Pedobacter heparinus and application thereof in preparation of cycloastragenol from fermented astragalus

Abstract

The application provides pediococcus acidilactici NM-12 and application thereof in preparation of cycloastragenol through fermentation of Astragalus membranaceus, and belongs to the technical field of microorganism, fermentation and natural product bioconversion. The pediococcus acidilactici NM-12 is screened and separated from the surface of Astragalus membranaceus raw materials in Inner Mongolia, is preserved in the Guangdong Microbial Digital Museum Center, and has a preservation number of GDMCC No: 68607; the pediococcus acidilactici NM-12 can prepare a microbial inoculant; the pediococcus acidilactici NM-12 and the microbial inoculant thereof can ferment acetylated astragaloside as a substrate, convert acetylated astragaloside in the Astragalus membranaceus raw materials into cycloastragenol, and have a conversion efficiency significantly better than that of other strains of the same kind, and have a good industrial application prospect.

Description

Technical Field

[0001] This invention belongs to the fields of microbial, fermentation and natural product biotransformation technology, specifically relating to Pediococcus lactis NM-12 and its application in the fermentation of Astragalus membranaceus to prepare cycloastragalool. Background Technology

[0002] Astragalus is a traditional bulk medicinal herb, and its saponins possess various pharmacological activities, including anti-inflammatory, immunomodulatory, and cardiovascular protective effects. All astragalus saponins share cycloastragenol (CAG) as their common aglycone, and can be classified into various monomeric saponins based on the type and number of sugar groups and the substitution of acetyl groups on the sugar chain. Cycloastragenol is the only natural compound to date capable of activating telomerase, exhibiting multiple pharmacological activities such as anti-aging, immune enhancement, and cardiovascular protection. Astragalus saponins require biotransformation to gradually remove sugar groups to generate easily absorbed cycloastragenol. However, the content of cycloastragenol in natural astragalus raw materials is extremely low, usually below the detection limit, making it difficult to obtain astragalus products rich in cycloastragenol through direct extraction. Therefore, how to increase the cycloastragenol content of the astragalus raw material itself, rather than relying on expensive pure product preparation, has become a core technological bottleneck in the astragalus deep processing industry.

[0003] Microbial fermentation has attracted widespread attention due to its mild conditions and high specificity, and is considered the most promising technical approach to enhance the content of active ingredients in Astragalus membranaceus raw materials. The saponin compounds in Astragalus membranaceus raw materials mainly include acetylated saponins (astragaloside I, II, isoastragaloside I, II) and non-acetylated saponins (represented by astragaloside A). The chemical relationship between the two is: acetylated saponin = astragaloside A + acetyl group on xylose. Although astragaloside A is a quality control indicator specified in the pharmacopoeia, its content in Astragalus membranaceus raw materials is not the highest; the content of acetylated saponins such as astragaloside I and II is often higher. However, the conversion of the acetyl group on the sugar chain of acetylated saponins to cycloastragaloyl alcohol requires a two-stage reaction of deacetylation followed by deglycosylation. Current research mainly focuses on screening strains or enzyme systems that can directly deglycosylate astragaloside A, but these strains cannot utilize the more abundant acetylated saponin precursors in Astragalus membranaceus raw materials, which seriously restricts the quality improvement of fermented Astragalus membranaceus products.

[0004] While human gut microbiota can convert various astragalus saponins into cycloastragalol, the composition is unstable, making it difficult to apply in food. Furthermore, the cycloastragalol content decreases after fermentation by fungi such as Cordyceps militaris, indicating that not all microorganisms can effectively increase the cycloastragalol content in astragalus raw materials. Existing reports on astragalus fermentation by Pediococcus lactis only focus on polysaccharide enhancement, without addressing the targeted deacetylation-deglycosylation cascade transformation of acetylated astragalus saponins, nor have they conducted systematic research from the perspective of "increasing the cycloastragalol content of the astragalus raw material itself."

[0005] Therefore, screening a strain of lactic acid bacteria that can safely and efficiently ferment Astragalus membranaceus raw material, converting acetylated saponins into cycloastragaloyl alcohol through a two-stage reaction of deacetylation and deglycosylation in a one-step fermentation process, thereby directly obtaining food-grade lactic acid bacteria with high cycloastragaloyl alcohol content fermented products, elucidating its conversion mechanism, and establishing a simple process are of great value for the quality upgrading of the Astragalus membranaceus deep processing industry and the development of functional food raw materials. Summary of the Invention

[0006] To address some shortcomings in existing technologies, this invention provides *Pediococcus lactis* NM-12 and its application in the fermentation of *Astragalus membranaceus* to prepare cycloastragalool. This invention isolates *Pediococcus lactis* NM-12 from the surface of *Astragalus membranaceus* raw materials from Inner Mongolia. *Pediococcus lactis* NM-12 is deposited at the Guangdong Provincial Microbial Culture Collection Center, with accession number GDMCC No: 68607. *Pediococcus lactis* NM-12 can prepare microbial inoculants. *Pediococcus lactis* NM-12 and its microbial inoculants can ferment acetylated astragaloside as a substrate, converting acetylated astragaloside in *Astragalus membranaceus* raw materials into cycloastragalool. The conversion efficiency is significantly better than other strains of the same species, showing great promise for industrial application.

