked raw starch substrate by site-specific integration of a mutant of saccharifying enzyme from Saccharomycopsis fibuligera and a truncated alpha-amylase from Rhizopus oryzae in the genome of Saccharomyces cerevisiae. The strategy avoids the steps of high-temperature cooking and exogenous enzyme addition in traditional alcohol fermentation, and significantly reduces energy consumption and production cost. The constructed recombinant strain maintains high ethanol tolerance and fermentation stability, and exhibits excellent raw starch degradation and simultaneous saccharification and fermentation capacity. In particular, under the condition of using corn meal as substrate, the ethanol yield is significantly improved, and the contents of by-products such as residual sugar, lactic acid and glycerol are obviously reduced, which has a good industrial application prospect.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to recombinant Saccharomyces cerevisiae strains and their application in the fermentation of raw materials to produce ethanol. Background Technology

[0002] Bioethanol is a renewable energy source produced through microbial fermentation of biomass feedstocks. It has wide applications in chemical, medical, transportation, and aerospace fields. Starch-based feedstocks are widely available and inexpensive, making them the primary raw material for industrial ethanol production. Traditional processes require crushing the feedstock, high-temperature cooking to 90-110°C, and adding α-amylase and saccharifying enzymes for liquefaction and saccharification, respectively, followed by fermentation with brewer's yeast. This process is energy-intensive and costly, with high-temperature cooking and enzyme preparations accounting for 30-40% of the total cost.

[0003] Raw material fermentation technology eliminates the need for high-temperature cooking and exogenous enzyme preparations, utilizing the amylase system secreted by microorganisms to simultaneously complete saccharification and fermentation, significantly reducing energy consumption and costs. However, current raw material fermentation mainly relies on filamentous fungi such as Rhizopus and Aspergillus niger, which have low ethanol yields (typically only 4-6% v / v) and poor ethanol tolerance, making it difficult to achieve high-concentration fermentation. While Saccharomyces cerevisiae has high ethanol yields and strong tolerance, the wild type lacks the ability to hydrolyze raw starch.

[0004] Of particular note is that existing recombinant Saccharomyces cerevisiae strains are quite sensitive to the particle size of raw starch feedstocks. Corn flour used in actual industrial production has a relatively large particle size, while existing strains typically require finely ground feedstocks to achieve good fermentation results, which severely limits their industrial application. Furthermore, existing recombinant strains generally suffer from insufficient enzyme activity, weak specificity to raw starch substrates, low enzyme secretion efficiency, and poor synergistic effects between saccharifying enzymes and α-amylases, leading to unsatisfactory raw material fermentation results.

[0005] To address the aforementioned issues, some technological explorations have been undertaken. For example, some studies have utilized Rhizopus for raw material fermentation, but this resulted in low ethanol yields and poor tolerance. Another method involves introducing a single α-amylase gene into Saccharomyces cerevisiae to impart liquefaction capabilities, but due to the lack of saccharifying enzymes, exogenous addition is still required. Other studies have simultaneously introduced α-amylase and saccharifying enzyme genes, but the enzymes used have low hydrolysis efficiency on raw starch, only reducing the amount of exogenous enzymes needed and failing to completely eliminate dependence. Some literature has also attempted to improve enzyme expression levels by optimizing promoters and signal peptides, but the efficiency of amylase in reacting with raw starch remains limited, and the synergistic effect of enzymes and process conditions have not been fully optimized, making it difficult to achieve the industrial-grade ethanol concentrations required.

[0006] In summary, the existing technology lacks a recombinant brewer's yeast strain and corresponding process that can utilize large-particle corn flour to achieve high-concentration ethanol fermentation of raw materials without the addition of exogenous enzymes. Summary of the Invention

[0007] In view of this, the technical problem to be solved by the present invention is to provide a recombinant Saccharomyces cerevisiae strain and its application in the production of ethanol from raw materials through fermentation.

[0008] The recombinant Saccharomyces cerevisiae provided by this invention expresses a saccharifying enzyme mutant and / or an α-amylase truncated variant; The saccharifying enzyme mutant was derived from *Saccharomyces cerevisiae* (a type of yeast). Saccharomycopsis fibuligera ), which has S165G and / or L494I mutations relative to wild-type saccharifying yeast saccharidase; The α-amylase truncated form is derived from Rhizopus oryzae (… Rhizopus oryzae ), which is missing amino acids from the N-terminus 2 to 25 relative to wild-type Rhizopus oryzae α-amylase.

[0009] In this invention, saccharifying enzymes and α-amylases with high activity towards raw starch are screened and modified to improve the hydrolysis efficiency of the enzymes on the dense crystalline structure of raw starch. This invention also optimizes the gene integration sites and expression ratios of saccharifying enzymes and α-amylases to achieve synergistic effects of the two enzymes and improve saccharification efficiency. By expressing the modified saccharifying enzyme gene and / or α-amylase gene in the chassis cells of *Saccharomyces cerevisiae*, a recombinant *Saccharomyces cerevisiae* strain capable of efficiently secreting starch hydrolytic enzyme systems is constructed. This allows the strain to directly utilize raw corn starch raw materials that have not been cooked at high temperatures, especially large-particle raw materials, to achieve simultaneous enzyme production, liquefaction saccharification, and ethanol fermentation without the addition of exogenous enzyme preparations, thus achieving the goal of producing high-concentration ethanol.

[0010] The recombinant Saccharomyces cerevisiae of this invention can express only the saccharifying enzyme mutant, only the truncated α-amylase, or both. The saccharifying enzyme mutant and the truncated α-amylase can exist in yeast cells as free plasmids, or they can be integrated into the yeast genome, or one can be free and the other integrated, to meet the needs of different application scenarios. Free expression facilitates rapid debugging and gene manipulation, while integrated expression ensures genetic stability; both have advantages and are within the scope of protection of this invention.

[0011] In this invention, the saccharifying enzyme mutant and / or the truncated α-amylase are expressed in an integrated manner, wherein the copy number of the saccharifying enzyme mutant is 2 to 4, and the copy number of the truncated α-amylase is 1 to 2.

[0012] This invention integrates exogenous genes into the genome of *Saccharomyces cerevisiae*, which, compared to expression using free plasmids, offers the advantage of high genetic stability. No plasmid loss occurs during long-term fermentation under no-selective pressure, making it more suitable for industrial production. By integrating the target gene in multiple copies into different sites within the genome, this invention increases the gene dosage, further enhancing enzyme protein expression and extracellular enzyme activity.

[0013] This invention demonstrates that increasing the copy number enhances the extracellular saccharifying enzyme activity of recombinant Saccharomyces cerevisiae. However, excessively high copy numbers increase the metabolic burden on the yeast, inhibiting growth and ultimately reducing fermentation efficiency. In this invention, the copy number of the saccharifying enzyme mutant is controlled at 2-4, and the copy number of the truncated α-amylase is controlled at 1-2. This ensures high enzyme activity while avoiding excessive metabolic burden, achieving optimal fermentation performance.

[0014] The selection of integration sites directly affects the expression level and stability of exogenous genes. The integration sites selected in this invention are all non-essential regions or high-copy-repetition regions in the *Saccharomyces cerevisiae* genome, and integration will not affect the normal growth and metabolism of yeast. The integration site of the saccharifying enzyme mutant is selected from one or more of X-3, int12, int19, int30, int4, and int17; the integration site of the α-amylase truncated variant is X-3.

