A compound microbial inoculant, a preparation method and application thereof

Abstract

The application provides a composite microbial inoculant and a preparation method and application thereof, and relates to the technical field of agricultural microorganisms and bio-fertilizers. Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus velezensis Bacillus velezensis DL292, and Serratia Serratia sp. DN15. The combined strains have good compatibility, no antagonism, can form stable functional flora, realize functional complementation and synergistic effect, and can be used for preparing bio-organic fertilizer, and solve the problems of single function of the microbial inoculant, antagonism between the strains, poor colonization effect in the organic fertilizer and poor product stability in the prior art.

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial and biofertilizer technology, specifically relating to a compound microbial agent, its preparation method, and its application. Background Technology

[0002] Cucumber wilt is caused by Fusarium oxysporum cucumber-specific strain (Fusarium oxysporum). Fusarium oxysporum F. sp. cucumerinum (FOC) is a devastating soil-borne disease that severely restricts the sustainable development of the cucumber industry. Traditional chemical control methods easily lead to problems such as increased pathogen resistance, pesticide residues, and environmental pollution. Developing bio-organic fertilizers using beneficial microorganisms, due to their dual effects of improving soil fertility and biological control, has become a research hotspot in green agricultural pest control.

[0003] Currently, commercially available bio-organic fertilizers and microbial agents suffer from problems such as limited functionality, inter-strain antagonism, weak colonization ability in organic fertilizer carriers, and unstable product quality. Furthermore, existing technologies lack systematic research on the compounding of functional strains and how to improve the colonization quantity and stability of functional bacteria in organic fertilizers by optimizing fermentation processes (especially key environmental factors in secondary fermentation). Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide a compound microbial agent, its preparation method, and its application. The compound microbial agent has good compatibility among strains, complementary functions, and can efficiently colonize in organic fertilizers. Its application in the production of bio-organic fertilizers can promote plant growth, control soil-borne diseases, improve rhizosphere microecology, and amend soil.

[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a compound microbial agent, wherein the compound microbial agent is composed of Pseudomonas aeruginosa. Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. Composed of DN15; In this invention, DL12 is Pseudomonas aeruginosa. Pseudomonas aeruginosa The strain name is classified as Pseudomonas aeruginosa. Pseudomonas aeruginosa It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38096, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. DL19 is Pseudomonas aeruginosa. Pseudomonas aeruginosaThe strain name is classified as Pseudomonas aeruginosa. Pseudomonas aeruginosa It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38097, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The DL292 is Bacillus belye. Bacillus velezensis The strain name is classified as Bacillus belesii. Bacillus velezensis It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38098, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The DN15 is Serratia marcescens. Serratia sp. The strain name is classified as Serratia marcescens. Serratia sp. It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38099, on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] Preferably, the *Pseudomonas aeruginosa* in the compound bacterial agent... Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. The volume ratio of DN15 was 0.8~1.2:0.8~1.2:0.8~1.2:0.8~1.2, and the effective viable count of each strain was not less than 1×10⁻⁶. 9 CFU / mL.

[0007] The present invention also provides a method for preparing the compound bacterial agent, comprising: incorporating the *Pseudomonas aeruginosa*... Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. DN15 was inoculated into culture medium and fermented to obtain fermentation broth for each strain; the fermentation broths of each strain were mixed to prepare a compound bacterial agent.

[0008] The present invention also provides the application of the composite microbial agent or the composite microbial agent prepared by the preparation method in any one or more of the following: A1. Preparation of bio-organic fertilizer products A2. Preparation of products for controlling the pathogen of Fusarium wilt. A3. Prevention and control of Fusarium wilt disease. A4. Promotes plant growth. A5. Regulate soil physical and chemical properties A6. Preparation of soil conditioner.

[0009] Preferably, the wilt disease is cucumber wilt. And / or, the pathogen causing cucumber wilt is *Fusarium oxysporum* cucumber-specific strain. Fusarium oxysporum f. sp. cucumerinum, And / or, the plant includes cucumber, And / or, the growth traits include one or more of plant height, stem diameter, root length, root-to-shoot ratio, and vigor index.

[0010] The present invention also provides the application of the compound microbial agent or the compound microbial agent prepared by the preparation method in improving the colonization quantity and / or stability of functional bacteria in organic fertilizer.

[0011] The present invention also provides a bio-organic fertilizer, wherein the bio-organic fertilizer comprises a compound microbial agent; (1) Adjust the decomposed organic fertilizer carrier to an initial pH of 7.0-7.2 and a moisture content of 50%-60%; (2) The compound microbial agent is inoculated into the organic fertilizer carrier treated in step (1) at an inoculation amount of 3% to 10% by mass volume; (3) Secondary fermentation is carried out at 30℃~35℃, and the fermentation cycle is 5~90 ​​days to obtain the bio-organic fertilizer.

[0012] The present invention also provides a method for preparing the bio-organic fertilizer, comprising the following steps: The compound microbial agent is obtained by inoculating the organic fertilizer carrier with it and then fermenting it.

[0013] The present invention also provides the application of the bio-organic fertilizer or the bio-organic fertilizer obtained by the preparation method in any one or more of the following: B1. Prevention and control of cucumber wilt disease B2, promotes cucumber growth. B3. Improve the planting soil.