[0007] To achieve the above-mentioned technical objectives, the present invention employs the following technical means:

[0008] The present invention first provides a *Pediococcus lactis* NM-12, which is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 68607 and deposit date of July 13, 2026.

[0009] Preferably, the 16S rRNA gene sequence of the lactic acid cocci NM-12 is shown in SEQ ID NO: 1.

[0010] The present invention also provides a microbial agent comprising the aforementioned Pediococcus lactis NM-12.

[0011] The present invention also provides the application of the aforementioned *Pediococcus lactis* NM-12, or the aforementioned microbial agent, in the fermentation of *Astragalus membranaceus* to produce cycloastragaloyl alcohol, or in products containing cycloastragaloyl alcohol.

[0012] Preferably, the application includes: acetylated astragaloside and / or non-acetylated astragaloside from fermented astragalus.

[0013] Preferably, the acetylated astragaloside includes one or more of astragaloside I, isoastragaloside I, or isoastragaloside II.

[0014] The present invention also provides a method for producing cycloastragalool, the method being based on the *Pediococcus lactis* NM-12 or the microbial inoculant fermentation substrate;

[0015] The substrate includes one or more of Astragalus membranaceus, acetylated astragaloside, non-acetylated astragaloside, and products containing acetylated or non-acetylated astragaloside.

[0016] Preferably, the method includes:

[0017] Seed culture of P. lactis NM-12 was obtained by activation, and the bacterial cells were collected by centrifugation and resuspended to obtain bacterial suspension of P. lactis NM-12.

[0018] The bacterial suspension was mixed with the substrate and fermented to obtain a fermentation product containing cycloastragaloyl alcohol.

[0019] Preferably, the OD value of the seed solution is 0.8-1.0;

[0020] The mass ratio of the bacterial suspension to Astragalus membranaceus is 1:1;

[0021] The OD value of the bacterial suspension is 0.5-0.6.

[0022] Preferably, the astragalus is dried, pulverized, and sterilized to obtain a powder.

[0023] Preferably, the fermentation conditions are: fermentation at 37°C for 24 hours.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] (1) This invention screened and obtained a strain of Pediococcus lactis NM-12, which was isolated from the surface of Astragalus membranaceus raw material in Inner Mongolia. It belongs to the food processing strain and is safe and reliable. Through hemolytic activity, biofilm formation, antibiotic sensitivity and whole genome safety analysis, it was confirmed that the strain meets the safety requirements for food processing strains and can be directly used in food processing.

[0026] (2) This invention is the first to discover and prove that *Pediococcus lactis* NM-12 can efficiently convert astragaloside I, isoastragaloside I, and isoastragaloside II into cycloastragalol using these as substrates. Substrate-specific comparison experiments show that when acetylated astragaloside is used as a substrate, the amount of cycloastragalol generated by NM-12 reaches 4.18~5.33 mg / L, while other homologous *Pediococcus lactis* strains (NM-1, NM-3, NM-5, NM-6) can only detect trace amounts of cycloastragalol (0.24~0.55 mg / L), and homologous *Lactobacillus reuteri* (NM-10, NM-11) and laboratory-preserved strains (ATCC 8042, M1-1) are completely unable to convert acetylated saponins. When Astragalus membranaceus raw material was directly fermented, the yield of cycloastragalool in NM-12 (737.4 μg / g) was 3.3 to 3.9 times that of Pediococcus lactis isolate (186.8 to 220.8 μg / g), 7.3 to 8.1 times that of Lactobacillus reuteri isolate, 7.7 times that of standard strain of Pediococcus lactis ATCC 8042, and 7.6 times that of Ginkgo biloba isolate M1-1.

[0027] This invention experimentally verifies that Pediococcus lactis NM-12 possesses a highly efficient conversion ability of acetylated saponins that is not found in other Pediococcus lactis strains. Pediococcus lactis NM-12 can be used to ferment Astragalus membranaceus raw materials and convert the acetylated astragalosides in the Astragalus membranaceus raw materials into cycloastragalool, thereby directly obtaining Astragalus membranaceus fermented products rich in cycloastragalool, which has great practicality.

[0028] (3) This invention elucidates the transformation mechanism of NM-12 for the first time through whole-genome sequencing and RT-qPCR: the strain transforms various saponins into cycloastragalool through the synergistic expression of acetylesterase, β-glucosidase and β-xylosidase. Among them, when acetylated saponins such as astragaloside I, isoastragaloside I, and isoastragaloside II are used as substrates, the acetyl group must first be removed by acetylesterase, and then the glycosyl group must be removed by β-glucosidase and β-xylosidase to finally generate cycloastragalool.

[0029] (4) This invention adopts a semi-solid fermentation method, which is simple to operate, requires low equipment, and is easy to scale up for production. Compared with the unfermented product, where the content of cycloastragalol is below the detection limit, the cycloastragalol content obtained by fermenting with Pediococcus lactis NM-12 under optimal conditions (fermentation temperature 35℃, fermentation time 24h, material-liquid ratio 1:1) is increased to 737.4 μg / g. The fermentation product can be directly used as a functional food ingredient rich in cycloastragalol without complicated extraction and separation steps, and has a good prospect for industrial application. Attached Figure Description

[0030] Figure 1 A phylogenetic tree of 42 lactic acid bacteria strains was obtained from Astragalus membranaceus samples from different origins in situ.