[0015] For example, if the copy number of the glucoamylase mutant is one, then its integration site is any one of X-3, int12, int19, int30, int4, or int17; If the glucoamylase mutant has two copies, then any two sites can be selected for integration, for example: X-3 and int12, X-3 and int19, X-3 and int30, X-3 and int4, X-3 and int17, int12 and int19, int12 and int30, int12 and int4, int12 and int17, int19 and int30, int19 and int4, int19 and int17, int30 and int4, int30 and int17, int4 and int17.

[0016] If the copy number of the glucoamylase mutant is three, then any three sites can be selected for integration, for example: X-3, int12 and int19; X-3, int12 and int30; X-3, int12 and int4; X-3, int12 and int17; X-3, int19 and int30; X-3, int19 and int4; X-3, int19 and int17; X-3, int30 and int4; X-3, int30 and int17; X-3, int30 and int17; X-3, int19 ... int4 and int17; int12, int19 and int30; int12, int19 and int4; int12, int19 and int17; int12, int30 and int4; int12, int30 and int17; int12, int4 and int17; int19, int30 and int4; int19, int30 and int17; int19, int4 and int17; int30, int4 and int17.

[0017] If the copy number of the glucoamylase mutant is four, then any four sites can be selected for integration, for example: X-3, int12, int19, and int30; X-3, int12, int19, and int4; X-3, int12, int19, and int17; X-3, int12, int30, and int4; X-3, int12, int30, and int17; X-3, int12, int4, and int17; X-3, int19, int30, and int17. nt4; X-3, int19, int30 and int17; X-3, int19, int4 and int17; X-3, int30, int4 and int17; int12, int19, int30 and int4; int12, int19, int30 and int17; int12, int19, int4 and int17; int12, int30, int4 and int17; int19, int30, int4 and int17.

[0018] If the glucoamylase mutant has five copies, then any five sites can be selected for integration, for example: X-3, int12, int19, int30 and int4; X-3, int12, int19, int30 and int17; X-3, int12, int19, int4 and int17; X-3, int12, int30, int4 and int17; X-3, int19, int30, int4 and int17; int12, int19, int30, int4 and int17.

[0019] If the number of copies of the glucoamylase mutant is six, then any six sites can be selected for integration, for example: X-3, int12, int19, int30, int4, and int17.

[0020] In this invention, the α-amylase truncated variant has one copy, or two copies, and its integration site is X-3. When the α-amylase truncated variant exists as a single copy, it integrates into the X-3 site; when it is a double copy, both copies integrate into different allele positions at the X-3 site, or integrate into the same X-3 site region through tandem repeats, to ensure expression stability and synergistic effect.

[0021] Based on the above construction strategy, this invention provides a series of recombinant Saccharomyces cerevisiae strains with defined genotypes, including but not limited to: SfGA S165G X-3::ADL1 int30::SfGA S165G ; SfGA S165G X-3::ADL1 int12::SfGA S165G int30::SfGA S165G ; SfGA S165G X-3::ADL1 int19::ADL1 int30::SfGA S165G ; SfGA S165G X-3::ADL1 int19::ADL1 int30::SfGA S165G int12::SfGA S165G ; SfGA S165G X-3::ADL1 int12::SfGA S165G int30::SfGA S165G int4::SfGA S165G ; SfGA S165G X-3::ADL1 int12::SfGA S165G int30::SfGA S165G int4::SfGA S165G int17::SfGA S165G .

[0022] In the expression for the recombinant Saccharomyces cerevisiae strains described above, X-3::ADL1 represents an expression cassette in which the truncated form of α-amylase (ADL1) is integrated at the X-3 site. These specific strains are not exhaustive but rather representative examples based on the inventive concept. Those skilled in the art can construct other equivalent strains by adjusting the copy number and integration site as needed. For example, the saccharifying enzyme mutant can be replaced with the L494I mutant, or ADL1 can be replaced with other truncated forms of α-amylase; all these variants fall within the scope of protection of this invention.

[0023] However, experiments showed that among these strains, the SfGA genotype... S165G X-3::ADL1 int12::SfGA S165G int30::SfGA S165G int4::SfGA S165G The selected strain exhibited the highest fermentation efficiency, achieving the highest alcohol content (17.25 V / V) under conditions of uncooked, large-particle corn flour as the substrate and without the addition of exogenous enzymes, representing a 46.8% increase compared to the control. Meanwhile, the contents of residual fructose, lactic acid, and glycerol decreased by 14.34%, 63.88%, and 6.39%, respectively, compared to the control. This strain not only demonstrated excellent raw starch utilization but also maintained the inherent high ethanol tolerance and fermentation stability of brewer's yeast, showing no significant performance degradation in continuous batch fermentation.

[0024] The recombinant Saccharomyces cerevisiae constructed in this invention can be used as a substrate strain for any Saccharomyces cerevisiae strain with good ethanol fermentation performance. Those skilled in the art can select a suitable substrate strain based on actual production conditions. However, in this invention, the substrate strain is Saccharomyces cerevisiae with accession number CCTCC NO: M 20251982. Saccharomyces cerevisiae M (CCTCC NO: M20251982) is a selected industrial alcohol yeast strain; inserting a saccharifying enzyme mutant and / or a truncated α-amylase into it can yield higher concentrations of ethanol. Using it as a substrate strain can more fully utilize the advantages of the exogenous amylase system, achieving high-concentration ethanol fermentation.

[0025] The present invention also provides a saccharifying enzyme mutant derived from *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomycopsis fibuligera It has S165G and / or L494I mutations relative to wild-type saccharifying yeast.

[0026] This invention screened mutation sites for saccharifying enzyme mutants and systematically evaluated the effects of multiple potential sites on enzyme activity and raw starch binding capacity. The results showed that the S165G and L494I mutations significantly enhanced the adsorption capacity of the saccharifying enzyme for raw corn starch granules, possibly related to their reduction of local steric hindrance on the catalytic domain surface and improved substrate accessibility.

[0027] Preferably, the amino acid sequence of the saccharifying enzyme mutant is shown in SEQ ID NO.1. Those skilled in the art will understand that, based on this sequence, other conserved substitutions that do not affect activity can be introduced, or modifications such as N-terminal / C-terminal truncation or fusion tags can be performed, as long as the S165G and / or L494I mutation characteristics are retained, all fall within the protection scope of this invention.

[0028] The present invention also provides a truncated form of α-amylase, said α-amylase truncated form being derived from Rhizopus oryzae (… Rhizopus oryzae ), which is missing amino acids from the N-terminus 2 to 25 relative to wild-type Rhizopus oryzae α-amylase.

[0029] This invention screened truncated fragments of α-amylase truncated forms. The results showed that, compared with other stage fragments, the truncated form lacking amino acids 2 to 25 at the N-terminus significantly improved the liquefaction efficiency of raw starch granules while maintaining the enzyme's catalytic activity.

[0030] Preferably, the truncated amino acid sequence of the α-amylase is shown in SEQ ID NO.2. This sequence lacks amino acids 2-25 from the N-terminus of wild-type Rhizopus oryzae α-amylase, while retaining the complete catalytic domain and C-terminal domain. Based on this sequence, modifications such as conserved substitutions and tag fusions can be made; as long as the N-terminal deletion feature is retained, they are all equivalent variants of this invention.

[0031] Furthermore, the present invention also provides a nucleic acid molecule, which is at least one of the following: I) Encodes the glycating enzyme mutant as described above; II) Encodes the truncated form of α-amylase as described above.

