Pediococcus acidilactici degrading purine nucleotides and fermented soy milk thereof, and application in improving hyperuricemia and inflammation

Abstract

The application discloses a lactococcus lactis capable of degrading purine nucleotides and fermented soymilk thereof, and application in improving hyperuricemia and inflammation, wherein the lactococcus lactis is preserved in the China General Microbiological Culture Collection Center on November 20, 2025, and the preservation number is CGMCC No. 36696. The strain provided by the application is the lactococcus lactis grx816 with high efficient purine nucleotide degradation capability, can significantly inhibit potential pathogenic bacteria such as escherichia coli, klebsiella pneumoniae and bacillus cereus in the intestinal tract, and can be used for preparing low purine fermented soymilk and application in reducing hyperuricemia and inflammation.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a type of Pietrococcus lactis that degrades purine nucleotides and its applications. Background Technology

[0002] Hyperuricemia is a common chronic metabolic disease caused by disordered purine metabolism or reduced uric acid excretion. With improved living standards and changes in dietary structure, the incidence of hyperuricemia is rising year by year and showing a trend towards affecting younger people, making it the "fourth highest" threat to human health. Uric acid in the human body is mainly produced from purines in food and from the metabolism of purines synthesized within the body. Studies have shown that excessive intake of purine nucleotides in the diet is a significant exogenous factor leading to elevated uric acid concentrations in the blood.

[0003] Soy products, as an important dietary source of plant protein, occupy a significant place in daily diets. However, traditional dried soy products (such as tofu and dried bean curd sticks) generally have extremely high purine abundance due to their low water content and highly concentrated protein and exogenous purines. Therefore, they are usually not recommended for people with high uric acid and gout in clinical practice. In contrast, soy milk beverages, due to the water regulation and solid-liquid separation characteristics of their processing technology, have a significantly lower purine content per unit volume than traditional dried soy products. More importantly, soy milk substrates retain abundant soy isoflavones (such as flavonoid glycosides), special short-chain peptides, and natural antioxidant active substances. Modern biomedical research shows that these endogenous active substances in soybeans have auxiliary regulatory effects in scavenging free radicals, anti-inflammation, and comprehensively improving the host's hyperuricemia syndrome. Therefore, developing low-purine soy milk products has unique dietary advantages for people with high uric acid to obtain plant protein nutrition.

[0004] Lactic acid bacteria play an important role in regulating the intestinal microecology and reducing inflammation. In recent years, utilizing probiotics to degrade food-derived purines in the intestine and block their absorption, thereby preventing and alleviating hyperuricemia at its source, has been considered a safe and effective method. To further degrade the residual purine content of soy milk substrates while preserving their original core nutrients and functional active substances, fermentation with lactic acid bacteria is currently recognized as a safe and effective approach. Therefore, developing a probiotic lactic acid bacteria strain with highly efficient purine nucleotide degradation capabilities that can be used to prepare low-purine fermented soy milk has significant economic value and broad application prospects. Summary of the Invention

[0005] Purpose of the invention: To address the problems existing in the prior art, the present invention provides a *Pediococcus lactis* strain that degrades purine nucleotides and its applications.

[0006] Technical solution: To achieve the above objectives, the present invention adopts the following technical solution: a type of Pediococcus lactis, which was deposited at the China General Microbiological Culture Collection Center on November 20, 2025, with accession number CGMCC No. 36696.

[0007] The present invention also provides the above-mentioned Pediococcus lactis for the application of degrading purine nucleotides.

[0008] The present invention also provides a low-purine fermented soy milk, which is obtained by inoculating soy milk products with the *Pediococcus lactis* as described in claim 1 and then fermenting.

[0009] The present invention also provides the above-mentioned Pediococcus lactis for use in inhibiting Escherichia coli, Klebsiella pneumoniae or Bacillus cereus.

[0010] The present invention also provides the above-mentioned Pyrococcus lactis for use in reducing hyperuricemia and inflammation.