[0014] Preferably, the wilt disease of cucumber is caused by *Fusarium oxysporum* cucumber-specific strain. Fusarium oxysporum f. sp. cucumerinum, the growth traits include one or more of the following: plant height, stem diameter, root length, root-to-shoot ratio, and seedling vigor index, and the soil is soil used for growing cucumbers. Compared with the prior art, the present invention has the following beneficial effects: This invention provides a compound microbial agent. The four strains screened in this invention (DL12, DL19, DL292, and DN15) were all isolated from compost sources. Systematic functional evaluation revealed that they possess multiple functions, including antagonistic effects against cucumber wilt caused by FOC (high inhibition rate against FOC), growth promotion (production of IAA, phosphorus solubilization, nitrogen fixation, etc.), and organic matter degradation (production of cellulase and protease). Antagonistic experiments verified that the combined strains have good compatibility, no antagonistic effects, and can form a stable functional microbial community, achieving complementary functions and synergistic effects. This multifunctional compound microbial agent is a multifunctional compound microbial agent with good inter-strain compatibility, complementary functions, and efficient colonization in organic fertilizers. It also possesses the ability to control wilt, promote cucumber growth, and improve planting soil.

[0015] This invention utilizes a compound microbial agent prepared from the four strains mentioned above (DL12, DL19, DL292, and DN15) to further prepare bio-organic fertilizer. This bio-organic fertilizer enhances the control of Fusarium wilt while promoting plant growth. During fermentation, the compound microbial agent effectively promotes the degradation of polysaccharides, cellulose, and proteins, increases humic acid content, significantly improves seed germination index, and enhances the inhibition rate of FOC (fermented organic carbon). This indicates that the invention not only increases the colonization of functional bacteria but also accelerates material decomposition, improving the overall quality of the organic fertilizer. The bio-organic fertilizer prepared by this invention significantly promotes plant height, stem diameter, root length, root-to-shoot ratio, and seedling vigor index, and significantly improves root architecture. Under FOC stress, this bio-organic fertilizer significantly reduces the Fusarium wilt disease index, significantly reduces the abundance of FOC in the rhizosphere, optimizes the rhizosphere microecological environment, and provides strong protection for healthy crop growth.

[0016] Biological Preservation Information: The Pseudomonas aeruginosa of this invention Pseudomonas aeruginosa DL12, strain name DL12, classified as Pseudomonas aeruginosa. Pseudomonas aeruginosa It is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 38096, deposited on April 9, 2026, and located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0017] The Pseudomonas aeruginosa of this invention Pseudomonas aeruginosa DL19, strain name DL19, classified as Pseudomonas aeruginosa. Pseudomonas aeruginosa It is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 38097, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0018] The Bacillus belesii described in this invention Bacillus velezensisDL292, strain name DL292, classified as Bacillus belye Bacillus velezensis It is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 38098, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0019] The Serratia marcescens of the present invention Serratia sp. DN15, strain name DN15, classified as Serratia marcescens. Serratia sp. It is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 38099, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0020] Figure 1 The phylogenetic trees for strains DL12, DL19, DL292 and DN15 in Example 1 are shown, where a is the phylogenetic tree of strain DL292, b is the phylogenetic tree of strains DL19 and DL12, and c is the phylogenetic tree of strain DN15.

[0021] Figure 2 The above are response surface plots of the optimal fermentation conditions in Example 3; where A is the response surface plot of the interaction between initial pH and initial moisture content on the viable cell count, B is the response surface plot of the interaction between initial pH and fermentation temperature on the viable cell count, and C is the response surface plot of the interaction between fermentation temperature and initial moisture content on the viable cell count.

[0022] Figure 3 The effects of different strains on seed germination index, viable cell count, and FOC inhibition rate during the expanded fermentation process of the compost pile in Example 3 are shown in Figure 3. A represents the effect of different strains on seed germination index during the expanded fermentation process of the compost pile in Example 3, B represents the effect of different strains on viable cell count during the expanded fermentation process of the compost pile in Example 3, and C represents the effect of different strains on FOC inhibition rate during the expanded fermentation process of the compost pile in Example 3.

[0023] Figure 4 The images show the Fourier transform infrared spectra of the bio-organic fertilizer before and after expanded fermentation in Example 3, where A represents CK, B represents Y1, C represents M1, and D represents BC.

[0024] Figure 5 The diagram shows the 2D-COS asynchronous graph of bio-organic fertilizer fermentation in Example 3, where A is CK, B is Y1, C is M1, and D is BC.

[0025] Figure 6The results show the dynamic changes in fluorescence index and humic acid content at different stages of bio-organic fertilizer fermentation in Example 3; where A represents the dynamic changes in fluorescence index at different stages of fermentation, and B represents the dynamic changes in humic acid content at different stages of fermentation.

[0026] Figure 7 The image shows the root growth of cucumber plants under different treatments in Example 1.

[0027] Figure 8 The results of using bio-organic fertilizer in Example 1 to control cucumber wilt disease are shown. The color represents the effect of soil-borne pathogens on the treatment, with red indicating poor resistance and blue indicating excellent resistance.

[0028] Figure 9 The image shows the root growth of cucumber plants under different treatments of FOC stress in Example 1.

[0029] Figure 10 The values ​​of pH and EC in potted plants under different treatments in Example 1 are given, where A is the pH in potted plants under different treatments and B is the EC in potted plants under different treatments.

[0030] Figure 11 The different treatments in Example 1 were used to measure the available potassium, available phosphorus, ammonia nitrogen, and nitrate nitrogen content in the potted soil. Here, A represents available potassium content, B represents available phosphorus content, C represents ammonia nitrogen content, and D represents nitrate nitrogen content. Detailed Implementation

[0031] This invention provides a compound microbial agent, wherein the compound microbial agent is composed of Pseudomonas aeruginosa. Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. Composed of DN15; DL12 is Pseudomonas aeruginosa. Pseudomonas aeruginosa The strain name is classified as Pseudomonas aeruginosa. Pseudomonas aeruginosa It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38096, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. DL19 is Pseudomonas aeruginosa. Pseudomonas aeruginosa The strain name is classified as Pseudomonas aeruginosa. Pseudomonas aeruginosaIt is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38097, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The DL292 is Bacillus belye. Bacillus velezensis The strain name is classified as Bacillus belesii. Bacillus velezensis It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38098, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The DN15 is Serratia marcescens. Serratia sp. The strain name is classified as Serratia marcescens. Serratia sp., deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38099, deposited on April 9, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0032] In this invention, the *Pseudomonas aeruginosa* in the compound bacterial agent... Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. The preferred volume ratio of DN15 is 0.8~1.2:0.8~1.2:0.8~1.2:0.8~1.2, more preferably 0.9~1.1:0.9~1.1:0.9~1.1:0.9~1.1, and most preferably 1:1:1:1; further preferably, the effective viable count of each strain is not less than 1×10⁻⁶. 9 CFU / mL.