[0032] The nucleic acid molecule described in this invention can be deoxyribonucleic acid (DNA), including complementary DNA (cDNA) and genomic DNA; or it can be ribonucleic acid (RNA), including messenger RNA (mRNA) and transfer RNA (tRNA). Spatially, the nucleic acid molecule can be double-stranded or single-stranded. Topologically, it can be linear or circular (e.g., plasmids, circular RNA, etc.). In terms of its state of existence, it can exist alone, as part of an expression cassette or gene cluster in a vector, or integrated into the chromosome of a host cell. All nucleic acid molecules of the above forms and morphologies that encode proteins with the amino acid sequence characteristics of the saccharidase mutant or α-amylase truncated form described in this invention fall within the scope of protection of this invention.

[0033] Because the genetic code is degenerate, the same amino acid sequence can be encoded by multiple different nucleic acid sequences. Specifically, the nucleic acid molecule can be a codon-optimized sequence, that is, optimized according to the codon usage preferences of the host cell (such as Saccharomyces cerevisiae, Pichia pastoris, Escherichia coli, etc.) to improve translation efficiency and protein expression levels; it can also be a wild-type sequence derived from a natural species, that is, the original gene sequence directly cloned from Saccharomyces cerevisiae or Rhizopus oryzae; or it can be an artificially synthesized degenerate sequence, that is, a sequence variant obtained by changing some codons while keeping the amino acid sequence unchanged. All of the above types of nucleic acid sequences, as long as the protein they encode has an S165G and / or L494I mutant saccharidase, or an α-amylase with a deletion of amino acids 2-25 at the N-terminus, are within the scope of protection of this invention.

[0034] Preferably, the nucleic acid sequence encoding the glycosylation enzyme mutant as described above is as shown in SEQ ID NO.3, or is a sequence having at least 85% identity with SEQ ID NO.3.

[0035] Preferably, the nucleic acid sequence encoding the α-amylase truncated form as described above is as shown in SEQ ID NO. 4, or is a sequence having at least 85% identity with SEQ ID NO. 4.

[0036] Compared to other coding sequences, the sequences shown in SEQ ID NO.3 and SEQ ID NO.4 have been optimized for codon bias in Saccharomyces cerevisiae, which significantly improves the transcription and translation efficiency of exogenous genes in host cells.

[0037] Furthermore, the nucleic acid molecule of the present invention may further include regulatory elements, such as promoters, terminators, signal peptide coding sequences, and selectable marker genes, to achieve efficient and stable expression of exogenous genes in *Saccharomyces cerevisiae*. Preferably, the promoter is a constitutive or inducible strong promoter, such as PGK1, TDH3, ADH1, or GAL1 promoters; the signal peptide coding sequence is an endogenous, highly efficient secretory signal peptide of *Saccharomyces cerevisiae*, such as α-factor signal peptide (MFα1), used to guide the correct secretion of the expression product into the extracellular space, enhancing the efficiency of action on extracellular starch substrates.

[0038] Furthermore, the present invention also provides a recombinant plasmid comprising the nucleic acid molecules as described above.

[0039] The recombinant plasmids described in this invention are used for the storage, amplification, or expression of nucleic acid molecules as previously mentioned. Different backbone types can be selected for the recombinant plasmids depending on the integration method and requirements. For example, they can be constructed as integrative plasmids, integrating the target gene into a specific site on the host chromosome through homologous recombination; or they can be constructed as free plasmids, stably propagating with host cell division. Those skilled in the art can select appropriate plasmid backbones and selection markers according to the actual integration site and copy number requirements. Related routine operations are all prior art in this field and will not be elaborated upon here.

[0040] Optionally, the nucleic acid molecules encoding the glucoamylase mutant and the nucleic acid molecules encoding the truncated α-amylase can be located on the same recombinant plasmid or on different recombinant plasmids. When they are on the same plasmid, both genes can be introduced simultaneously in a single transformation, simplifying the experimental procedure and facilitating control of the copy number ratio of the two genes. When they are on different plasmids, gene manipulation and optimization can be performed independently, allowing for flexible adjustment of the expression intensity of each gene and facilitating stepwise construction of recombinant strains. Both strategies have their advantages and are within the scope of protection of this invention.

[0041] Optionally, the nucleic acid molecule is operatively linked to a promoter and a terminator; the promoter is an ADH1 promoter, and the terminator is a PDC1 terminator. Optionally, the backbone vector of the recombinant plasmid is pUC19.

[0042] Furthermore, the present invention also provides a method for constructing the recombinant Saccharomyces cerevisiae as described above, comprising the following steps: The nucleic acid molecules encoding the saccharifying enzyme mutant as described above and / or the nucleic acid molecules encoding the truncated α-amylase as described above were cloned into expression vectors, and then transformed into Saccharomyces cerevisiae to obtain the recombinant Saccharomyces cerevisiae.

[0043] In this invention, the specific operation method for cloning nucleic acid molecules into the expression vector is not limited, and any cloning method known in the art can be used, such as restriction endonuclease digestion and ligation, Gibson assembly, seamless cloning, etc. The introduced nucleic acid molecule can be a linearized expression cassette (for integration into the genome) or a complete circular plasmid (for free expression).

[0044] This invention does not specifically limit the transformation method; any suitable method known in the art can be used, such as electroconversion, LiAc chemical transformation, protoplast transformation, etc. Those skilled in the art can select appropriate cloning and transformation strategies according to actual needs to obtain the desired expression level and genetic stability.

[0045] Furthermore, the present invention also provides the application of the recombinant Saccharomyces cerevisiae in the fermentation production of ethanol.

[0046] Furthermore, the present invention also provides a method for producing ethanol by fermentation, comprising: using the recombinant Saccharomyces cerevisiae as described above, fermenting a starch-containing substrate under conditions without the addition of exogenous saccharifying enzymes and α-amylases.

[0047] The present invention obtains a recombinant brewing yeast strain through modification, which utilizes the recombinant strain's own enzyme system to complete starch hydrolysis and fermentation, thereby achieving simultaneous saccharification and fermentation.

[0048] In this invention, the starch-containing substrate can be any starchy raw material, including but not limited to corn, cassava, wheat, sorghum, and potatoes.

[0049] The substrate may or may not undergo cooking. The energy-saving effect is most significant when using raw materials that have not been cooked at high temperatures. In a specific embodiment, the starch-containing substrate is a starchy raw material that has not been cooked at high temperatures.

[0050] Starchy raw materials that have not undergone high-temperature cooking refer to raw materials that are added directly to the fermentation system in the form of raw starch without being heated to 90-110℃ for gelatinization and liquefaction. This significantly reduces energy consumption, avoids the destruction of nutrients by high temperatures, and simplifies the process. This invention does not impose strict limitations on substrate particle size; it is applicable from fine powders to coarse particles, making the method more closely aligned with industrial production practices. In a specific embodiment, the starchy raw material is corn flour with an average particle size of 1.27 mm.

[0051] In previous technologies, the fermentation substrate had to be small-particle corn flour, for example, corn flour with a particle size of less than 0.1 mm. This application, however, can directly utilize raw starch, especially large-particle raw materials. This is because the saccharifying enzyme mutant secreted by the strain constructed in this invention has a stronger adsorption and hydrolysis capacity for raw starch particles, and the truncated α-amylase has higher thermal stability and specific activity. The synergistic effect of both is sufficient to efficiently hydrolyze the dense crystalline structure of raw starch.