[0031] Figure 2 This is a comparison chart of the cycloastragalol content of the standard and that of Astragalus membranaceus fermented with Pediococcus lactis NM-12.

[0032] Figure 3 The relative expression levels of the genes encoding acetylesterase, β-glucosidase, and β-xylosidase in Pediococcus lactis NM-12 under Astragalus substrate induction are shown in the figure. ** indicates a highly significant difference compared with the control group (P<0.01), and *** indicates a highly significant difference compared with the control group (P<0.001).

[0033] Figure 4 This is a verification result of the conversion of Pleurotus ostreatus NM-12 into cycloastragalool using different saponin substrates.

[0034] Figure 5 The results represent the optimization of fermentation conditions for Pyorrhizococcus lactis NM-12.

[0035] Figure 6 The results show the comparison of cycloastragalool production by *Pediococcus lactis* NM-12 and other control strains using non-acetylated saponins (astragaloside A) as substrates.

[0036] Figure 7 The results show the comparison of cycloastragalool production by *Pediococcus lactis* NM-12 and other control strains using acetylated saponins (astragaloside I, isoastragaloside I, and isoastragaloside II) as substrates.

[0037] Figure 8 The results show the comparison of the total yield of cycloastragalool after fermentation of Astragalus membranaceus raw material by Pediococcus lactis NM-12 and other control strains. Detailed Implementation

[0038] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. In the embodiments of the present invention, unless otherwise described, conventional experimental methods are used. The processes involved in the embodiments, unless otherwise described, are those that can be understood and easily implemented by those skilled in the art based on the product manual or basic knowledge in the field, and therefore will not be described in detail.

[0039] The detection method of cycloastragaloyl alcohol is described in the following examples:

[0040] (1) Construction of the standard curve of cycloastragalool:

[0041] Accurately weigh cycloastragalol standard and prepare standard solutions with concentrations of 0.01, 0.02, 0.05, 0.10, 0.20, and 0.50 mg / mL using chromatographic grade methanol. Detect the solutions using HPLC-ELSD and plot a standard curve with the logarithm of peak area on the ordinate and the logarithm of concentration on the abscissa.

[0042] The HPLC-ELSD detection conditions for cycloastragalool were as follows: the chromatographic column was a Shim-pack GIST C18 column (4.6 mm × 250 mm, 5 μm); mobile phase A was 0.1% formic acid aqueous solution, mobile phase B was acetonitrile, and the gradient elution program was: 0–10 min, 85% A; 10–20 min, 85% A → 75% A; 20–40 min, 75% A → 60% A; 40–50 min, 60% A → 50% A; 50–55 min, 50% A → 85% A; 55–60 min, 85% A; the flow rate was 1.0 mL / min; the ELSD drift tube temperature was 70℃, the nitrogen pressure was 0.2 MPa, and the injection volume was 20 μL.

[0043] The results showed that cycloastragalool had a good linear relationship in the range of 0.01-0.50 mg / mL, and the regression equation was Y=1.5237X+5.0142 (R²=0.9993).

[0044] (2) Extraction method of cycloastragalool from Astragalus membranaceus raw material:

[0045] Take 5 g of Astragalus powder, add 50 mL of 70% ethanol, reflux at 85℃ for 1 hour, filter, evaporate the filtrate to dryness, dissolve the residue in 25 mL of chromatographic grade methanol, filter through a 0.22 μm filter membrane, and then perform HPLC-ELSD detection.

[0046] In the following examples, the formulation of MRS liquid culture medium is as follows: 10.0 g peptone, 5.0 g beef extract, 4.0 g yeast extract, 20.0 g glucose, 2.0 g K2HPO4, 2.0 g triammonium citrate, 5.0 g sodium acetate, 0.2 g MgSO4·7H2O, 0.05 g MnSO4·H2O, 1.08 g Tween-80, dissolved in distilled water and brought to a final volume of 1 L. The pH is adjusted to 6.4 with NaOH or HCl and sterilized at 121°C for 15 minutes before use.

[0047] Example 1: Isolation and Identification of Pediococcus lactis NM-12

[0048] Dried roots of Astragalus membranaceus var. mongholicus were collected from Inner Mongolia (NM, Huaishuo Town, Guyang County, Baotou City, Inner Mongolia Autonomous Region), Shanxi (SH1, Wangzhuangbao Town, Hunyuan County, Datong City, Shanxi Province) and Shaanxi (SH2, Laojundian Town, Zizhou County, Yulin City, Shaanxi Province).

[0049] 20g of surface attachments and epidermal tissue from dried Astragalus membranaceus roots of different sources were pulverized and then added to 20 mL of sterile physiological saline. The mixture was incubated at 37℃ for 48 hours to obtain an enriched culture medium. The enriched culture medium was then serially diluted 10-fold, and 10g of each diluted medium was used as the base. -4 10 -5 10 -6 100 μL of diluted bacterial suspension was spread onto MRS solid medium plates and anaerobically incubated at 37°C for 48 hours. Single colonies producing clear calcification zones were picked and streaked three times on MRS plates to obtain pure cultures.