[0033] The present invention also provides a method for preparing the compound bacterial agent, comprising: incorporating the *Pseudomonas aeruginosa*... Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp.DN15 cells were inoculated into culture medium and fermented to obtain fermentation broths for each strain. The fermentation broths of each strain were then mixed to prepare a compound bacterial agent. The culture medium is preferably LB broth medium. The fermentation temperature is preferably 28-37℃, more preferably 28-35℃, more preferably 28-30℃, and most preferably 28℃. The fermentation time is preferably 24-48 h, more preferably 24-42 h, more preferably 24-36 h, and most preferably 24 h. The fermentation speed is preferably 150-220 r / min, more preferably 160-210 r / min, more preferably 170-200 r / min, and most preferably 180 r / min. Before fermentation, a seed culture is preferably obtained. The seed culture is prepared by inoculating *Pseudomonas aeruginosa* with... Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. DN15 cells were inoculated into activation medium and cultured at 28-37℃ to obtain single colonies. Single colonies were then picked and inoculated into seed culture medium, and cultured with shaking to prepare seed culture. The activation medium was preferably LB broth medium, and the culture temperature was preferably 28-35℃, more preferably 28-30℃, and most preferably 28℃. The activation time was preferably 24-48 h, further preferably 24-42 h, more preferably 24-36 h, and most preferably 24 h. The activation rotation speed was preferably 150-220 r / min, further preferably 160-210 r / min, more preferably 170-200 r / min, and most preferably 180 r / min. The seed culture was preferably inoculated into fermentation medium at a volume inoculation rate of 1%-10%, more preferably 3%-8%, and more preferably 5%. Finally, the fermentation broths of the four strains were mixed uniformly at different volume ratios (1-2):(1-2):(1-2):(1-2) to obtain a total effective viable count of not less than 1×10⁻⁶. 9 A compound bacterial agent with CFU / mL.

[0034] The present invention also provides the application of the composite microbial agent or the composite microbial agent prepared by the preparation method in any one or more of the following: A1. Preparation of bio-organic fertilizer products A2. Preparation of products for controlling the pathogen of Fusarium wilt. A3. Prevention and control of Fusarium wilt disease. A4. Promotes plant growth. A5. Regulate soil physical and chemical properties A6. Preparation of soil conditioner.

[0035] In the above applications of the present invention, the wilt disease is preferably cucumber wilt disease, and the pathogen causing cucumber wilt disease is preferably *Fusarium oxysporum* cucumber-specific strain. Fusarium oxysporum f. sp. cucumerinum, the plant is preferably cucumber, and the growth traits include cucumber plant height, stem diameter, root length, root-to-shoot ratio and / or seedling vigor index.

[0036] This invention also provides the application of the compound microbial agent or the compound microbial agent prepared by the method described above in improving the colonization quantity and / or stability of functional bacteria in organic fertilizer. The bio-organic fertilizer obtained by fermentation of the compound microbial agent or the compound microbial agent prepared by the method described above with an organic fertilizer carrier still has a good number of viable bacteria after 90 days, indicating that the compound microbial agent of this invention improves the colonization quantity and / or stability of functional bacteria in organic fertilizer.

[0037] This invention also provides a bio-organic fertilizer, comprising the compound microbial agent or the compound microbial agent prepared by the aforementioned method and an organic fertilizer carrier, wherein the organic fertilizer carrier comprises decomposed vegetable residues and sawdust. The bio-organic fertilizer of this invention must have an effective viable bacteria count greater than or equal to 3 × 10⁻⁶. 8 CFU / g. Verification has shown that the effective viable bacteria count of the bio-organic fertilizer described in this invention can reach 4 × 10⁻⁶. 8 CFU / g ~8×10 8 CFU / g, further preferably 5×10 8 CFU / g ~ 7×10 8 CFU / g, more preferably 5.55×10 8 CFU / g.

[0038] The present invention also provides a method for preparing the aforementioned bio-organic fertilizer, comprising the following steps: (1) Adjust the decomposed organic fertilizer carrier to an initial pH of 7.0-7.2 and a moisture content of 50%-60%; (2) The compound microbial agent is inoculated into the organic fertilizer carrier treated in step (1) at an inoculation amount of 3% to 10% by mass volume; (3) Secondary fermentation is carried out at 30℃~35℃, and the fermentation cycle is 5~90 ​​days to obtain the bio-organic fertilizer.

[0039] In the preparation method of the bio-organic fertilizer, the decomposed organic fertilizer carrier is preferably adjusted to an initial pH of 7.14, the moisture content of the decomposed organic fertilizer carrier is preferably 55.72%, the inoculum amount is further preferably 5%~10%, and most preferably 10%; the temperature of the secondary fermentation is further preferably 34.3℃; the fermentation period of the secondary fermentation is further preferably 10~90 days, more preferably 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3 The organic fertilizer carrier can be any one of the following: 1, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and 90 days, with 90 days being the most preferred. As an optional implementation, the organic fertilizer carrier of this invention is well-rotted vegetable waste organic fertilizer provided by Beijing Shunyi District Shared Harvest Organic Farm. The secondary fermentation refers to the fermentation of the matured organic fertilizer carrier of the present invention. Therefore, the fermentation of the compound microbial agent into the matured organic fertilizer carrier is called secondary fermentation.