[0052] The strain of this invention exhibits high enzyme activity and good stability, enabling it to effectively hydrolyze larger corn flour particles. Experiments show that even when using coarse corn flour, the fermentation alcohol content can still reach 15.76% v / v. This characteristic makes the technology of this invention easier to scale up industrially without increasing the cost of raw material grinding.

[0053] The present invention has at least one of the following beneficial effects: The recombinant Saccharomyces cerevisiae strain constructed in this invention has both high starch hydrolysis and ethanol fermentation capabilities, and can directly utilize raw starch raw materials without the need for exogenous addition of saccharifying enzymes and α-amylases, thus significantly reducing production costs. Through enzyme modification and optimization, the hydrolysis efficiency of saccharifying enzyme and α-amylase on raw starch was significantly improved. The synergistic effect of saccharifying enzyme and α-amylase achieved efficient starch saccharification. No high-temperature cooking is required, saving energy consumption and meeting energy conservation and carbon reduction requirements; Raw material fermentation is a simple and easy-to-operate process that produces high levels of ethanol and is stable, making it suitable for large-scale industrial production. Attached Figure Description

[0054] Figure 1 Technical solution implementation flowchart; Figure 2 Agarose gel electrophoresis verification results of M+ScGA and M+SfGA strains (A is the electrophoresis verification result of M+ScGA strain, and B is the electrophoresis verification result of M+SfGA strain). Figure 3 Agarose gel electrophoresis verification results of point mutant strains (lanes 1-15 are verification results for M+SfGA L494D, M+SfGA Q448E, M+SfGA S165G, M+SfGA F233Y, M+SfGA L235A, M+SfGAI471A, M+SfGAL494I, M+SfGA L494Y, M+SfGA L494E, M+SfGA L494A, M+SfGA A80G, M+SfGA L494V, M+SfGA S165A, M+SfGA L471T, and M+SfGA L235I, respectively). Figure 4Results of raw material fermentation by saccharifying enzyme strains; Figure 5 Agarose gel electrophoresis verification results of α-amylase recombinant strains (lanes 1-9 are GL0583, GL0600, GL0621, GL0622, GL0623, GL0624, GL0625, GL0626, and GL0627, respectively). Figure 6 Results of raw material fermentation by recombinant α-amylase strain; Figure 7 Agarose gel electrophoresis verification results of recombinant strains (A represents the verification result of strain GL0601; lanes 1-8 in B represent the verification result of strain GL0602, and lanes 9-16 represent the verification result of strain GL0603; C represents the verification result of strain GL0620; D represents the verification result of strain GL0632; E represents the verification result of strain GL0633). Figure 8 Results of raw material fermentation using multi-copy recombinant strains; Figure 9 Fermentation results of different corn raw materials. Detailed Implementation

[0055] This invention provides a recombinant Saccharomyces cerevisiae strain and its application in the fermentation of raw materials to produce ethanol. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0056] Unless otherwise defined in this invention, scientific and technical terms related to this invention shall have the meanings understood by one of ordinary skill in the art.

[0057] The terms “comprising,” “including,” and “having” are used interchangeably to indicate the inclusiveness of a scheme, meaning that the scheme may contain elements other than those listed. It should also be understood that the use of “comprising,” “including,” and “having” herein also provides for schemes “consisting of…”.

[0058] The term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can mean: A exists alone, A and B exist simultaneously, or B exists alone. A and B can be singular or plural.

[0059] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single or multiple items.

[0060] The numerical ranges and parameters involved in this invention have been presented as precisely as possible in the specific embodiments. However, any numerical value inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all numerical ranges or specific data used in this disclosure may have a reasonable deviation within a certain range, such as ±10%, ±5%, ±1%, or ±0.5%.

[0061] In this invention, the "recombinant Saccharomyces cerevisiae" refers to an engineered strain in which exogenous nucleic acid molecules encoding a saccharifying enzyme mutant and / or a truncated α-amylase are introduced into Saccharomyces cerevisiae host cells through genetic engineering technology, enabling the strain to autonomously secrete a functional starch-hydrolyzing enzyme system. This recombinant strain can directly utilize raw starch raw materials (such as corn flour) that have not been cooked at high temperatures for simultaneous saccharification and ethanol fermentation without relying on the addition of exogenous enzyme preparations.

[0062] In this invention, the "Rhizopus oryzae" ( Rhizopus oryzae "" refers to a filamentous fungus commonly used for starch hydrolysis. Its naturally secreted glucoamylase (GA) has high activity in degrading raw starch and is one of the original gene sources of the glucoamylase mutant in this invention.

[0063] The "capsule-coated yeast" described in this invention Saccharomycopsis fibuligera "α-amylase" refers to a type of yeast that can secrete α-amylase. The α-amylase secreted by the yeast can effectively hydrolyze the α-1,4-glycosidic bonds inside starch molecules to produce dextrin and oligosaccharides, providing suitable substrates for the subsequent action of saccharifying enzymes.

[0064] In this invention, the "saccharifying enzyme" refers to an exoglycosidic amylase capable of sequentially cleaving α-1,4 glycosidic bonds from the non-reducing end of the starch chain, gradually releasing glucose. In this invention, it specifically refers to an enzyme derived from *Saccharomyces cerevisiae* (…). Saccharomycopsis fibuligera ) saccharifying enzyme (SfGA), or from Schizophyllum commune ( Schizophyllum commune ) saccharifying enzyme (ScGA).

[0065] In this invention, the "saccharifying enzyme mutant" refers to an enzyme protein variant obtained by site-directed mutagenesis of the amino acid sequence of wild-type *Saccharomyces cerevisiae* saccharifying enzyme. In this invention, the mutant has at least the S165G and / or L494I mutations, i.e., a mutation from serine to glycine at position 165, and / or a mutation from leucine to isoleucine at position 494. The mutant may further include other amino acid substitutions that do not affect enzyme activity, such as L494D, Q448E, F233Y, L235A, I471A, L494Y, L494D, L494E, L494A, A80G, L494V, S165A, L471T, etc.

[0066] In this invention, "α-amylase" refers to an endoglucosidase capable of randomly cleaving the α-1,4 glycosidic bonds within starch molecules to produce intermediate products such as dextrins and oligosaccharides. In this invention, it specifically refers to amylase derived from *Rhizopus oryzae* (…). Rhizopus oryzae α-Amylase (ADL) of α-amylase, including its wild-type sequence and variants obtained through truncation, mutation, or other modifications.

[0067] In this invention, the "α-amylase truncated variant" refers to an enzyme protein variant obtained by truncating the N-terminus of the amino acid sequence of wild-type Rhizopus oryzae α-amylase. In this invention, the truncated variant lacks the amino acid sequence corresponding to positions 2-25 at the N-terminus of wild-type Rhizopus oryzae α-amylase; this region is a loop domain, and its deletion improves the protein's thermostability and specific activity.

[0068] In this invention, "integrative expression" refers to inserting the expression cassette of a foreign gene into a specific location in the genomic DNA of *Saccharomyces cerevisiae* through homologous recombination or other methods. This allows the foreign gene to be stably inherited and expressed along with chromosome replication, unlike transient expression via free plasmids. Integrative expression maintains the stable presence of the foreign gene without the need for external selection pressure, making it more suitable for long-term industrial fermentation.

[0069] In this invention, the term "copy number" refers to the number of independent units of a specific exogenous gene (such as a saccharidase mutant gene or an α-amylase truncated gene) integrated into the genome of the same recombinant Saccharomyces cerevisiae strain. For example, if the saccharidase mutant gene is integrated into two different sites, its copy number is 2; if it is integrated into four different sites, the copy number is 4.