[0050] Forty-two suspected lactic acid bacteria strains were isolated in situ from Astragalus membranaceus samples from different origins. Genomic DNA of the strains was extracted and purified, and PCR amplification was performed using universal primers 27F and 1492R. The PCR products were sent for sequencing, and the sequencing results were compared with BLAST in the NCBI database.

[0051] The primer sequences are as follows:

[0052] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID No: 5);

[0053] 1492R: 5'-TACGGCTACCTTGTTACGACTT-3' (SEQ ID No: 6).

[0054] like Figure 1 As shown, 7 out of 42 suspected lactic acid bacteria were identified as food-grade lactic acid bacteria by 16S rRNA identification. All of them were isolated from Astragalus membranaceus samples (NM) from Inner Mongolia. These included 5 strains of Pediococcus lactis, represented by strain NM-12 (denoted as NM-1, NM-3, NM-5, NM-6, and NM-12), and 2 strains of Lactobacillus reuteri, represented by strain NM-10 (denoted as NM-10 and NM-11).

[0055] Example 2: Verification of cycloastragalool production from Astragalus membranaceus fermentation by Pediococcus lactis NM-12 and comparison with other Pediococcus lactis strains

[0056] In this embodiment, Astragalus membranaceus was used as the fermentation substrate. The seven food-grade lactic acid bacteria strains obtained in Example 1, the standard strain of Pediococcus lactis ATCC 8042 (laboratory deposit, available for purchase), and the strain of Pediococcus lactis M1-1 isolated from Ginkgo biloba (accession number GDMCC No: 64673, laboratory deposit) were used as fermentation bacteria to conduct parallel fermentation experiments to investigate the ability of different strains to produce cycloastragaloyl alcohol from Astragalus membranaceus.

[0057] The Astragalus used in this embodiment is from Guyang, Inner Mongolia. Its main saponin composition was analyzed by HPLC-ELSD, and the results are as follows: the total content of acetylated saponins is approximately 1.87 mg / g, of which astragaloside I is 1.18±0.09 mg / g, isoastragaloside I is 0.34±0.03 mg / g, isoastragaloside II is 0.32±0.02 mg / g, and astragaloside II is only 0.03±0.01 mg / g. The non-acetylated saponin is astragaloside A, with a content of 0.62±0.05 mg / g. The content of acetylated saponins is much higher than that of non-acetylated saponins.

[0058] The specific steps are as follows:

[0059] The seven food-grade lactic acid bacteria strains obtained in Example 1, the standard strain of *Pediococcus lactis* ATCC 8042, and the *Pediococcus lactis* strain M1-1 isolated from Ginkgo biloba were respectively inoculated into MRS liquid medium and incubated statically at 37°C for 16 hours until OD (Organic Dysplasia Rate) was reached. 600 The concentration of the bacterial culture was set to 0.8-1.0 to obtain the seed culture. 5 mL of the seed culture was centrifuged at 4000 rpm for 10 minutes, the supernatant was discarded, and the bacterial cells were resuspended in 5 mL of sterile physiological saline (OD200). 600 (The concentration is 0.5-0.6), to obtain a bacterial suspension.

[0060] Astragalus samples from Guyang, Inner Mongolia, were pulverized to obtain Astragalus powder. 5 g of sterilized Astragalus powder (121℃, 20 min) was weighed and mixed with bacterial suspension, and fermented at 37℃ for 48 hours. Uninoculated sterilized Astragalus powder was used as a control. Fermentation products were obtained after fermentation. Cycloastragalol was extracted from the fermentation products and detected by HPLC-ELSD. The results are shown below. Figure 2 As shown.

[0061] After 48 hours of fermentation, the area of ​​the characteristic peak of cycloastragaloyl alcohol (retention time approximately 20.2 min) in the Astragalus membranaceus raw material inoculated only with strain NM-12 was significantly increased compared to the uninoculated control and the other 8 strains treatment groups, and the retention time of this characteristic peak was consistent with that of the cycloastragaloyl alcohol standard. Figure 2In contrast, the characteristic peak area of ​​cycloastragaloyl alcohol in Astragalus membranaceus inoculated with eight other lactic acid bacteria strains was similar to that in Astragalus membranaceus inoculated with no lactic acid bacteria. These results indicate that *Pediococcus acidilactici* NM-12 is a specific strain with outstanding cycloastragaloyl alcohol transformation function, and its 16S rRNA gene sequence is shown in SEQ ID NO:1.

[0062] The *Pediococcus acidilactici* NM-12 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCCNo: 68607, deposit date July 13, 2026, and taxonomic name: *Pediococcus acidilactici*.

[0063] Example 3:

[0064] (1) Whole genome sequencing and identification of key converting enzymes of Pediococcus lactis NM-12

[0065] The selected *Pediococcus lactis* NM-12 was enriched in 100 mL MRS medium at 37°C for 12 h. The bacterial cells were rapidly separated by low-temperature high-speed centrifugation for 10 min. The supernatant was discarded, and the cells were resuspended in 1 mL MRS medium. The suspension was transferred to a 1.5 mL centrifuge tube, centrifuged at 8000 rpm for 10 min, and sent to Shanghai Lingen Biotechnology Co., Ltd. for whole-genome sequencing.