[0040] This invention also provides the application of the bio-organic fertilizer or the bio-organic fertilizer obtained by the preparation method in any one or more of the following: B1, prevention and control of cucumber wilt disease; B2, promotion of cucumber growth; B3, improvement of planting soil. Preferably, the pathogen causing cucumber wilt disease is *Fusarium oxysporum* cucumber-specific strain. Fusarium oxysporum f.sp. cucumerinum, the growth traits preferably include cucumber plant height, stem diameter, root length, root-to-shoot ratio and / or seedling vigor index; the soil is preferably soil for growing cucumbers.

[0041] The compound microbial agent described in this invention may also contain other active ingredients. The product of this invention can be used alone or in combination with other excipients and / or products.

[0042] The compound microbial agent described in this invention exhibits complementary and synergistic effects. The four strains screened in this invention (DL12, DL19, DL292, and DN15) were all isolated from compost sources. Systematic functional evaluation revealed that they possess multiple functions, including antagonistic effects against FOC (high inhibition rate against FOC), growth promotion (production of IAA, phosphorus solubilization, nitrogen fixation, etc.), and organic matter degradation (production of cellulase and protease). Antagonism tests verified that the combined strains have good compatibility, no antagonistic effects, and can form a stable functional microbial community, achieving complementary and synergistic effects.

[0043] The compound microbial agent of this invention can achieve an effective viable bacteria count of up to 5.55 × 10⁻⁶ in organic fertilizer. 8 The CFU / g and viable bacterial count can be stably maintained at 4.57 × 10⁻⁶ for a long period of time. 8 The concentration is above CFU / g, far exceeding the requirement of 0.20 billion / g in the national standard for bio-organic fertilizer (NY 884-2012).

[0044] The bio-organic fertilizer prepared by the compound microbial agent of this invention can effectively promote the degradation of polysaccharides, cellulose, and proteins during fermentation, increase humic acid content (up to 35.25 mg / kg), significantly improve seed germination index (GI up to 133.07%), and enhance the inhibition rate of FOC. This indicates that the present invention not only increases the colonization of functional bacteria but also accelerates material decomposition and improves the overall quality of organic fertilizer.

[0045] The bio-organic fertilizer prepared by the compound microbial agent of this invention has significant growth-promoting and biocontrol effects. The bio-organic fertilizer prepared by this invention significantly promotes the growth of cucumber seedlings, increasing plant height, stem diameter, and seedling vigor index by 36.70%, 52.01%, and 67.74%, respectively, and significantly improving root structure. Under FOC stress, this bio-organic fertilizer significantly reduces the disease index of cucumber wilt, with a control effect superior to the commercial microbial agent control. It also upregulates the expression of plant defense genes (such as PR3) and significantly reduces the abundance of FOC in the rhizosphere. The bio-organic fertilizer prepared by the compound microbial agent of this invention can also improve the rhizosphere microecology and significantly enrich beneficial functional bacteria in the rhizosphere soil (such as...). Bacillus , Thermobifida ), and enhance the connectivity of bacterial community networks; in fungal communities, it can enrich groups with repair potential (such as Phialemonium This optimizes the rhizosphere microecological environment, providing a strong guarantee for the healthy growth of crops.

[0046] The *Fusarium oxysporum* species described in the following embodiments of the present invention is a cucumber-specific variant of *Fusarium oxysporum*. Fusarium oxysporum f. sp. cucumerinum (FOC), strain number HG1901020102, was purchased from the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences.

[0047] The cucumber variety described in the following embodiments of the present invention is 'Jinyan No. 4', and its source is not further limited; any commercially available product of the same type can be used.

[0048] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; and the materials and reagents used are commercially available unless otherwise specified.

[0049] Example 1 Screening and Identification of Multifunctional Complex Strains 1. Strains screening Starting with 22 strains of Fusarium oxysporum antagonistic activity isolated from previous compost (the organic fertilizer used in the fermentation experiment was taken from the Shared Harvest Organic Farm in Shunyi District, Beijing), a cucumber-specific strain of Fusarium oxysporum was used. Fusarium oxysporum f. sp. cucumerinum was screened for plate activity and evaluated for its growth-promoting properties, including cellulase production, protease production, IAA production, phosphorus solubilization, nitrogen fixation, siderophore production, and emulsification ability. The Boitur scoring system was used for comprehensive evaluation.

[0050] The physicochemical properties of the raw materials for the initial compost (i.e., organic fertilizer from vegetable waste) are shown in Table 1 below; the 22 strains obtained by screening and their antagonistic activities, growth-promoting characteristics, and their ability to be used as PGPRs are shown in Table 2.

[0051] Table 1 Physicochemical Properties of Vegetable Tail Organic Fertilizer Raw Materials

[0052] Table 2. Overall evaluation results of 22 strains with antagonistic activity against Fusarium oxysporum.

[0053] Note: XW represents cellulase production capacity, DB represents protease production capacity, HX represents hemolysis capacity, OP represents organophosphate solubilization capacity, K represents potassium solubilization capacity, and IN represents nitrogen fixation capacity; all capacity ratings are (1 = capable, 0 = incapable). IP represents inorganic phosphorus solubilization capacity (3 = phosphorus solubilization capacity, 0 = no phosphorus solubilization capacity). CAS represents siderophore secretion capacity (3 = strong secretion capacity, 2 = weak secretion capacity, 0 = no secretion capacity). IAA represents IAA production capacity (mg / L, 3 = 11.54~15.38, 2 = 7.69~11.54, 1 = 0~7.69, 0 = no secretion capacity). EI 24 The percentage represents emulsifying ability (%, 2=26.67~53.39, 1=0~26.67, 0=no secretion ability). The antibacterial rate represents FOC inhibition rate (%, 4=56.44~70.55, 3=42.33~56.44, 2=28.22~42.33, 1=0~28.22, 0=no FOC inhibition ability).