[0011] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0012] (1) This invention provides a strain of Pediococcus lactis that can degrade purine nucleotides, with the aim of further development and utilization. The strain of Pediococcus lactis grx816, which has a high efficiency in degrading purine nucleotides, was screened from infant feces and has been deposited at the China General Microbiological Culture Collection Center, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, before the application date of this invention.

[0013] (2) The strains provided by the present invention have a significant inhibitory effect on potential intestinal pathogens such as Escherichia coli, Klebsiella pneumoniae and Bacillus cereus.

[0014] (3) The strain provided by this invention can be used to prepare low-purine fermented soy milk, and sensory evaluation and electronic nose analysis have confirmed that it has no unpleasant flavor. The fermentation of this strain can significantly change the metabolic characteristics of soy milk, among which nucleotide metabolism, purine metabolism and pyrimidine metabolism are the main differential metabolic pathways. At the same time, it can significantly increase the content of bioactive peptides such as pentapeptide Gly-Ala-Pro-Met-Phe and tripeptide Ala-Pro-Tyr.

[0015] (4) The strains provided by this invention and their low-purine fermented soy milk can effectively reduce the levels of serum uric acid, creatinine and urea nitrogen in rats with hyperuricemia, inhibit serum xanthine oxidase activity, regulate inflammatory factors and reduce inflammatory response. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 The diagram shows the results of adenosine degradation capacity analysis in this embodiment of the invention. It is a schematic diagram of high performance liquid chromatography-mass spectrometry detection of the culture medium after fermentation. The peak time of adenosine is 3.003 min.

[0018] Figure 2 This is a principal component analysis (PCA) score graph of two groups of samples in positive ion mode according to an embodiment of the present invention.

[0019] Figure 3 This is a principal component analysis (PCA) score graph of two groups of samples under negative ion mode in an embodiment of the present invention.

[0020] Figure 4 This is a classification diagram of KEGG functional pathways in an embodiment of the present invention.

[0021] Figure 5 The HMDB compounds in the embodiments of the present invention are classified.

[0022] Figure 6 This is a volcano diagram of differential metabolites in an embodiment of the present invention.

[0023] Figure 7 This is a statistical chart of the main differential metabolites in the embodiments of the present invention.

[0024] Figure 8 This invention provides an enrichment analysis of the KEGG pathway for significantly differentially expressed metabolites in this embodiment. Detailed Implementation

[0025] The present invention will be further illustrated below with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. After reading this invention, any modifications of the invention in various equivalent forms by those skilled in the art will fall within the scope defined by the appended claims.

[0026] Unless otherwise specified in the embodiments of this invention, the conditions shall be performed according to conventional conditions or the manufacturer's recommendations. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0027] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0028] I. Screening of purine nucleotide-degrading lactic acid bacteria

[0029] The strain of this invention is a purine nucleotide-degrading Pediococcus acidilactici, which was screened by the inventors from infant feces. It was identified as Pediococcus acidilactici and named grx816. This strain was deposited at the China General Microbiological Culture Collection Center on November 20, 2025, with accession number CGMCC No. 36696.

[0030] 1 M KxHxPO4: Take 121.9 g K2HPO4 and 40.8 g KH2PO4 and add them to 900 ml of deionized water. Adjust the pH to 7.2 and bring the volume to 1.0 L.

[0031] Vitamin K1+K3: Dissolve 0.1 ml of liquid vitamin K1 in 10 ml of 100% ethanol, add 20 mg of vitamin K3, filter to sterilize, and store at -20℃ for later use.

[0032] Trace mineral solution: Dissolve in 1000 ml of deionized water, acidify with 5 drops of sulfuric acid, and store under nitrogen atmosphere. The content of each component is shown in Table 1.

[0033] Table 1. Trace Mineral Content

[0034] #B medium: Main components are shown in Table 2.

[0035] Table 2. Main Components of Culture Medium #B

[0036] Mobile phase -- 20 mM potassium dihydrogen phosphate (pH 3.0) solution: Accurately weigh 2.722 g of potassium dihydrogen phosphate, dilute to 1000 mL with ultrapure water, and adjust the pH to 3.0 with phosphoric acid. All reagents used here are chromatographic grade.