[0066] Genome sequencing results showed that the genome size of strain NM-12 was 1.87 Mb (1,866,385 bp), with a G+C content of 42.21 mol%, and a clean data rate of 99.5%. Correlation analysis between sequencing depth and GC content showed no significant contamination, indicating high sequencing quality. The amino acid sequences of reported lactic acid bacteria deacetylases, including acetylesterase, chitosan oligosaccharide deacetylase, peptidoglycan deacetylase, acetylxylan esterase, and β-1,6-glucan deacetylase, as well as β-glucosidase and β-xylosidase, were compared with the whole-genome predicted protein database of NM-12 using local BLASTP (E-value < 1e-5, identity ≥ 30%).

[0067] The comparison results revealed corresponding coding genes with similarities of 32.1%, 72.1%, and 92.1%, respectively, which are presumed to be the coding genes for acetylesterase, β-glucosidase, and β-xylosidase of NM-12. The amino acid sequences of acetylesterase, β-glucosidase, and β-xylosidase are shown in SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively.

[0068] (2) Validation of the expression of key enzyme genes in Pediococcus lactis NM-12:

[0069] Specific primers were designed targeting the encoding genes of acetylesterase, β-glucosidase, and β-xylosidase (Table 1). RT-qPCR was used to detect the gene expression level of NM-12 in a fermentation system containing astragalus substrate (experimental group) and MRS liquid medium without astragalus substrate (control group). The 16S rRNA gene was used as an internal reference gene, and the relative expression level was calculated using the 2^−ΔΔCt method. The results are shown below. Figure 3 As shown.

[0070] Table 1 Primer sequences used for RT-qPCR detection

[0071] Acetylesterase (ACE) ACE-F ACACATTCCGTTGTCATCCCA (SEQ ID NO: 7) Acetylesterase (ACE) ACE-R CACAGTTGACGTGGTCAGGA (SEQ ID NO: 8) β-glucosidase (bgl) bgl-F CCGATTGTGGGCATCGTCTA (SEQ ID NO: 9) β-glucosidase (bgl) bgl-R TGAAGGGCTTGCCTTACCAG (SEQ ID NO: 10) β-xylosidase (xyl) xyl-F ATTCCGTCAACGTGATCCCA (SEQ ID NO: 11) β-xylosidase (xyl) xyl-R AAACGGGGTGGGCTTTGAT (SEQ ID NO: 12)

[0072] from Figure 5 It can be seen that under the induction of Astragalus substrate, the expression levels of the three enzyme genes were significantly upregulated: the expression level of ACE gene was 4.2 times that of the control group (P<0.01), the expression level of β-glucosidase gene was 5.8 times that of the control group (P<0.001), and the expression level of β-xylosidase gene was 3.9 times that of the control group (P<0.01). It can be inferred that NM-12 achieves the directional conversion of multiple saponin substrates through the synergistic expression of acetylesterase, β-glucosidase and β-xylosidase, and finally generates cycloastragalool.

[0073] Based on the substrate specificity verification results of Example 4, it can be confirmed that NM-12 achieves the directional conversion of various saponin substrates through the synergistic expression of acetylesterase, β-glucosidase and β-xylosidase, ultimately generating cycloastragaloyl alcohol.

[0074] Example 4: Validation of substrate specificity of Pyotrophic cephalosporin NM-12

[0075] To clarify the specific substrate spectrum and enzymatic mechanism of NM-12's conversion to cycloastragaloside, this example uses the main acetylated saponin monomers in three Astragalus membranaceus raw materials—astragaloside I, isoastragaloside I, and isoastragaloside II—as substrates and conducts in vitro co-incubation experiments with NM-12 bacterial culture.

[0076] High-concentration stock solutions (prepared with DMSO) were prepared for three saponin monomers: astragaloside I, isoastragaloside I, and isoastragaloside II. NM-12 seed culture was centrifuged at 4000 rpm for 10 minutes to collect the cells. After resuspending in sterile physiological saline, the high-concentration stock solutions of the three saponin monomers were added separately to achieve a final fermentation system with each standard concentration of 0.2 mg / mL and a final DMSO concentration of 0.5%. The reaction system was then incubated at 37℃ for 24 hours. After the reaction, the mixture was extracted with water-saturated n-butanol, and the formation of cycloastragaloside was detected by HPLC-ELSD. The results are shown below. Figure 4 As shown.

[0077] The results showed that ( Figure 4 NM-12 can convert astragaloside I, isoastragaloside I, and isoastragaloside II into cycloastragalol using these as substrates. This further verifies that NM-12 achieves the directional conversion of multiple acetylated saponin substrates through the synergistic expression of acetylesterase, β-glucosidase, and β-xylosidase, ultimately generating cycloastragalol.

[0078] In summary, when acetylated saponins such as astragaloside I, isoastragaloside I, and isoastragaloside II are used as substrates, NM-12 expresses acetylesterase, β-glucosidase, and β-xylosidase. First, acetylesterase removes the acetyl group from the sugar chain, and then β-glucosidase and β-xylosidase remove the sugar group, ultimately generating cycloastragalool.