[0054] According to the results in Table 2, strains DL12, DL19, D37, and D20 had the highest overall scores (≥17 points). Antagonism tests revealed that the high-scoring strain D37 exhibited significant antagonism with several Pseudomonas strains, while DL292 showed better compatibility and possessed the ability to dissolve organophosphates.

[0055] Taking into account both functional complementarity and niche diversity, the optimal combination was determined to be: DL12, DL19, DL292 and DN15.

[0056] 2. Biological identification of strains To achieve accurate classification and identification of the above-mentioned strains, PCR amplification was performed using their respective genomic DNA as templates and 16S rRNA gene primers: 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1) and 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO.2) to obtain 16S rRNA gene fragments. Subsequently, the sequences of the amplified 16S rRNA gene fragments were aligned on NCBI to construct a phylogenetic tree for each strain and clarify their taxonomic position.

[0057] The 16S rRNA gene fragments of DL12, DL19, DL292, and DN15 are as follows:

[0058]

[0059]

[0060]

[0061] pass Figure 1 Phylogenetic tree analysis showed that strains DL12, DL19, DL292, and DN15, in order, are: *Pseudomonas aeruginosa* (…). Pseudomonas aeruginosa ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa Bacillus belesiensis ( Bacillus velezensis ) and Serratia ( Serratia sp.).

[0062] Based on the above physiological and biochemical index measurements, molecular sequencing, and phylogenetic tree analysis results, the final identification results are as follows: Strain DL12 is Pseudomonas aeruginosa Pseudomonas aeruginosa It was deposited on April 9, 2026 at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 38096, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0063] Strain DL19 is also a Pseudomonas aeruginosa. Pseudomonas aeruginosa It was deposited on April 9, 2026 at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCCNo.38097, located at No.3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0064] Strain DL292 is Bacillus belye Bacillus velezensis It was deposited on April 9, 2026 at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 38098, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0065] Strain DN15 is Serratia marcescens. Serratia sp. It was deposited on April 9, 2026 at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 38099, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0066] Example 2 Multifunctional compound microbial agent formulation The *Pseudomonas aeruginosa* strain obtained in Example 1 was screened. Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa ( Pseudomonas aeruginosa DL19, Bacillus belysinus ( Bacillus velezensis DL292 and Serratia marcescens ( Serratia(sp.) DN15, each strain was inoculated into LB broth medium for activation, and cultured at 28℃ to obtain single colonies; single colonies were picked and inoculated into seed culture medium, and shaken to prepare seed culture. LB broth medium was used as the seed culture medium, and the culture was carried out at 28℃ and shaken at 180 r / min for 24 h; then the seed culture was inoculated into fermentation medium at a volume of 5%, and fermented at 28℃ and 180 r / min for 24 h to scale up the culture to a concentration of 1×10⁻⁶. 9 CFU / mL was used to obtain the fermentation broth for each strain; finally, the fermentation broths of the four strains were mixed uniformly at a volume ratio of 1:1:1:1 to obtain a total effective viable count of not less than 1×10⁻⁶. 9 Y1 is a multifunctional compound bacterial agent with a concentration of CFU / mL.

[0067] Example 3 I. Optimization of colonization conditions for compound microbial agents in organic fertilizers Using well-rotted vegetable residue organic fertilizer (raw materials include vegetable residues and sawdust, etc.) provided by Beijing Shunyi District Shared Harvest Organic Farm as a carrier, and the effective viable count of the multifunctional compound microbial agent Y1 prepared in Example 2 as the response value, Plackett-Burman design was used to screen factors such as initial pH, KH2PO4 content, (NH4)2SO4 content, fermentation temperature, and moisture content.

[0068] Figure 2 The results showed that initial pH, fermentation temperature, and moisture content had a significant impact on the viable cell count. P The values ​​were all <0.05, and all were positive effects. Further, the maximum response region was approximated through the steepest ramp test to determine the center point. A three-factor, three-level experiment was designed using the Box-Benhnken response surface methodology to establish a quadratic regression model.

[0069] pass Figure 2 The model optimization results determined the optimal colonization conditions to be: initial pH 7.14, fermentation temperature 34.3℃, and moisture content 55.72%. The model predicted a viable cell count of up to 5.55 × 10⁻⁶. 8 CFU / g.

[0070] II. Preparation and Scale-up Verification of the Optimized Bio-organic Fertilizer Preparation of bio-organic fertilizer: Take well-rotted vegetable waste organic fertilizer (i.e., the well-rotted vegetable residue organic fertilizer provided by the Beijing Shunyi District Shared Harvest Organic Farm mentioned above), and adjust the initial pH to 7.14 and the moisture content to 55.72% according to the optimal colonization conditions determined in Example 3. Inoculate the above organic fertilizer with the multifunctional compound bacterial agent Y1 prepared in Example 2 at an inoculation rate of 10% (100 mL bacterial solution / 1 kg dry basis). After mixing, place it in an 8 L stainless steel reactor and carry out aerobic secondary fermentation at 34.3℃ for 7 days. During the fermentation, the compost is turned regularly to obtain bio-organic fertilizer.

[0071] On the 7th day of fermentation, the number of viable bacteria in the prepared bio-organic fertilizer was tested, and the actual number of viable bacteria reached 5.50 × 10⁻⁶. 8 The CFU / g value is in high agreement with the model prediction.