[0037] Adenosine standard: Accurately weigh 100 mg of adenosine standard into a 50 ml volumetric flask, dissolve and dilute to volume with ultrapure water to prepare a 2.0 g / L stock solution. Transfer 1.0, 2.0, 3.0, 4.0, and 5.0 ml of the standard working solution into 10 ml volumetric flasks, and dilute to 10 ml with water to prepare a standard series with concentrations of 0.2 g / L, 0.4 g / L, 0.6 g / L, 0.8 g / L, and 1.0 g / L. The preparation method for adenosine and adenine standards is the same.

[0038] Take 20 mg of fecal sample collected from healthy infants and young children. After enrichment for two generations, take 0.1 mL of the enriched fermentation broth, serially dilute it with sterile physiological saline, and spread it evenly on #B solid medium plates. Incubate anaerobically at 37°C for 24 h. Select typical single colonies that are milky white, nearly round, with a raised surface and smooth edges, purify for three generations, and store in 35% glycerol at -80°C.

[0039] The activated second-generation bacterial cultures of each pre-selected strain were inoculated into #B liquid medium at a 3% inoculum and anaerobically cultured at 37°C for 24 h. After culture, the residual amount of substrate nucleotides in the supernatant was quantitatively determined by high-performance liquid chromatography (HPLC) to screen for dominant strains with high adenosine degradation capabilities.

[0040] Chromatographic conditions: Agilent HPLC system 1260; column: Poroshell 120 SB.C18; mobile phase A: methanol; mobile phase B: 20 ​​mM, pH 3.0 potassium dihydrogen phosphate buffer; column temperature: 30℃; detection wavelength: 254 nm; sample loading volume: 5 μl; flow rate: 0.8 ml / min.

[0041] The results showed that the strain achieved a degradation rate of 42.61% for adenosine.

[0042] II. Strain Morphology and Identification

[0043] 1. Morphological observation and Gram staining

[0044] The colony characteristics on the MRS solid plate were observed with the naked eye, and a single colony was picked and placed on a glass slide. After Gram staining, the morphology of the strain was observed through a biological microscope.

[0045] The colonies of the strain of this invention are milky white, nearly circular, raised, and smooth with regular edges. After Gram staining, they are Gram-positive, long rod-shaped, and do not form spores.

[0046] 2. Identification of 16S rDNA in the strain

[0047] (1) Extraction of genome: After the strain is activated, take 1 ml of bacterial culture and centrifuge it. Use a bacterial genomic DNA extraction kit to extract DNA.

[0048] (2) PCR amplification: The strain's genomic DNA was used as a template for amplification. The primers were (27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT). The PCR amplification program was: 95℃ for 5 min; 95℃ for 30 s; 55℃ for 15 s; 72℃ for 2 min. After 30 cycles, the extension was performed at 72℃ for 5 min.

[0049] After electrophoresis detection of the PCR products, they were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The 16S rDNA gene sequencing results are as follows:

[0050]

[0051] Sequencing results: The nucleotide length is around 1181 bp. The sequence obtained by sequencing was compared with the NCBI GenBank database for homology analysis. The results showed that the strain of the present invention is Pediococcus lactis, and the 16S rDNA sequence identity reached 99%.

[0052] Table 3. Results of homology comparison of 16S rDNA gene sequences of lactic acid bacteria

[0053] III. Analysis of the utilization capacity of the strain of this invention for low concentrations of purine nucleotides

[0054] 1. Analysis of the utilization capacity of lactic acid bacteria for low concentrations of purine nucleotides