[0079] Example 5: Safety Evaluation of NM-12

[0080] This embodiment investigated the safety of Pediococcus lactis NM-12, and the specific investigation content is as follows:

[0081] Hemolytic test: NM-12 was streaked onto blood agar medium and incubated at 37°C for 48 hours. Staphylococcus aureus ATCC 25923 was used as a positive control. The absence of a transparent hemolytic zone around the NM-12 colony indicated γ-hemolysis and no production of hemolysin.

[0082] Biofilm formation capacity determination: The OD of NM-12 was determined using the crystal violet staining method in a 96-well plate. 590 If the measured value is lower than the critical value of the blank control, it is determined that there is no biofilm formation ability.

[0083] Antibiotic susceptibility testing: The KB disk diffusion method was used to detect the susceptibility of NM-12 to a variety of commonly used antibiotics. NM-12 showed susceptibility to most of the tested antibiotics, which was consistent with the results of the resistance gene detection.

[0084] Antibiotic resistance gene and virulence factor detection: Based on whole-genome sequencing data, antibiotic resistance genes were compared using the CARD database (identity ≥70%, E-value ≤ 1e-5), and virulence factors were compared using the VFDB database. The VFDB database annotated four virulence-related homologous proteins (phosphopyruvate hydratase / enolase, ATP-dependent Clp protease proteolytic subunit, UTP-glucose-1-phosphate uridine ditransferase GalU, and elongation factor Tu). These proteins are all conserved functional proteins widely present in bacteria, mainly involved in physiological processes such as energy metabolism, protein homeostasis, carbohydrate metabolism, and protein translation, and are not clearly defined classical pathogenic virulence factors. The CARD database annotated five classes of drug resistance-related genes, involving aminoglycosides, fusidic acid, rifamycins / peptides, elfamycins, and lincosamides. The first four classes are all antibiotic target mutations with almost no possibility of metastasis. The lincosamide genes are located in regions containing Rep proteins and plasmid recombinant proteins, suggesting possible plasmid-related association, but no typical mobile genetic elements such as transposases or integrases were found, and there is no evidence that they have transmission value.

[0085] Based on the above results, NM-12 meets the safety requirements for microbial strains used in food processing and can be safely used in the food processing field.

[0086] Example 6: Optimization of fermentation conditions for Pyotrophic cephalosporin NM-12

[0087] This embodiment optimized the fermentation time, fermentation temperature, and solid-liquid ratio of Astragalus membranaceus NM-12 to produce cyclic astragalool. The specific steps are as follows:

[0088] Pietrococcus lactis NM-12 was inoculated into MRS liquid medium and incubated statically at 37°C for 16 hours until OD reached. 600 The concentration of the bacterial culture was set to 0.8-1.0 to obtain the seed culture. 5 mL of the seed culture was centrifuged at 4000 rpm for 10 minutes, the supernatant was discarded, and the bacterial cells were resuspended in 5 mL of sterile physiological saline (OD200). 600 (The concentration is 0.5-0.6), to obtain a bacterial suspension.

[0089] Fermentation steps: Crush the Astragalus membranaceus raw material and mix it with a physiological saline suspension of Pyrococcus lactis NM-12 (OD200). 600 Mix and let stand for fermentation (0.5-0.6%). After the fermentation product is dried at low temperature (≤50℃), it is pulverized to obtain fermented astragalus powder containing cycloastragalool.

[0090] (1) Optimization of fermentation time:

[0091] Fermentation was carried out at 37℃ with a bacterial suspension to astragalus powder mass ratio of 1:1, for fermentation times of 12h, 24h, 36h, 48h, and 60h, respectively, following the above fermentation steps. The content of cycloastragalol was measured after fermentation. The results showed that the cycloastragalol content increased with increasing fermentation time, reaching a peak at 24 hours, while there were no significant differences between 24 hours and 48 hours, 60 hours, and 48 hours (P>0.05). Considering production efficiency, 24 hours was selected as the optimal fermentation endpoint. Figure 5 a).

[0092] (2) Optimization of fermentation temperature:

[0093] Under the conditions of a bacterial suspension to astragalus powder mass ratio of 1:1 and a fermentation endpoint of 24 hours, fermentation temperatures of 25℃, 30℃, 35℃, 40℃, and 45℃ were set, and fermentation was carried out according to the above fermentation steps. The content of cycloastragalol was measured after 24 hours of fermentation. The results showed that the content of cycloastragalol first increased and then decreased with increasing temperature, reaching a peak at 35℃, which was significantly higher than that of the other temperature groups (P<0.05). Therefore, 35℃ is the optimal fermentation temperature. Figure 5 b).

[0094] (3) Optimization of the feed-liquid ratio:

[0095] Fermentation was carried out at 35℃ for 24 hours, with the mass ratio of bacterial suspension to astragalus powder set at 0.5:1, 0.75:1, 1:1, 1.25:1, and 1.5:1, respectively. Fermentation was performed according to the above steps, and the content of cycloastragalol was measured after fermentation. The results showed that the content of cycloastragalol increased with increasing material-to-liquid ratio, reaching a peak at 1:1. There was no significant difference between 1:1 and 1:25:1 and 1.5:1 (P>0.05). Considering the mass transfer efficiency and water activity of the semi-solid fermentation system, 1:1 was selected as the optimal material-to-liquid ratio. Figure 5 c).