[0072] The germination index of cucumber seeds was determined using this bio-organic fertilizer.

[0073] The seed germination index (GI) was determined as follows: 10 g of fresh bio-organic fertilizer sample was placed in a 250 mL plastic bottle. 100 mL of deionized water was added at a solid-liquid ratio of 1:10. The mixture was shaken on a shaker at 25℃ and 200 r / min for 30 min. After filtration, the extract was obtained. A filter paper was placed in a petri dish, and 10 plump radish seeds were evenly placed on it. 5 mL of the compost extract was added. The mixture was incubated at 25℃ in the dark for 48 h before measurement. The treatment with added deionized water served as a control. Each sample was tested in triplicate. The calculation method is shown in Formula 1. Tests showed that the germination index of cucumber seeds obtained from the fermentation of the multifunctional compound microbial agent Y1 reached 139.36%.

[0074] III. Testing of the colonization capacity and stability of bio-organic fertilizer To monitor the colonization capacity and stability of the bio-organic fertilizer, the number of viable bacteria was continuously monitored after 90 days of storage, that is, the bio-organic fertilizer was continuously sampled over 90 days.

[0075] Simultaneously, the bio-organic fertilizer obtained by fermentation of the multifunctional compound microbial agent Y1 was compared with the bio-organic fertilizer fermented by the commercial microbial agent control group. The fermentation method of the bio-organic fertilizer fermented by the commercial microbial agent control group was the same as the preparation method of the bio-organic fertilizer described above. Among them, the commercial microbial agent control group was divided into two groups: commercial microbial agent control group 1 and commercial microbial agent control group 2. Commercial microbial agent control group 1 was designated as M1, which included SY (maltophilic oligotrophosome), BY (Bacillus belye), and PY (Pseudomonas aeruginosa). SY is maltophilic oligotrophosome (ATCC 51331), and PY is Pseudomonas aeruginosa (ATCC 9027). Both were single commercial microbial agents and were purchased from the Beijing Microbial Culture Collection Center. BY is *Bacillus belyssus* sourced from the Institute of Organic Cycling, China Agricultural University (Suzhou), with biological preservation number CGMCC No. 23398; BC is a commercial compound bacterial powder preparation purchased from Zhongke Chemical Co., Ltd., with registration code Microbial Fertilizer (2021) License No. (10703); the preparation method of M1 is as follows: after activating SY (maltophilic oligotrophozoites), BY (*Bacillus belyssus*), and PY (*Pseudomonas aeruginosa*), after each being cultured on a large scale, the fermentation broths of SY, BY, and PY are mixed uniformly at a volume ratio of 1:1:1. The commercial bacterial agent control group 2 is designated as BC, a commercial compound bacterial powder preparation purchased from Zhongke Chemical Co., Ltd.; this preparation consists of *Bacillus subtilis*, *Bacillus licheniformis*, *Bacillus amyloliquefaciens*, and *Bacillus amyloliquefaciens*.

[0076] Before inoculation for bio-organic fertilizer fermentation, the viable count of the bacterial strains involved in the experimental and control groups was tested to ensure that the viable count reached 1×10⁻⁶ at the time of inoculation. 8 CFU / g level. At the end of fermentation, the total viable count of Y1 in this bio-organic fertilizer remained stable at 4.57 × 10⁻⁶. 8 With CFU / g or higher, the seed germination index still reached 133.07%, and the antibacterial rate against FOC was significantly higher than that of the commercial inoculant control group. Figure 3 After 90 days of fermentation, the viable bacteria count in group Y1 increased by 92.28% compared to the control and by 37.23% compared to the commercial control (mL); the antibacterial rate of Y1 increased by 10.31% compared to the control. This indicates that the viable bacteria count of the multifunctional compound microbial agent Y1 of the present invention is superior to that of the commercial microbial agent control group, and it has better colonization ability and stability in the preparation of bio-organic fertilizer.

[0077] according to Figure 4 , Figure 5 , Figure 6Correlation analysis using Fourier transform infrared spectroscopy, 2D-COS asynchronous plots, and two-dimensional correlation spectroscopy showed that the Y1 treatment group effectively promoted the degradation of polysaccharides, cellulose, and proteins in the bio-organic fertilizer. After 90 days of fermentation, the humic acid content reached 35.25 mg / kg, an increase of 19.86% compared to the control group. After 90 days of storage, the humic acid content of the fermented bio-organic fertilizer was higher than that of other commercial microbial agents in the control group, and the humic acid content showed a linear upward trend, becoming more stable.

[0078] Application Example 1 1. Pot experiment on the growth-promoting effect of bio-organic fertilizer: Using cucumber (variety: Jinyan No. 4) as the test subject, a potted plant growth promotion experiment was conducted. The amount of fertilizer applied to each pot was 900g of sterile soil mixed with 100g of bio-organic fertilizer or organic fertilizer.

[0079] Seven treatments were set up, including no fertilizer (CK), organic fertilizer without secondary fermentation (i.e., well-rotted vegetable waste organic fertilizer provided by Beijing Shunyi District Shared Harvest Organic Farm, denoted CC), unfermented organic fertilizer (i.e., well-rotted vegetable waste organic fertilizer provided by Beijing Shunyi District Shared Harvest Organic Farm) + compound microbial agent Y1 (CCM), and bio-organic fertilizer (CY) prepared in Example 3. See Table 3 for details. All bio-organic fertilizers in Table 3 were fermented for 90 days.

[0080] Among them, the CK group's bio-organic fertilizer is made from well-rotted vegetable waste organic fertilizer provided by Beijing Shunyi District Shared Harvest Organic Farm, fermented for 90 days without any additives.