[0055] The strain preserved in cryopreservation tubes was inoculated at a 3% inoculum into 10 ml of fresh MRS liquid medium and incubated statically at 37°C for 24 h to obtain the first generation. The above procedure was repeated, and 150 μl of the second generation bacterial culture was transferred to a 10 ml centrifuge tube containing 5 ml of fresh MRS liquid medium. After incubation at 37°C for 16–18 h, centrifugation was performed at 4500 r / min for 3 min. The supernatant was discarded, and the culture was washed three times with 0.85% physiological saline. OD was measured by adding 1.00 g / L potassium adenosine dihydrogen phosphate buffer (20 mM, pH 7.0) and 1.00 g / L potassium guanylate dihydrogen phosphate buffer (20 mM, pH 7.0), respectively. 600 The sample was incubated at 37℃ for 20 h, centrifuged at 4500 r / min for 3 min, and 900 μl of the supernatant was collected, filtered through a 0.22 μm membrane, and then detected by high performance liquid chromatography (HPLC).

[0056] The results showed that, in a 1.00 g / L phosphate buffer system, the adenosine degradation rate of the strain of this invention was 7.55%, the adenosine degradation rate was 0.10 μmol / OD·h, the guanylic acid degradation rate was 7.49%, and the guanylic acid degradation rate was 0.09 μmol / OD·h.

[0057] 2. Analysis of the ability of lactic acid bacteria to degrade purine nucleosides

[0058] The activated second-generation strain was washed three times with 0.85% physiological saline, and then potassium dihydrogen phosphate buffer (20 mM, pH 7.0) containing 0.20 g / L adenosine and guanosine was added respectively to measure OD. 600 The samples were incubated in a constant temperature incubator at 37℃, and samples were taken at 60 min. The reduction of purine nucleosides in the buffer solution was determined by HPLC, and the degradation rate of purine nucleosides by lactic acid bacteria was calculated.

[0059] The results showed that, in a 0.20 g / L phosphate buffer system, the adenosine degradation rate of the strain of this invention was 25.33%, with a degradation rate of 1.71 μmol / OD·h, and the guanosine degradation rate was 15.82%, with a degradation rate of 0.99 μmol / OD·h.

[0060] IV. Determination of the antibacterial properties of the strain of this invention against enteropathogenic bacteria

[0061] Escherichia coli, Klebsiella pneumoniae (LB medium), and Bacillus cereus (BHI medium) were used as indicator bacteria. The three indicator bacteria were cultured on solid plates at 37°C for 24 h. Typical single colonies were picked and inoculated into the corresponding liquid media and cultured with shaking at 37°C and 200 r / min for 12 h. After transfer activation for 2 h, the cells were collected by centrifugation at 5000 r / min for 10 min, washed twice with physiological saline, resuspended, mixed, and diluted to OD. 600 It is reserved at around 0.45.

[0062] Using a sterile cotton swab, the bacterial suspension was evenly and crosswise spread onto the corresponding solid agar plate surface and allowed to stand until slightly dry. Agar was then removed from the wells using a sterile pipette tip. The *Pediococcus lactis* grx816 of this invention was cultured at 37°C for 24 h to obtain the fermentation broth. The fermentation broth was centrifuged at 4500 r / min for 10 min to collect the supernatant, and 80 μL of the supernatant was injected into each well. The plates were sealed with sealing film and refrigerated at 4°C for 2 h for diffusion. Afterward, they were transferred to a 37°C incubator for 12 h of incubation. The diameter of the generated inhibition zone was accurately measured using calipers.

[0063] The results showed that the invented strain of Pediococcus lactis grx816 had excellent antibacterial activity. Its fermentation supernatant had a significant inhibitory effect on common intestinal pathogens. The diameters of the inhibition zones against Escherichia coli, Klebsiella pneumoniae and Bacillus cereus reached 18.2 mm, 21.6 mm and 15.8 mm, respectively.

[0064] V. Preparation of low-purine fermented soy milk using the strain of this invention.

[0065] Commercially available high-quality soybeans were used as raw material. After washing, soaking overnight at 4℃, and grinding (wet soybeans:water = 1:7), the soybean residue was removed using a 120-mesh sieve to obtain crude soy milk. 6% sucrose was added to the crude soy milk, and the mixture was homogenized twice under high pressure (20 MPa). After dispensing, the mixture was sterilized at 105℃ for 15 min and cooled to room temperature for later use. An activated *Pediococcus acidilactici* grx816 bacterial suspension was transferred to the aseptic soy milk substrate at a 3% (v / v) inoculation rate and placed in a 37℃ constant temperature incubator for fermentation.