[0070] In this invention, the "integration site" refers to a specific chromosomal location in the *Saccharomyces cerevisiae* genome used for the insertion of a foreign gene expression cassette. In this invention, the integration site of the saccharifying enzyme mutant is selected from one or more of X-3, int12, int19, int30, int4, and int17; the integration site of the α-amylase truncated mutant is X-3. Specifically, X-3 is a specific integration site on chromosome X; int12, int19, int17, and int4 are neutral integration sites in intergenic regions of the genome, which do not affect host growth and have high genetic stability after integration; and int30 is an integration site in a high-copy-repetition region of rDNA, suitable for achieving multi-copy integration of foreign genes.

[0071] In this invention, the "chasm bacteria" refers to the initial Saccharomyces cerevisiae strain used to receive the introduction of exogenous genes and as the basis for constructing recombinant strains. In this invention, the chassis bacteria is Saccharomyces cerevisiae strain M with preservation number CCTCC NO: M 20251982. This strain is a selected industrial alcohol yeast with excellent characteristics such as high ethanol yield, strong tolerance, and stable fermentation.

[0072] In this invention, the term "nucleic acid molecule" refers to a polymer composed of nucleotides that encodes the saccharifying enzyme mutant or α-amylase truncated form described in this invention. Its nucleotide sequence can be in DNA or RNA form, including but not limited to genomic DNA, cDNA, mRNA, synthetic oligonucleotides, or codon-optimized coding sequences. As long as the nucleic acid molecule can be transcribed and / or translated to ultimately produce a saccharifying enzyme with the S165G and / or L494I mutation, or an α-amylase truncated form lacking amino acids 2-25 from the N-terminus, it falls within the scope of "nucleic acid molecule" as defined in this invention.

[0073] In specific implementations, the nucleic acid molecule may contain a complete open reading frame (ORF) or a partial regulatory sequence, such as a 5' untranslated region (5'UTR) or a 3' untranslated region (3'UTR), provided that it does not affect the correct expression and function of the target protein. Furthermore, the nucleic acid molecule may exist alone or as part of an expression cassette, constructed together with promoters, terminators, selection markers, and other elements in a vector for transforming *Saccharomyces cerevisiae*.

[0074] Specifically, when the nucleic acid molecule is used for integrated expression, it typically contains homologous arms on both sides, which are generally 30–1000 bp in length, preferably 400–800 bp, to ensure efficient and accurate homologous recombination. These homologous arms can be derived from upstream or downstream sequences at sites such as X-3, int12, int19, int30, int4, or int17; the specific choice depends on the target integration site and copy number design strategy.

[0075] The nucleic acid molecules described in this invention not only cover coding sequences from natural sources or artificial synthesis, but also include all their functional variants and equivalent forms. As long as their encoded products possess the structural features and starch hydrolysis activity defined in this invention, they fall within the protection scope of this invention.

[0076] In this invention, "identity" refers to the degree of base matching between two nucleic acid sequences obtained using sequence alignment methods known in the art. A higher percentage of identity indicates higher sequence homology and more similar functions. As long as the encoded protein retains the corresponding mutation or truncated features and has the corresponding enzymatic activity, it falls within the protection scope of this invention. The phrase "at least 85% identity" means an identity of not less than 85%, not less than 90%, not less than 95%, or not less than 98%.

[0077] In this invention, the "recombinant plasmid" refers to a circular DNA molecule constructed by inserting a foreign nucleic acid molecule into a vector plasmid using in vitro recombination technology. In this invention, the recombinant plasmid contains a nucleic acid molecule encoding the glucoamylase mutant described in this invention and / or a nucleic acid molecule encoding the truncated α-amylase described in this invention, and is operatively linked with expression regulatory elements such as promoters and terminators, as well as functional elements such as selection markers and origins of replication. The nucleic acid molecule encoding the glucoamylase mutant and the nucleic acid molecule encoding the truncated α-amylase can be located on the same recombinant plasmid or on different recombinant plasmids. This recombinant plasmid can be used to transform *Saccharomyces cerevisiae* or other microbial hosts to achieve the expression of the target enzyme protein.

[0078] In this invention, the "backbone vector" refers to the basic plasmid portion of the recombinant plasmid used to carry exogenous nucleic acid molecules, typically containing basic elements such as the origin of replication, multiple cloning sites, and selection markers. In this invention, the backbone vector is preferably pUC19, but other commonly used vectors such as pBluescript, pBR322, pYES2, and pGAPZ can also be used. The specific type of backbone vector does not affect the scope of protection of this invention.

[0079] In this invention, the "construction method" refers to the process of preparing the recombinant Saccharomyces cerevisiae strain described herein. Specifically, it includes cloning nucleic acid molecules encoding a saccharifying enzyme mutant and / or a nucleic acid molecule encoding a truncated α-amylase into an expression vector, then introducing the resulting recombinant expression vector into Saccharomyces cerevisiae host cells, and screening to obtain recombinant strains that successfully express the target enzyme protein. This construction method covers all possible gene introduction methods and operational strategies, and the cloning and transformation methods are not specifically limited.

[0080] In this invention, "cloning" refers to the molecular biological process of inserting a target nucleic acid molecule into a vector molecule. The specific cloning method is not limited in this invention; any method known in the art can be used, such as restriction endonuclease digestion and ligation, Gibson assembly, seamless cloning, TA cloning, etc. The purpose of cloning is to place nucleic acid molecules encoding glycan mutants and / or α-amylase truncated variants under appropriate expression regulatory elements to achieve effective expression in host cells.

[0081] In this invention, "transformation" refers to the process of introducing exogenous nucleic acid molecules into host cells to acquire new genetic traits. The specific method of transformation is not limited in this invention; any suitable method known in the art can be used, such as electroporation, LiAc chemical transformation, protoplast transformation, gene gun method, etc. The introduced nucleic acid molecule can be a linearized expression cassette (for integration into the genome) or a complete circular plasmid (for free expression). The purpose of transformation is to enable *Saccharomyces cerevisiae* to acquire the ability to express saccharifying enzyme mutants and / or α-amylase truncated variants.

[0082] In this invention, "raw material" refers to starchy raw materials that have not undergone high-temperature cooking and gelatinization. Unlike traditional cooked material fermentation processes where raw materials are heated to 90-110℃ for cooking and liquefaction, raw material participates in the fermentation process directly in the form of natural starch granules. Raw starch granules have a dense crystalline structure, making them difficult to effectively hydrolyze by ordinary amylases. Therefore, an enzyme system with strong raw starch hydrolysis capabilities is required to achieve efficient saccharification.

[0083] In this invention, "enzyme-free raw material fermentation" refers to a process in which no exogenous commercial saccharifying enzymes or α-amylase preparations are added during fermentation. Instead, the saccharification of raw starch is accomplished solely by the starch hydrolytic enzyme system secreted by the recombinant Saccharomyces cerevisiae strain (i.e., the saccharifying enzyme mutant and α-amylase truncated form described in this invention), coupled with the yeast's own ethanol fermentation pathway, achieving simultaneous saccharification and fermentation to produce ethanol. This process eliminates the need for high-temperature cooking and the addition of exogenous enzyme preparations, offering significant energy-saving and consumption-reducing advantages.