[0081] Y1 group of bio-organic fertilizer was made by adjusting the initial pH to 7.14 and the moisture content to 55.72% of the well-rotted vegetable waste organic fertilizer provided by Beijing Shunyi District Shared Harvest Organic Farm. Y1 microbial agent was added and fermented for 90 days (that is, the multifunctional compound microbial agent Y1 prepared in Example 2 was inoculated into the above organic fertilizer at an inoculation rate of 10% (100 mL of bacterial solution / 1 kg dry basis), mixed well, and then carried out aerobic secondary fermentation at 34.3℃ for 90 days, during which the compost was turned regularly to obtain bio-organic fertilizer).

[0082] The M1 group of bio-organic fertilizer was made by adjusting the initial pH to 7.14 and the moisture content to 55.72% with well-rotted vegetable waste organic fertilizer provided by Beijing Shunyi District Shared Harvest Organic Farm. M1 microbial agent was added and fermented for 90 days (i.e., at an inoculation rate of 10% (100 mL of bacterial solution / 1 kg dry basis), the commercial microbial agent control group 1 (M1) described in Example 3 was inoculated into the above organic fertilizer, mixed well, and then subjected to aerobic secondary fermentation at 34.3℃ for 90 days, with regular turning during the period to obtain bio-organic fertilizer).

[0083] The BC group of bio-organic fertilizer was prepared by adjusting the initial pH to 7.14 and the moisture content to 55.72% with well-rotted vegetable waste organic fertilizer provided by Beijing Shunyi District Shared Harvest Organic Farm. M1 microbial agent was added and fermented for 90 days (i.e., the commercial microbial agent control group 2 (BC) described in Example 3 was inoculated into the above organic fertilizer at an inoculation rate of 10% (100 mL of bacterial solution / 1 kg dry basis), mixed well, and then subjected to aerobic secondary fermentation at 34.3℃ for 90 days, with regular turning during the period to obtain bio-organic fertilizer).

[0084] Table 3. Specific experimental treatments for each treatment.

[0085] Statistics of each process , Then, the cucumber seedling strength index is calculated.

[0086] The results showed that the CY treatment group had the best effect on promoting the growth of cucumber seedlings. Compared with the CK group, the plant height, stem diameter, and seedling vigor index of the CY group were significantly increased by 36.70%, 52.01%, and 67.74%, respectively (see Table 4); the total root length and total root surface area were significantly increased by 21.59% and 38.89%, respectively (see Table 4). Figure 7 Rhizosphere microbial community analysis showed that the CY group soil contained... Bacillus , Thermobifida Functional bacteria were significantly enriched, and the connectivity of the bacterial community network was enhanced.

[0087] Table 4. Effects of different treatments on cucumber plant morphogenesis

[0088] Note: Different lowercase letters indicate different... P The difference was significant at the <0.05 level.

[0089] 2. Pot experiment on the biocontrol effect of biological organic fertilizer: The bio-organic fertilizer prepared in Example 4 was inoculated with FOC spore suspension (concentration of 10) using the root-damage irrigation method. 8 The CFU / mL concentration was calculated, and seven treatments were set up, including a positive control (pathogen only, F0), pathogen and unfermented organic fertilizer (FC), pathogen and Y1 bio-organic fertilizer (FY), as detailed in Table 5. The concentrations were statistically analyzed and calculated. result.

[0090] The disease grading standards for cucumber wilt are as follows: Grade 0, no withered leaves; Grade 1: Wilted leaves or wilted area account for 1 / 4 or less of the entire plant; Grade 2: withered leaves or wilted area account for 1 / 2 of the total plant area; Level 3: Wilted leaves or wilted area account for 3 / 4 of the total plant area; Level 4: All leaves are wilted or dead.

[0091] Table 5 Specific Implementation Conditions for Different Treatments with Different Biocontrol Effects of Bio-organic Fertilizer

[0092] Note: The soil weight per pot is approximately 1 kg; the amount of FOC spore suspension added is 50 mL. The concentration of the FOC spore suspension is 10. 8 CFUs / mL.

[0093] according to Figure 8 The FY treatment group had the lowest disease index and its prevention and control effect was better than that of the commercial bacterial agent treatment group. Figure 9 The results showed that compared with the positive control (F0), the root-to-shoot ratio of the FY group increased by 19.23%, and the total root length and total root surface area increased significantly by 241.69% and 208.46%, respectively. Rhizosphere FOC abundance determination showed that the number of FOCs in the rhizosphere of the FY group was significantly decreased. Simultaneously, the expression of the plant defense gene PR3 was significantly upregulated, and FOCs in the rhizosphere soil were significantly increased. Phialemonium Enrichment of fungal groups with repair potential.

[0094] according to Figure 10 The soil pH in the cucumber wilt stress group was slightly lower than that in the growth promotion group. This may be because FOC dominates the microbial community, leading to reduced microbial activity and thus a decrease in pH. The pH difference between the treatment groups was not significant. Regarding soil EC, the EC values ​​of each treatment group in the stress group were higher than those of the corresponding control group (F0 group). This may be due to the addition of nutrients such as organic fertilizer, bio-organic fertilizer, or pathogen inoculum to the potted plants. The EC content in the cucumber wilt stress group was generally higher than that in the growth promotion group. This may be related to the additional application of soil-borne pathogen inoculum to the cucumber wilt stress group.

[0095] according to Figure 11 It is evident that under FOC stress, the concentration of available potassium in the control group was significantly lower than that in all fertilized treatment groups, indicating that the addition of exogenous nutrients can significantly increase the content of available potassium in the soil. Among them, the treatment of direct application of ordinary organic fertilizer without secondary fermentation (FC) had a significantly higher concentration of available potassium than other treatments. This may be because the microbial agent itself has the ability to solubilize potassium, which promotes the conversion or utilization of potassium during metabolism, thereby reducing the accumulation of available potassium in the soil.