[0066] 1. Determination of purine content in fermented soy milk

[0067] After fermentation, 3.0 g of fermented soybean milk sample was accurately weighed, and 10 mL of 10% perchloric acid solution was added for ultrasonic pretreatment. After centrifugation, the supernatant was collected and the pH value was adjusted to 5.75 with KOH. After standing for 30 min, it was filtered through a 0.22 μm microporous membrane, and the purine content was determined by high performance liquid chromatography.

[0068] The results showed that the initial contents of guanylic acid, adenosine, xanthine, inosine, guanosine, and adenosine in unfermented raw soy milk were 9.61, 25.74, 5.27, 5.85, 10.30, and 17.45 mg / L, respectively. After fermentation with *Pediococcus lactis* grx816, the total purine content in the fermented soy milk decreased by 26.13%. Specifically, the guanylic acid content decreased by 2.26% (to 9.39 mg / L), the adenosine content decreased by 7.23% (to 23.87 mg / L), and the inosine content decreased by 7.86% (to 5.39 mg / L). The contents of xanthine, guanosine, and adenosine decreased significantly, by 62.62% (to 1.97 mg / L), 37.96% (to 6.39 mg / L), and 55.27% (to 7.81 mg / L), respectively. Data shows that grx816 fermentation effectively reduces purine substances in fermented soy milk.

[0069] 2. Determination of antioxidant activity and total flavonoid content in fermented soy milk

[0070] The pH of the fermented soy milk was adjusted to 4.6 with 1 mol / L sodium hydroxide, and centrifuged at 10000 g and 4 ℃ for 10 min. The supernatant was filtered through a 0.22 μm filter membrane to obtain the sample to be tested.

[0071] Determination of DPPH radical scavenging rate: A 0.20 mmol / L DPPH radical solution was prepared with anhydrous ethanol and stored in the dark. 45 μL of a 10-fold diluted sample and 100 μL of the 0.20 mmol / L DPPH radical solution were added sequentially to a 96-well plate, mixed thoroughly, and allowed to stand at room temperature in the dark for 30 min. The absorbance (A1) at 516 nm was measured. Simultaneously, 45 μL of anhydrous ethanol was used as a blank absorbance (A0). Vitamin C was used as a positive control.

[0072] DPPH radical scavenging rate (%) = (A0 - A1) / A0 × 100

[0073] Determination of hydroxyl radical scavenging rate: Mix 0.5 mL of sample with 0.5 mL of 9 mmol / L FeSO4 solution, 0.5 mL of 8.8 mmol / L H2O2 solution, and 0.5 mL of 9 mmol / L salicylic acid-ethanol solution. Record the absorbance as A1. Without adding H2O2 solution, record the absorbance as A2. If the sample is replaced with distilled water, record the absorbance as A0.

[0074] Hydroxyl radical scavenging rate (%) = (1 - (A1 - A2)) / A0 × 100

[0075] Determination of total flavonoid content: The total flavonoid content in fermented soy milk was determined by aluminum salt colorimetric method.

[0076] The results showed that the DPPH free radical scavenging rate of unfermented soy milk was 82.38%, the hydroxyl free radical scavenging capacity was 992.63 U / mL, and the total flavonoid content was 0.33 g / L; while the DPPH free radical scavenging rate of soy milk fermented with Pediococcus lactis grx816 increased to 94.67%, the hydroxyl free radical scavenging capacity increased to 1212.95 U / mL, and the total flavonoid content accumulated in the fermented soy milk increased to 0.44 g / L.

[0077] VI. Sensory evaluation and electronic nose flavor response analysis of fermented soy milk by the strain of this invention

[0078] 1. Sensory evaluation of fermented soy milk

[0079] Ten students with knowledge of fermented milk and rich experience in sensory evaluation were selected to rate the fermented milk in four aspects: state, color, smell, and taste, for a total of 100 points. The lowest and highest scores were removed, and the average score was kept to two significant figures as the final score of the product.