[0084] The test materials used in this invention are all commercially available products. It should be understood that in the various embodiments of this application, the sequence numbers of the above processes do not imply a specific order of execution. Some or all steps can be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application. The invention is further illustrated below with reference to embodiments: Example 1 Selection of glucoamylase gene Screening was performed on yeast cells covered with vesicles ( Saccharomycopsis fibuligera ) Glycoamylase gene ( SfGA, AJ311587) and Schizophyllum commune ( Schizophyllum commune ) Source of glycan enzyme gene ( ScGA, Wild-type saccharidase genes (e.g., SEQ ID NO. 8) were integrated into *Saccharomyces cerevisiae* M (accession number: CCTCC NO: M 20251982) to initially screen for the optimal saccharifying enzyme genes. To improve the enzyme's thermostability and catalytic efficiency, the screened saccharifying enzyme genes were modified using site-directed mutagenesis. All saccharifying enzyme genes were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., and after codon optimization in *Saccharomyces cerevisiae*, they were ligated into the PUC19 plasmid. The ADH1 promoter was used to drive gene expression, and the PDC1 terminator was ligated after the gene coding sequence to ensure mRNA stability and transcription termination. Point mutations designed on SfGA included L494D, Q448E, S165G, F233Y, L235A, I471A, L494I, L494Y, L494D, L494E, L494A, A80G, L494V, S165A, and L471T. The specific primer sequences are shown in Table 1 below. All point mutations were verified by sequencing by Qingke Biotechnology Co., Ltd. (Wuhan). The constructed point mutant SfGA expression cassette was electroporated into strain M. The constructed strains and insertion sites are shown in Table 2 below.

[0085] Table 1. Point Mutation Primer Sequences

[0086] Table 2. Strains Information Table

[0087] 1.1 Obtaining the target gene

[0088] Using PUC19-SfGA and PUC19-ScGA plasmids as templates, PCR was performed with the corresponding primer sequences (GA-F: AAAGATACGAAATATGAAAGGCGAGGAAAATTAGAATTATTTCAATCATTGGAGCAATC; GA-R: TATGATTGACGTCATTCTGAGTTACAATGATCTTAGCGACGATTTTTTTCTAAACCGTG) to obtain the glycated enzyme expression cassette fragment. Using the PUC19-SfGA mutant plasmid as a template, PCR amplification with GA-F and GA-R primer pairs was performed to obtain the corresponding mutant SfGA expression cassette fragment. High-fidelity PCR in the examples used Phanta Max Super-Fidelity DNA Polymerase (purchased from Novizan). DNA gel electrophoresis excision and recovery were performed using a gel recovery kit (purchased from OMEGA), yeast genomic DNA extraction was performed using a yeast genomic DNA extraction kit (purchased from OMEGA), and seamless cloning was performed using the Plus One Step Cloning Kit (purchased from Yisheng Biotechnology). Specific molecular manipulation steps were performed according to the respective reagent instructions.

[0089] 1.2 Preparation and electrotransfer of competent states

[0090] (1) Inoculate strain M into a test tube containing 5 mL of YPD medium (1% yeast extract, 2% peptone, 2% glucose) and culture for 12 h. The next day, inoculate 2% into a conical flask containing 50 mL of YPD medium and culture for about 5 h. Measure OD600 to 0.8-1.0. Incubate on ice for 15 min, centrifuge at 5000 rpm for 5 min (4℃) and collect the cells.

[0091] (2) Wash the bacterial cells twice with 10% glycerol, mix them by pipetting, and collect the bacterial cells by centrifugation at 5000 rpm for 5 min (4℃).

[0092] (3) The obtained bacterial cells were suspended in 500 μL of 10% glycerol and dispensed into 100 μL competent cells for later use.

[0093] (4) Add 1-1.5 μg gRNA plasmid and 2 μg GA linear fragment to the competent cells.

[0094] (5) 2 mm electric rotary cup, set to 2.5 kV voltage, (breakdown time is about 5.5 ms); (6) Take 900 μL of YPD medium to wash the competent cell solution, transfer it to a 1.5 mL centrifuge tube, and incubate at 30℃ for 1 h; centrifuge at 12000 g for 1 min, collect the cells, suspend them in 200 μL of sterile water, spread 50~100 μL on a plate; incubate overnight at 30℃, and pick single bacteria.

[0095] 1.3 Strain Validation

[0096] Positive transformants were screened by agarose gel electrophoresis, and the results were verified as follows: Figures 2-3 As shown, M+ScGA and M+SfGA strains were successfully constructed.

[0097] 1.4 Validation of saccharification function

[0098] 1.4.1 Raw material fermentation process

[0099] Weigh and record the weight of each clean, dry Erlenmeyer flask. Weigh 100 g of corn flour and transfer it to a clean, dry 500 mL Erlenmeyer flask. Add 0.2 mL of 1.5% dilute sulfuric acid, 0.8 g of magnesium sulfate heptahydrate, 1.00 g of urea, 1 g of yeast extract FM888, and approximately 175 g of tap water at 40 °C. Stir well, and finally add 0.16 mL of fresh yeast (with a viable count of approximately 10 million / mL). Clean the flask walls with a long sampling spoon. On an analytical balance, add water to the final volume (288 g) according to the weight difference. Seal the flask with sealing film and wrap it with a rubber band three times. Weigh the flask. Incubate the Erlenmeyer flask in a constant-temperature shaker at 170 rpm and 33 °C for 70–72 hours. After fermentation, shake well and transfer 100 mL of fermentation mash to a 1000 mL distillation flask using a 100 mL graduated cylinder. Add 100–150 mL of tap water and 2 drops of defoaming agent, and proceed with distillation. Collect the distillate in a 100 mL volumetric flask (with an external cold water bath to control the temperature of the distillate below 25 °C). When the distillate reaches approximately 95 mL, stop distillation, remove the flask, and bring the volume to 100 mL. Shake well and use a precision alcohol meter to measure the alcohol content of the distillate.

[0100] 1.4.2 Results of Raw Material Fermentation Experiment

[0101] like Figure 4 As shown in A, screening for saccharifying enzyme genes from *Saccharomyces cerevisiae* and *Schizophyllum commune* revealed that the saccharifying enzyme gene from *Saccharomyces cerevisiae* showed better fermentation performance under corn-based feed conditions in a factory. Therefore, point mutations were performed on this gene to improve the catalytic efficiency of the strain, such as... Figure 4 As shown in B, the S165G mutation showed the best effect, increasing the alcohol content by 20.45% compared to the control, while reducing the contents of acetic acid, lactic acid, and glycerol by 3.9%, 18.75%, and 8.64%, respectively. Figure 4Therefore, based on the M+SfGA-S165G strain, we continued to screen and modify α-amylase.

[0102] Example 2: Selection and Modification of α-Amylase Gene

[0103] Selected from Rhizopus oryzae ( Rhizopus oryzae The α-amylase gene (ADL) was selected from the PUC19 plasmid. The screening and construction process of this gene is described in patent CN121759491A. The N-terminal 2-25 amino acids of the ADL gene form a loop region; deleting this region may improve protein stability. Therefore, the ADL1 gene was constructed by deleting amino acid sequences 2-25 of this gene. To further enhance enzyme activity, mutations were performed on the ADL1 gene at seven sites: N53T, Q443E, Q446T, Q450T, Q452D, K128R, and Q254E. The primer sequences for plasmid construction are shown in Table 3. All genes were constructed onto the PUC19 plasmid after codon optimization by Suzhou Genewiz Biotechnology Co., Ltd. The truncated and mutated sequences of the ADL gene were verified by sequencing by Qingke Biotechnology Co., Ltd. (Wuhan). Detailed information on the strain and fragment insertion sites are shown in Table 4.