[0096] Similar to the trend of available potassium, the concentration of available phosphorus in the control group was much lower than that in all treatment groups, indicating that inoculation with nutrients is a key factor in improving soil phosphorus availability. In the fertilization groups, there were differences between the treatments, but they were not significant. However, the available phosphorus in the FY group was higher than that in other treatments that applied bio-organic fertilizer. This may be because the inoculant has the ability to dissolve phosphorus, which causes the insoluble phosphorus in the compost to be converted into phosphorus that can be absorbed by plants, thus increasing the available phosphorus in the potted plants.

[0097] Although there were significant differences in ammonium nitrogen concentration between the control group and each treatment group, the overall ammonium nitrogen concentration in all treatment groups was at a low level. This reflects that cucumber plants effectively absorbed and utilized ammonium nitrogen in the soil during the pot experiment, resulting in less residue in the soil. Even with the application of different organic materials, ammonium nitrogen did not accumulate in large quantities, indicating that this form of nitrogen has high availability in plant nitrogen nutrition.

[0098] In contrast to ammonium nitrogen, the difference in nitrate nitrogen concentration between the control group and each treatment group was extremely significant, indicating that the application of nutrients such as organic fertilizer or bio-organic fertilizer can greatly increase the soil nitrate nitrogen level. Among the fertilization groups, the treatment with bio-organic fertilizer had the highest nitrate nitrogen concentration, which may be related to the metabolic activity of functional microorganisms in bio-organic fertilizer, which promotes the mineralization or nitrification of organic nitrogen, thus making nitrate nitrogen the main accumulation form of soil nitrogen.

[0099] In summary, the multifunctional compound microbial agent and the bio-organic fertilizer prepared by this invention have shown excellent application potential in promoting crop growth, controlling soil-borne wilt disease, and restoring and improving the soil rhizosphere microecology.

[0100] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A compound microbial agent, characterized in that, The compound bacterial agent is composed of Pseudomonas aeruginosa. Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. Composition of DN15; the aforementioned Pseudomonas aeruginosa Pseudomonas aeruginosa The preservation number of DL12 is CGMCC No. 38096; the *Pseudomonas aeruginosa* described Pseudomonas aeruginosa The accession number for DL19 is CGMCC No. 38097; the described Bacillus belesii Bacillus velezensis The preservation number of DL292 is CGMCC No. 38098; the *Serratia marcescens* described Serratia sp. The accession number for DN15 is CGMCC No.38099.

2. The compound microbial agent according to claim 1, characterized in that, The *Pseudomonas aeruginosa* in the compound microbial agent Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. The volume ratio of DN15 was 0.8~1.2:0.8~1.2:0.8~1.2:0.8~1.2, and the effective viable count of each strain was not less than 1×10⁻⁶. 9 CFU / mL.

3. The method for preparing the compound microbial agent as described in claim 1 or 2, characterized in that, Including the aforementioned Pseudomonas aeruginosa Pseudomonas aeruginosa DL12, Pseudomonas aeruginosa Pseudomonas aeruginosa DL19, Bacillus belye Bacillus velezensis DL292 and Serratia marcescens Serratia sp. DN15 was inoculated into culture medium and fermented to obtain fermentation broth for each strain; the fermentation broths of each strain were mixed to prepare a compound bacterial agent.

4. The application of the compound microbial agent as described in claim 1 or 2, or the compound microbial agent prepared by the preparation method described in claim 3, in any one or more of the following: A1. Preparation of bio-organic fertilizer products A2. Preparation of products for controlling the pathogen of Fusarium wilt. A3. Prevention and control of Fusarium wilt disease. A4. Promotes plant growth. A5. Regulate soil physical and chemical properties A6. Preparation of soil conditioner.

5. The application according to claim 4, characterized in that, The wilt disease mentioned is cucumber wilt. And / or, the pathogen causing cucumber wilt is *Fusarium oxysporum* cucumber-specific strain. Fusarium oxysporum f.sp. cucumerinum, And / or, the plant includes cucumber, And / or, the growth traits include one or more of plant height, stem diameter, root length, root-to-shoot ratio, and vigor index.

6. The application of the compound microbial agent as described in claim 1 or 2, or the compound microbial agent prepared by the preparation method described in claim 3, in improving the colonization quantity and / or stability of functional bacteria in organic fertilizer.

7. A bio-organic fertilizer, characterized in that, The bio-organic fertilizer contains a compound microbial agent; The compound microbial agent is the compound microbial agent according to claim 1 or 2, or the compound microbial agent prepared by the preparation method according to claim 3.

8. The method for preparing bio-organic fertilizer as described in claim 7, characterized in that, Includes the following steps: (1) Adjust the decomposed organic fertilizer carrier to an initial pH of 7.0-7.2 and a moisture content of 50%-60%; (2) The compound microbial agent is inoculated into the organic fertilizer carrier treated in step (1) at an inoculation amount of 3% to 10% by mass volume; (3) Secondary fermentation is carried out at 30℃~35℃, and the fermentation cycle is 5~90 ​​days to obtain the bio-organic fertilizer.

9. The use of the bio-organic fertilizer according to claim 7 or the bio-organic fertilizer obtained by the preparation method according to claim 8 in any one or more of the following: B1. Prevention and control of cucumber wilt disease B2, promotes cucumber growth. B3. Improve the planting soil.

10. The application as described in claim 9, characterized in that, The cucumber wilt disease is caused by *Fusarium oxysporum* cucumber-specific strain. Fusarium oxysporum f. sp. cucumerinum, the growth traits include one or more of plant height, stem diameter, root length, root-to-shoot ratio and seedling vigor index, and the soil is soil used for growing cucumbers.

Images