[0080] The results showed that grx816 fermented soy milk had no unpleasant flavor and high sensory acceptance.

[0081] 2. Electronic nose analysis of fermented soy milk

[0082] 4 g of fermented soy milk was placed in a 20 mL headspace vial and sealed. The vial was then incubated in a 42℃ water bath for 30 min to equilibrate. Odor was recorded using an electronic nose. Data acquisition time was 90 s. Dry, clean air was used as the carrier gas with an internal flow rate of 400 mL / min and an injection flow rate of 400 mL / min. Sample preparation time was 5 s, and sensor cleaning time was 180 s. Each sample was measured three times, and the average value was taken.

[0083] The results showed that the main component distributions of unfermented soy milk and grx816 fermented soy milk did not overlap, indicating significant differences in the volatile flavor compounds they produced. The two groups of samples showed the greatest difference in W2S sensor response values, suggesting that the differences in volatile flavor compounds caused by fermentation mainly originate from alcohols, aldehydes, and ketones.

[0084] VII. Non-targeted metabolomics analysis of fermented soybean milk by the strain of this invention

[0085] 1. Sample extraction

[0086] After dissolving the lyophilized sample in water, 100 μL of the liquid sample was transferred to a 1.5 mL centrifuge tube. 400 μL of extraction buffer (acetonitrile:methanol = 1:1) containing 0.02 mg / mL of internal standard (L-2-chlorophenylalanine) was added. The mixture was vortexed for 30 s, followed by low-temperature ultrasonic extraction for 30 min (5℃, 40 kHz). The sample was then allowed to stand at -20℃ for 30 min. After centrifugation at 4℃ for 15 min at 13000 g, the supernatant was collected, dried under nitrogen, and reconstituted with 100 µL of reconstitution solution (acetonitrile:water = 1:1). The sample was then extracted using low-temperature ultrasonic extraction for 5 min (5℃, 40 kHz), followed by centrifugation at 4℃ for 10 min at 13000 g. The supernatant was then transferred to a vial with an inner tube for analysis.

[0087] 2 Chromatographic conditions

[0088] A 3 μL sample was separated using an HSS T3 column (100 mm × 2.1 mm id, 1.8 µm) and then analyzed by mass spectrometry. Mobile phase A consisted of 95% water + 5% acetonitrile (containing 0.1% formic acid), and mobile phase B consisted of 47.5% acetonitrile + 47.5% isopropanol + 5% water (containing 0.1% formic acid). The flow rate was 0.40 mL / min, and the column temperature was 40 ℃.

[0089] Mass spectrometry conditions: Sample mass spectrometry signal acquisition employed positive and negative ion scanning modes, with a mass scan range of 70–1050 m / z. The sheath gas flow rate was 50 psi, the auxiliary gas flow rate was 13 psi, the auxiliary gas heating temperature was 425 °C, the capillary temperature was 325 °C, the positive mode ion spray voltage was set to 3500 V, the negative mode ion spray voltage was set to -3500 V, and the normalized collision energy was 20–40–60 eV cyclic collision energy. The first-stage mass spectrometer had a resolution of 60,000 m / s, and the second-stage mass spectrometer had a resolution of 7,500 m / s, using DDA mode for data acquisition.

[0090] like Figure 2-7As shown, the results indicate that, under both positive and negative ion modes, the unfermented and fermented soy milk samples were clearly separated in principal component analysis (PCA), with good reproducibility within each group and significant overall metabolic differences between the two groups. A total of 1103 metabolites were detected under positive ion mode and 1638 under negative ion mode. KEGG pathway enrichment analysis revealed that nucleotide metabolism, purine metabolism, and pyrimidine metabolism, all related to uric acid metabolism, were the main differential metabolic pathways.