[0104] Table 3 Primer Sequences

[0105] Table 4. Construction of strain information table

[0106] 2.1 Obtaining the target gene and constructing the strain

[0107] Using PUC19-ADL and PUC19-ADL1 plasmids as templates, α-amylase expression cassette fragments were obtained by PCR using the corresponding primer sequences (ADL-F: TGAAAATTGTGCCGGATATTCAAGACTAAGAGATGTACAAAGGAAGTGTTTCCCTC; ADL-R: AAATCGACATGTTAATGATCTTACGACAGAGTAGTTTATGTCAAATTAAAGCCTTCGAG). Using the PUC19-ADL1 mutant plasmid as a template, ADL1N53T, ADL1Q443E, ADL1Q450T, ADL1Q452D, ADL1K128R, ADL1Q254E, and ADL1Q446T expression cassette fragments were obtained by PCR amplification using primer pairs ADL-F and ADL-R. The enzymes used in this implementation were the same as those in 1.1 of Example 1. The above fragments were electroporated (using the electroporation method described in 1.2 of Example 1) into strain M+SfGA. S165GIn this study, strains GL0583, GL0600, GL0621, GL0622, GL0623, GL0624, GL0625, GL0626, and GL0627 were constructed. Positive transformants were screened by agarose gel electrophoresis, and the results were verified as follows: Figure 5 As shown, the corresponding series of strains were successfully constructed.

[0108] 2.2 Results of raw material fermentation experiment of strain

[0109] Enzymatic modification of the α-amylase gene from *Rhizopus oryzae* was performed, deleting the N-terminal 2-25 amino acid loop region to improve protein stability and significantly increase the alcohol content of the raw material fermentation strain. Compared with the control strain (GL0583), the alcohol content increased by 40%, from 8.385 V / V to 11.62 V / V, and the enzyme activity increased by 232.9% relative to the control strain. Subsequently, seven mutation sites were selected based on protein structure prediction for further modification of the enzyme, but the modification effect was not satisfactory. Figure 6 ).

[0110] Example 3. Construction of multi-copy strains and raw material fermentation

[0111] 3.1 Construction of multi-copy strains

[0112] Different multi-copy strains were constructed by integrating the modified GA and ADL expression cassettes into different sites in the genome of *Saccharomyces cerevisiae* strain GL0600 via electroporation to ensure stable gene inheritance and efficient expression (electroporation method as described in 1.2 of Example 1). Strain names and specific information are shown in Table 5 below, and primer sequences are shown in Table 6. Positive transformants were screened by agarose gel electrophoresis, and the verification results are as follows: Figure 7 As shown, all multi-copy strains were successfully constructed.

[0113] Table 5. Strains Information Table

[0114] Table 6 Primer Sequences

[0115] 3.2 Results of raw material fermentation by strains

[0116] Six strains were constructed by integrating multiple copies of the saccharifying enzyme and α-amylase genes into strain GL0600. Compared with strain GL0600, the alcohol content of raw material fermentation was significantly increased. Among them, strain GL0632 had the highest alcohol content, reaching 17.25 V / V, which was 46.8% higher than the control. Figure 8 In the control group (A), the content of residual sugars, lactic acid, and glycerol decreased by 14.34%, 63.88%, and 6.39%, respectively. Figure 8 (B in the middle).

[0117] 3.3 Fermentation Validation of Different Corn Flour Raw Materials

[0118] 3.3.1 Different Fermentation Processes for Corn Flour Raw Materials

[0119] The characteristics of strains were analyzed during raw material fermentation using two different corn flours. One type of corn flour is sourced from Henan Huangjinsu Food Technology Co., Ltd., and features better corn grinding and finer powder (particle size approximately 0.1 mm or less).

[0120] Another type of corn flour uses corn sourced from Yichang, which is then crushed by our company, resulting in larger particle sizes (average particle size of approximately 1.27 mm), making it closer to the corn flour used in our production workshop.

[0121] Using the two different corn flour raw materials mentioned above, GL0632 was subjected to enzyme-free raw material fermentation. The raw material fermentation process was the same as 1.4.1 in Example 1, with all other conditions remaining unchanged. The experimental results are as follows: Figure 9 As shown: The alcohol content of the fermented raw corn flour is 1.5 V / V lower than that of the raw corn flour from Henan Huangjinsu Food Technology Co., Ltd. Although the large size of the corn flour particles means that some of the internal starch is not fully utilized, the alcohol content of the fermented raw corn flour by strain GL0632 can still reach 15.76 V / V under enzyme-free conditions. This fermentation alcohol content meets the requirements of commercial production and does not require the addition of exogenous enzymes or saccharification liquid chemical treatment, which can reduce costs and increase efficiency, and has broad application prospects.

[0122] Table 7 Alcohol content after fermentation by different strains

[0123] The sequences involved in the embodiments are as follows: S-glucoamylase SfGA S165Gamino acid sequence: MIRLTVFLTAVFAAVASCVPVELDKRNTGHFQAYSGYTVARSNFTQWIHEQPAVSWYYLLQNIDYPEGQFKSAKPGVVVASPSTSEPDYFYQWTRDTAITFLSLIAEVEDHSFSNTTLAKVVEYYISNTYTLQRVSNPSGNFDSPNHDGLGEPKFNVDDTAYTAGWGRPQNDGPALRAYAISRYLNAVAKHNNGKLLLAGQNGIPYSSASDIYWKIIKPDLQHVSTHWSTSGFDLWEENQGTHFFTALVQLKALSYGIPLSKTYNDPGFTSWLEKQKDALNSYINSSGFVNSGKKHIVESPQLSSRGGLDSATYIAALITHDIGDDDTYTPFNVDNSYVLNSLYYLLVDNKNRYKINGNYKAGAAVGRYPEDVYNGVGTSEGNPWQLATAYAGQTFYTLAYNSLKNKKNLVIEKLNYDLYNSFIADLSKIDSSYASKDSLTLTYGSDNYKNVIKSLLQFGDSFLKVLLDHIDDNGQLTEEINRYTGFQAGAVSLTWSSGSLLSANRARNKLIELL (SEQ ID NO. 1).

[0124] Amino acid sequence of ADL truncated body: MRASASDWENRVIYQLLTDRFAKSTDDTNGCSNLSDYCGGTFQGIINHLDYIAGMGFDAIWISPIPKNVNGGYHGYWASDFSQINEHFGTADDLKKLVAAAHAKNMYVMLDVVANHAGTPSSGGDYSGYTFGQSSEYHRACDINYNDQNSIEQCWISGLPDINTEDSAIVSKLNSIVSGWVSDYGFDGLRIDTVKHVRKDFWDGYVSAAGVFATGEVLSGDVSYVSPYQQHVPSLINYPLYYPVYDVFTKSRTMSRLSSGFSDIKNGNFKNIDVLVNFIDNHDQPRLLSKADQSLVKNALAYSFMVQGIPVLYYGTEQSFKGGNDPNNREVLWTTGYSTTSDMYKFVTTLVKARKGSNSTVNMGIAQTDNVYVFQRGGSLVVVNNYGQGSTNTITVKAGSFSNGDTLTDVFSNKSVTVQNNQITFQLQNGNPAIFQKN (SEQ ID NO.2).