[0096] In summary, the optimal fermentation conditions for the production of cycloastragalool from Astragalus membranaceus using NM-12 were determined to be: fermentation temperature 35℃, fermentation time 24h, and a material-to-liquid ratio of 1:1. Specifically, the Astragalus membranaceus raw material was pulverized and mixed with a physiological saline suspension of P. methemoglobin NM-12 (OD200). 600 Mix 0.5-0.6g of the sample at a mass ratio of 1:1 and let it ferment at 37℃ for 24 hours. After the fermentation product is dried at low temperature (≤50℃), it is pulverized to obtain fermented astragalus powder containing cycloastragaloyl alcohol.

[0097] Astragalus root raw material was pulverized, and the content of cycloastragalol in unfermented astragalus root raw material was compared with that in fermented astragalus root raw material. The cycloastragalol content in unfermented and fermented astragalus root powders was detected by HPLC-ELSD. The results showed that the cycloastragalol content in unfermented astragalus root raw material was below the detection limit, while a clear characteristic peak of cycloastragalol was detected in the fermented astragalus root powder produced by the method described in this invention, indicating that this method can effectively generate cycloastragalol, with a content of approximately 700-730 μg / g. Therefore, the fermented astragalus root powder can be used as a functional food ingredient containing cycloastragalol.

[0098] Example 7: Systematic comparison of substrate profiles and transformation capabilities of Pediococcus lactis NM-12 and control strains

[0099] To systematically evaluate the substrate profile and transformation advantage of *Pediococcus lactis* NM-12 compared to other homologous *Pediococcus lactis* strains, homologous *Lactobacillus reuteri* strains, and laboratory-preserved control strains, this example used non-acetylated saponins (astragaloside A) and acetylated astragalosides (astragaloside I, isoastragaloside I, isoastragaloside II) as substrates to investigate the cycloastragaloside production capacity of five *Pediococcus lactis* strains (NM-12, NM-1, NM-3, NM-5, NM-6), two *Lactobacillus reuteri* strains (NM-10, NM-11), the standard *Pediococcus lactis* strain ATCC 8042, and *Pediococcus lactis* strain M1-1, all homologous to *Astragalus membranaceus* from Guyang, Inner Mongolia, as described in Example 1. Furthermore, the actual fermentation effect of each strain was verified using *Astragalus membranaceus* raw material from Guyang as a substrate.

[0100] The specific steps are as follows:

[0101] (1) Comparison of conversion efficiency using non-acetylated saponins (astragaloside A) as substrates:

[0102] Nine bacterial strains were inoculated into MRS liquid medium and incubated at 37°C for 16 hours until OD reached. 600 The concentration was 0.8-1.0. Take 5 mL of seed culture, centrifuge at 4000 rpm for 10 minutes, discard the supernatant, and resuspend the bacterial cells in 5 mL of sterile physiological saline (OD). 600 (The concentration was 0.5-0.6). Take 1 mL of each bacterial suspension, add astragaloside A substrate (final concentration 0.2 mg / mL), and add sterile water to a final volume of 5 mL. Incubate at 37℃ for 24 hours. After the reaction, extract with water-saturated n-butanol, and detect the amount of cycloastragaloside produced by HPLC-ELSD. The results are shown in the table below. Figure 6 .

[0103] from Figure 6As can be seen, all tested strains were able to convert astragaloside A into cycloastragalool. The cycloastragalool production of homologous isolated *Pediococcus lactis* (NM-12, NM-1, NM-3, NM-5, NM-6) was 4.38–5.12 mg / L, which was higher than that of homologous isolated *Lactobacillus reuteri* (NM-10, NM-11, 2.85–3.09 mg / L) and laboratory-preserved control strains (ATCC 8042, M1-1, 2.87–2.91 mg / L). The amount of cycloastragalool produced by NM-12 on the astragaloside A substrate (4.38 mg / L) was not significantly different from that of other homologous Pediococcus lactis strains (NM-1, NM-3, NM-5, NM-6, 4.45~5.12 mg / L) (P>0.05), indicating that NM-12 did not show any particular advantage on non-acetylated saponin substrates.

[0104] (2) Comparison of conversion efficiency using acetylated astragaloside as a substrate:

[0105] Using astragaloside I, isoastragaloside I, and isoastragaloside II as substrates (final concentration 0.2 mg / mL), conversion experiments were performed according to the above method. The amount of cycloastragaloside generated was detected by HPLC-ELSD. The results are shown in [Figure 1]. Figure 7 .

[0106] from Figure 7 It can be seen that, when acetylated astragaloside is used as a substrate, only NM-12 exhibits highly efficient conversion ability (astragaloside I 4.82 mg / L, isoastragaloside I 5.33 mg / L, isoastragaloside II 4.18 mg / L). Other homologous *Pediococcus lactis* strains (NM-1, NM-3, NM-5, NM-6) showed only trace amounts of cycloastragaloside (0.24~0.55 mg / L), which is 6%~11% of that of NM-12. Homologous *Lactobacillus reuteri* (NM-10, NM-11) and laboratory-preserved control strains (ATCC 8042, M1-1) were completely unable to convert acetylated saponins. This result clearly demonstrates that the high efficiency of acetylated saponin conversion is unique to NM-12, and other homologous Pediococcus lactis strains, Lactobacillus reuteri strains, and laboratory-preserved strains do not possess this ability.