[0091] grx816 fermented soy milk can significantly increase the content of active ingredients such as the pentapeptide Gly-Ala-Pro-Met-Phe (glycine-alanine-proline-methionine-phenylalanine), the tripeptide Ala-Pro-Tyr (alanine-proline-tyrosine), and acylated flavonoid glycosides (such as 24-acetyl-25-cinnamoylvalgaside). Related studies have shown that food-derived bioactive peptides can reduce uric acid production by inhibiting xanthine oxidase (XOD) activity, and simultaneously regulate the expression of renal uric acid transport proteins (such as URAT1, GLUT9, and ABCG2), promoting uric acid excretion. Furthermore, bioactive peptides can also reduce the levels of pro-inflammatory factors IL-1β, IL-6, and TNF-α by inhibiting the activation of inflammatory signaling pathways such as nuclear factor κB (NF-κB), thereby alleviating inflammatory responses.

[0092] 8. The strain of this invention and its low-purine fermented soy milk can effectively reduce the levels of serum uric acid, creatinine and urea nitrogen in rats with hyperuricemia, inhibit serum xanthine oxidase activity, regulate inflammatory factors, and reduce inflammatory response.

[0093] Fifty-four SPF-grade male Wistar rats (150±10g) were randomly divided into six groups (normal control group, model group, positive drug group, lactic acid bacteria suspension intervention group, soy milk intervention group, and lactic acid bacteria fermented soy milk intervention group) after one week of acclimatization feeding, with nine rats in each group. The feeding conditions were as follows: a well-ventilated, well-lit, and clean environment with a temperature of 23±1℃, a humidity of 50±5%, a 12-hour diurnal rhythm, free access to water, and a quiet environment.

[0094] Except for the normal control group, which was fed regular rat food, the other groups were fed a high-purine customized rat food for one week. Simultaneously, the high-purine customized rat food (containing 25 g yeast extract, 1 g ribonucleic acid, and 74 g regular feed per 100 g of feed) was administered via gavage with 750 mg / (kg / d) potassium oxonate (a uricase inhibitor) and 100 mg / (kg / d) adenine mixed with sodium carboxymethyl cellulose to induce a rat model. Two weeks after modeling, blood was collected from the orbital venous plexus of rats to determine the success of the model.

[0095] After successful modeling, each rat in the probiotic intervention group was administered 1 ml / 100 g of bacterial suspension by gavage daily; each rat in the allopurinol intervention group was administered 25 mg / kg of allopurinol solution by gavage daily. Each rat in the hyperuricemia model group and the normal control group was administered 1 ml / 100 g of 0.9% physiological solution by gavage for 4 weeks.

[0096] The alleviating effect of lactic acid bacteria on HUA rats was analyzed by detecting organ indices, renal function indicators (serum uric acid, blood urea, serum creatinine), fecal uric acid levels, kidney and liver damage, serum inflammatory factors, and serum xanthine oxidase activity.

[0097] The results showed that *Pediococcus lactis* grx816 effectively reduced serum uric acid, creatinine, and blood urea nitrogen levels in hyperuricemic rats, decreasing them by 22.13%, 12.86%, and 8.45%, respectively. Compared with the normal control group (IL-1β 531.79 pg / mL, IL-6 60.24 pg / mL, TNF-α 289.53 pg / mL, TGF-β 747.18 pg / mL), the serum levels of pro-inflammatory factors IL-1β (413.56 pg / mL), IL-6 (44.86 pg / mL), and TNF-α (211.47 pg / mL) in the model group rats were significantly decreased (P<0.05), while the anti-inflammatory repair factor TGF-β (829.05 pg / mL) was significantly increased (P<0.05), indicating that the inflammatory regulatory network in the hyperuricemic model rats was disordered. After intervention with fermented soybean milk by *Pediococcus lactis* grx816, the serum levels of IL-1β, IL-6, and TNF-α in hyperuricemia model rats decreased to 528.46 pg / mL, 58.97 pg / mL, and 284.12 pg / mL, respectively, while the TGF-β level rebounded to 751.36 pg / mL. These indicators showed no statistically significant difference compared to the normal group (P>0.05), and the improvement effect was significantly better than that of the unfermented soybean milk group and the single-strain group. Furthermore, *Pediococcus lactis* grx816 fermented soybean milk intervention reduced the activity of xanthine oxidase (XOD) in the serum of hyperuricemia model rats by 25.63%.