[0125] Glucoamylase SfGA S165G Expression cassette sequence:

[0126] ADH1 promoter sequence: TGTATATGAGATAGTTGATTGTATGCTTGGTATAGCTTGAAATATTGTGCAGAAAAAGAAACAAGGAAGAAAGGGAACGAGAACAATGACGAGGAAACAAAAGATTAATAATTGCAGGTCTATTTATACTTGATAGCAAGACAGCAAACTTTTTTTTATTTCAAATTCAAGTAACTGGAAGGAAGGCCGTATACCGTTGCTCATTAGAGAGTAGTGTGCGTGAATGAAGGAAGGAAAAAGTTTCGTGTGCTTCGAGATACCCCTCATCAGCTCTGGAACAACGACATCTGTTGGTGCTGTCTTTGTCGTTAATTTTTTCCTTTAGTGTCTTCCATCATTTTTTTGTCATTGCGGATATGGTGAGACAACAACGGGGGAGAGAGAAAAGAAAAAAAAAGAAAAGAAGTTGCATGCGCCTATTATTACTTCAATAGATGGCAAATGGAAAAAGGGTAGTGAAACTTCGATATGATGATGGCTATCAAGTCTAGGGCTACAGTATTAGTTCGTTATGTACCACCATCAATGAGGCAGTGTAATTGGTGTAGTCTTGTTTAGCCCATTATGTCTTGTCTGGTATCTGTTCTATTGTATATCTCCCCTCCGCCACCTACATGTTAGGGAGACCAACGAAGGTATTATAGGAATCCCGATGTATGGGTTTGGTTGCCAGAAAAGAGGAAGTCCATATTGTACACCCGGAAACAACAAAAGGATATCCGAAATATTCCACGGTTTAGAAAAAAATCG (SEQ ID NO.5).

[0127] PDC1 terminator sequence: TTTCAATCATTGGAGCAATCATTTTACATGGACCGCACCAAGTGGCGTAGAAATCTACGACAACTAGCTTGTCTTGAGCAATTGCAGAGTCGAATTCGCTGGCAGTTTTGAATTGAGTAACCATTATTTGTATCGAGGTGTCTAGTCTTCTATTACACTAATGCAGTTTCAGGGTTTTGGAAACCACACTGTTTAAACAGTGTTCCTTAATCAAGGATACCTCTTTTTTTTTCCTTGGTTCCACTAATTCATCGGTTTTTTTTTTGGAAGACATCTTTTCCAACGAAAAGAATATACATATCGTTTAAGAGAAATTCTCCAAATTTGTAAAGAAGCGGACCCAGACTTAAGCCTAACCAGGCCAATTCAACAGACTGTCGGCAACTTCTTGTCTGGTCTTTCCATGGTAAGTGACAGTGCAGTAATAATATGAACCAATTTATTTTTCGTTACATAAAAATGCTTATAAAACTTTAACTAATAATTAGAGATTAAATCGC (SEQ ID NO.6).

[0128] Amylase ADL truncate expression cassette sequence:

[0129] Secretion signal peptide: AGCTTCAGCCTCTCTTTTCTCGAGAGATACCCCTTCTCTTTAGCAGCAATGCTGGCAATAGTAGTATTTATAAACAATAACCCGTTATTTGTGCTGTTGGAAAATGGCAAAACAGCAACATCGAAATCCCCTTC TAAATCTGAGTAACCGATGACAGCTTCAGCCGGAATTTGTGCCGTTTCATCTTCTGTTTGTAGTGTTGACTGGAGCAGCTAATGCGGAGGATGCTGCGAATAAAACAGCAGTAAAAATTGAAGGAAATCTCAT (SEQ ID NO.7).

[0130] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Recombinant Saccharomyces cerevisiae expressing a saccharifying enzyme mutant and / or an α-amylase truncated variant; The amino acid sequence of the saccharifying enzyme mutant is shown in SEQ ID NO.1; The amino acid sequence of the α-amylase truncated form is shown in SEQ ID NO.

2.

2. The recombinant Saccharomyces cerevisiae according to claim 1, characterized in that, The saccharifying enzyme mutant and / or the truncate α-amylase are expressed in an integrated manner, with the saccharifying enzyme mutant having a copy number of 2 to 4 and the α-amylase truncate having a copy number of 1 to 2.

3. The recombinant Saccharomyces cerevisiae according to claim 1 or 2, characterized in that, The integration site of the saccharifying enzyme mutant is selected from one or more of X-3, int12, int19, int30, int4, and int17; the integration site of the α-amylase truncated variant is X-3.

4. The recombinant Saccharomyces cerevisiae according to claim 1 or 2, characterized in that, It is at least one of the following: SfGA S165G X-3::ADL1 int30:: SfGA S165G ; SfGA S165G X-3::ADL1 int12:: SfGA S165G int30:: SfGA S165G ; SfGA S165G X-3::ADL1 int19::ADL1 int30:: SfGA S165G ; SfGA S165G X-3::ADL1 int19::ADL1 int30::SfGA S165G int12:: SfGA S165G ; SfGA S165G X-3::ADL1 int12::SfGA S165G int30::SfGA S165G int4::SfGA S165G ; SfGA S165G X-3::ADL1 int12:: SfGA S165G int30:: SfGA S165G int4:: SfGA S165G int17:: SfGA S165G 。 5. The recombinant Saccharomyces cerevisiae according to claim 4, characterized in that, The substrate bacteria are Saccharomyces cerevisiae with preservation number CCTCCNO: M 20251982.

6. A saccharifying enzyme mutant, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

1.

7. A truncated form of α-amylase, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

2.

8. A nucleic acid molecule, characterized in that, It is at least one of the following: I) Encoding the saccharifying enzyme mutant as described in claim 6; II) Encoding the truncated form of α-amylase as described in claim 7.

9. The nucleic acid molecule according to claim 8, characterized in that, The nucleic acid sequence encoding the glycosylation enzyme mutant of claim 6 is shown in SEQ ID NO. 3; The nucleic acid sequence encoding the α-amylase truncated form of claim 7 is shown in SEQ ID NO.

4.

10. A recombinant plasmid, characterized in that, The recombinant plasmid comprises the nucleic acid molecule as described in claim 8 or 9.

11. The recombinant plasmid according to claim 10, characterized in that, The nucleic acid molecule is operatively linked to a promoter and a terminator; the promoter is an ADH1 promoter and the terminator is a PDC1 terminator.

12. The recombinant plasmid according to claim 10 or 11, characterized in that, The backbone vector for the recombinant plasmid is pUC19.

13. The method for constructing the recombinant Saccharomyces cerevisiae according to any one of claims 1 to 5, characterized in that, Includes the following steps: The nucleic acid molecules encoding the saccharifying enzyme mutant of claim 6 or 7 and / or the nucleic acid molecules encoding the α-amylase truncated mutant of claim 8 or 9 are respectively cloned into the expression vector, and then transformed into Saccharomyces cerevisiae to obtain the recombinant Saccharomyces cerevisiae.

14. The use of the recombinant Saccharomyces cerevisiae according to any one of claims 1 to 5 in the fermentation production of ethanol.

15. A method for producing ethanol by fermentation, characterized in that, include: Using the recombinant Saccharomyces cerevisiae according to any one of claims 1 to 5, fermentation is carried out on a starch-containing substrate without the addition of exogenous saccharifying enzymes and α-amylases.

16. The method according to claim 15, characterized in that, The starch-containing substrate is a starchy raw material that has not been cooked at high temperature.

17. The method according to claim 15 or 16, characterized in that, The starchy raw material is corn flour, and the average particle size of the corn flour is 1.27 mm.

Images