[0107] (3) Comparison of semi-solid fermentation using Astragalus membranaceus as a substrate:

[0108] Nine bacterial strains were prepared into bacterial suspensions (OD) according to the method in Example 2. 600 The concentration of cycloastragalool was 0.5-0.6 g, and it was mixed with 5 g of sterilized Astragalus membranaceus powder at a mass ratio of 1:1 and fermented in a semi-solid state at 35℃ for 24 hours. Cycloastragalool was extracted and quantitatively determined; the results are shown below. Figure 8 .

[0109] from Figure 8 It can be seen that the astragalool content of NM-12 after fermentation of Astragalus membranaceus from Guyang reached 737.4 μg / g, which was 7.7 times that of the standard strain of Pediococcus lactis ATCC 8042, 7.6 times that of M1-1, 7.3 times that of Lactobacillus reuteri NM-10, and 8.1 times that of NM-11, respectively. The yields of other homologous Pediococcus lactis strains (NM-1, NM-3, NM-5, NM-6) (186.8~220.8 μg / g) were only 25%~30% of that of NM-12.

[0110] Based on the results of Example 7 above, when astragaloside A was used as the substrate alone, there was no significant difference in transformation efficiency between NM-12 and other homologous Pediococcus lactis strains (P>0.05); however, when acetylated astragaloside was used as the substrate, the cycloastragalol production of NM-12 (4.18~5.33 mg / L) was 10~20 times that of the homologous strains (0.24~0.55 mg / L). This difference was directly reflected in the actual fermentation of Astragalus membranaceus raw materials—the cycloastragalol yield of NM-12 (737.4 μg / g) was 3.3~3.9 times that of the homologous strains (186.8~220.8 μg / g). Because the content of acetylated saponins in Guyang Astragalus raw materials (approximately 1.83 mg / g) is much higher than that of astragaloside A (approximately 0.60 mg / g), NM-12, through its unique acetylated saponin conversion ability, converts the previously unusable acetylated saponin precursors into cycloastragalol, achieving a total yield far exceeding that of other strains. Therefore, NM-12 can be used for fermentation of one or more substrates, including Astragalus raw materials, products containing acetylated astragaloside, non-acetylated astragaloside, and products containing acetylated or non-acetylated astragaloside, to produce cycloastragalol or products containing cycloastragalol.

[0111] In summary, this invention has obtained a strain of *Pediococcus lactis* NM-12 capable of efficiently converting *Astragalus membranaceus* raw materials into cycloastragalool through in-situ isolation from the surface of *Astragalus membranaceus* raw materials from Inner Mongolia. This strain can use astragaloside I, isoastragaloside I, and isoastragaloside II as substrates, and through the synergistic expression of acetylesterase, β-glucosidase, and β-xylosidase, directionally convert multiple saponin precursors into cycloastragalool, with a conversion efficiency significantly superior to other strains of the same species. Systematic safety evaluation has confirmed that this strain meets the safety requirements for microbial strains used in food processing. This invention employs a semi-solid-state fermentation method, which is simple to operate, requires low equipment requirements, and has good prospects for industrial application.

[0112] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A type of Pyrococcus lactis NM-12, characterized in that, The *Pediococcus lactis* NM-12 strain is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 68607, and the deposit date is July 13, 2026.

2. A microbial inoculant, characterized in that, The microbial agent comprises the *Pediococcus lactis* NM-12 as described in claim 1.

3. The use of the *Pediococcus lactis* NM-12 of claim 1 or the microbial agent of claim 2 in the fermentation of *Astragalus membranaceus* to produce cycloastragaloyl alcohol or products containing cycloastragaloyl alcohol.

4. The application according to claim 3, characterized in that, The applications include: acetylated astragaloside and / or non-acetylated astragaloside in fermented astragalus.

5. The application according to claim 4, characterized in that, The acetylated astragalosides include one or more of astragaloside I, isoastragaloside I, or isoastragaloside II.

6. A method for producing cycloastragaloyl alcohol, characterized in that, The method is based on the *Pediococcus lactis* NM-12 of claim 1 or the microbial inoculant fermentation substrate of claim 2; The substrate includes one or more of Astragalus membranaceus, acetylated astragaloside, non-acetylated astragaloside, and products containing acetylated or non-acetylated astragaloside.

7. The method according to claim 6, characterized in that, The method includes: activating Pediococcus lactis NM-12 to obtain a seed culture, centrifuging to collect the bacterial cells, and resuspending to obtain a bacterial suspension of Pediococcus lactis NM-12; mixing the bacterial suspension with a substrate and then fermenting to obtain a fermentation product containing cycloastragalol.

8. The method according to claim 7, characterized in that, The OD value of the seed solution is 0.8-1.0; The bacterial suspension has a mass ratio of 1:1 to Astragalus membranaceus; the OD value of the bacterial suspension is 0.5-0.

6.

9. The method according to claim 7, characterized in that, The astragalus is dried, pulverized, and sterilized to obtain a powder.

10. The method according to claim 7, characterized in that, The fermentation conditions were: fermentation at 37°C for 24 hours.

Images