[0098] This strain was isolated from infant feces. Experimental results showed that in #B medium with adenosine as the main carbon source, the adenosine degradation rate was 42.61%; in a phosphate buffer system with adenosine (1.00 g / L), the adenosine degradation rate was 7.55% (0.10 μmol / OD·h), and the guanylic acid degradation rate was 7.49% (0.09 μmol / OD·h); in a 0.20 g / L phosphate buffer system, the adenosine degradation rate was 25.33% (1.71 μmol / OD·h), and the guanylic acid degradation rate was 15.82% (0.99 μmol / OD·h). Using a rat model of hyperuricemia, this strain effectively reduced serum uric acid, creatinine, and blood urea nitrogen levels in hyperuricemic rats, decreasing them by 22.13%, 12.86%, and 8.45%, respectively.

[0099] IX. The method for preparing lactic acid bacteria for degrading purine nucleotides according to the present invention includes the following steps:

[0100] Isolation of lactic acid bacteria from samples: The diluted sample was spread on #B solid medium with adenosine as the main carbon source, single colonies were picked and purified, and single colonies were picked and inoculated into #B liquid medium with adenosine as the main carbon source, and the growth was observed.

[0101] From the strains exhibiting good growth, we further screened and selected strains with a strong ability to degrade various purine nucleotides and purine nucleosides.

[0102] The third objective of this invention is to develop low-purine fermented soy milk, the preparation process of which is as follows:

[0103] The *Pediococcus lactis* grx816 was used to ferment soy milk to prepare low-purine fermented soy milk. The total purine content of the fermented soy milk decreased by 26.13%, and the contents of xanthine, guanosine, and adenosine decreased significantly, by 62.62%, 37.96%, and 55.27%, respectively. Furthermore, comprehensive evaluation using an electronic nose and sensory analysis confirmed that the fermented soy milk had no unpleasant flavor. The DPPH free radical scavenging rate of the fermented soy milk increased to 94.67%, the hydroxyl free radical scavenging capacity increased to 1212.95 U / mL, and the total flavonoid content increased to 0.44%. g / L; and through non-targeted metabolomics analysis, the unfermented and fermented soy milk samples were clearly separated in principal component analysis. KEGG pathway enrichment analysis showed that nucleotide metabolism, purine metabolism and pyrimidine metabolism, which are related to uric acid metabolism, were the main differential metabolic pathways. Fermented soy milk by *Pediococcus lactis* grx816 can significantly increase the content of bioactive peptides such as pentapeptide Gly-Ala-Pro-Met-Phe and tripeptide Ala-Pro-Tyr.

[0104] The above embodiments detail the fabrication method, characterization techniques, and performance advantages of the wet power generation device of the present invention. By introducing a thermally induced covalent crosslinking strategy, the present invention successfully solves the core problem of weak bonding between carbon dots and the substrate interface, obtaining a high-output, highly stable, and highly flexible wet power generation device, and demonstrating its great potential for modular integration and practical applications.

Claims

1. A type of Pediococcus lactis, characterized in that: The *Pediococcus lactis* was deposited at the China General Microbiological Culture Collection Center on November 20, 2025, with accession number CGMCC No. 36696.

2. The application of the *Pediococcus lactis* of claim 1 for degrading purine nucleotides.

3. A low-purine fermented soy milk, characterized in that: It is obtained by fermentation of soy milk products after inoculation with the *Pediococcus lactis* as described in claim 1.

4. The application of the *Pediococcus lactis* of claim 1 for inhibiting *Escherichia coli*, *Klebsiella pneumoniae*, or *Bacillus cereus*.

5. The *Pediococcus lactis* of claim 1, used for reducing hyperuricemia and inflammation.

Images