Delftia tsuruhatensis and application thereof in prevention and treatment of aphidoidea disease

Abstract

The application discloses a Delftia tsuruhatensis strain and application thereof in prevention and treatment of Ichthyophthirius multifiliis disease, and belongs to the technical field of fish disease prevention and treatment. Delftia tsuruhatensis DT W19, which is preserved in the China Center for Type Culture Collection and has a preservation number of CCTCC NO: M 20252609. The DT W19 strain provided by the application is completely independently isolated from rainbow trout gills by the inventors, has excellent resistance to Ichthyophthirius multifiliis, is convenient to use, can effectively resist invasion of Ichthyophthirius multifiliis in a direct soaking mode, and has great application potential in prevention and treatment of Ichthyophthirius multifiliis disease.

Description

Technical Field

[0001] This invention relates to the field of fish disease prevention and control technology, specifically to a strain of Delftobacterium tsurugi and its application in the prevention and treatment of Ichthyophthirius multifiliis disease. Background Technology

[0002] Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) Ichthyophthirius multifiliis Ichthyophthirius multifiliis (hereinafter referred to as Ich) is a freshwater parasite distributed globally and is considered one of the most challenging pathogens in fish farming. The "white spot disease" it causes severely impacts fish health, resulting in high mortality rates and significant economic losses to the aquaculture industry. The life cycle of Ich is mainly divided into four stages: trophozoite stage, cyst precursor stage, cyst stage, and predatory stage. The trophozoite refers to the parasite that parasitizes the fish, feeding on fish tissue cells and maturing; it is usually visible to the naked eye (approximately 0.4-0.6 mm). In the final stage of the trophozoite, Ich leaves the fish as a cyst precursor and secretes a translucent, proteinaceous gel-like cyst wall on any available environmental substrate. Inside the cyst, the dividing precursor gradually differentiates into an infectious larva, which then emerges and detaches from the cyst. Through a combination of mechanical and enzymatic action, it invades and penetrates the fish's surface, settles, and transforms into a trophozoite, completing its entire life cycle. The reason why Ichthyophthirius multifiliis is highly harmful is mainly because it has low host specificity and can infect almost all kinds of freshwater fish, including channel catfish, rainbow trout, carp, grass carp, and zebrafish.

[0003] The integrated management of Ichthyophthirius multifiliis (Ich) in aquaculture still faces severe challenges. Traditional physical control methods (raising the temperature to 30°C and salinity to 3‰) can accelerate parasite shedding, but they easily induce metabolic disorders in fish, and are difficult to implement in cold-water fish (such as rainbow trout). Chemical drugs (such as malachite green) have been banned due to their carcinogenicity, while heavy metal preparations such as copper sulfate easily accumulate in fish, threatening food safety. Although extracts of traditional Chinese medicine (such as emodin) inhibit predator activity in vitro, their penetration into trophozoites during the parasitic stage is insufficient, and large-scale production is not feasible. Although the antimicrobial peptide HBβ-C can target the entire life cycle of the parasite, its high cost limits its industrial application. Fish live in a unique environment, and their mucous membranes constitute an important barrier (including microbial and immune barriers). However, existing strategies generally lack in-depth analysis of the host-parasite interaction mechanism and have not fully explored the antiparasitic potential of the fish mucous membrane barrier.

[0004] Fish body surface mucosa harbors a rich and complex microbial network that participates in regulating the host's mucus barrier function, immune system development, nutrient absorption, and neuroendocrine regulation, playing a crucial role in maintaining host health. The symbiotic microbiota colonizing the mucosal surface can resist pathogen invasion through nutrient competition, secretion of antibacterial substances, or activation of the host's immunity, thus exerting a microbial barrier effect. Currently, some studies have reported the anti-Ichthyophthirius multifiliis infection effects of bacteria. For example, the metabolites produced by bacteria such as mycotoxins from *Streptomyces griseus* SDX-4, amphotericin B from *Streptomyces HL-2-14*, lepromycin B from *Streptomyces CJK17*, and salinomycin from *Streptomyces JSY-2* exhibit excellent antiparasitic activity. In vitro, they can significantly kill *Ichthyophthirius multifiliis* and interrupt its life cycle stages, including cyst precursor, cyst, and predator. Simultaneously, immersion in the bacteria can also reduce the *Ichthyophthirius multifiliis* load in the host. Studies have also reported that the surfactant PS lipopeptide produced by Pseudomonas H5 can activate the immune response of rainbow trout, significantly upregulating genes for antimicrobial peptides (cathelicidin-1), hepcidin, IFNγ, IL-1β, and IL-6 to resist Ichthyophthirius multifiliis infection. From the perspective of microbial insecticide control, implementing biological control can effectively reduce the use of chemical drugs, providing important theoretical basis and practical direction for promoting the healthy and sustainable development of the aquaculture industry. Summary of the Invention

[0005] In view of the technical problems in the background art, the present invention aims to discover new bacteria that have excellent preventive and / or therapeutic effects on Ichthyophthirius multifiliis infection, and provide new microbial resources for the prevention and control of Ichthyophthirius multifiliis disease.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a strain of *Delfordia tsuruhata*, specifically *Delfordia tsuruhata* (… Delftia tsuruhatensis )DT W19, its accession number is CCTCC NO: M 20252609.

[0007] The preservation information for the above-mentioned strain (Delfordia tsurugi DT W19) is as follows: Name of depositary institution: China Center for Type Culture Collection (CCTCC); Address of the depositary institution: Wuhan University, Wuhan, China; Deposit date: November 20, 2025; Accession number: CCTCC NO: M 20252609.

[0008] The Delfordia tsurugi DT W19 provided by this invention was isolated by the inventors from the gill mucosa of rainbow trout that survived infection with Ichthyophthirius multifiliis. It can colonize the gill tissue of fish and exert anti-Ichthyophthirius multifiliis activity.

[0009] Secondly, the present invention provides a microbial inoculant containing *Delfordia tsurugi* DT W19. The formulation of this microbial inoculant is not specifically limited; it can be a dry powder, a wettable powder, or a liquid inoculant.

[0010] Thirdly, the present invention provides a fermentation product obtained by culturing *Delfordia tsurugi* DT W19 in a liquid culture medium. It is understood that the fermentation product comprises at least one of *Delfordia tsurugi* DT W19, fermentation supernatant, and fermentation extract (i.e., the active ingredient obtained from the fermentation supernatant). For example, in some embodiments of the present invention, the fermentation product is a bacterial suspension obtained by fermenting *Delfordia tsurugi* DT W19 in a liquid culture medium; in other embodiments, the fermentation product is the supernatant obtained by centrifugation after culturing *Delfordia tsurugi* DT W19 in a liquid culture medium.

[0011] Fourthly, this invention provides the application of *Delfordia tsurugi* DT W19 and its related derivatives in the preparation of products for the prevention and treatment of Ichthyophthirius multifiliis (white spot disease). Experiments of this invention show that *Delfordia tsurugi* DT W19 can colonize the gill tissue of fish and effectively reduce the load of *Ichthyophthirius multifiliis* in the gill tissue, thereby achieving prevention and treatment of *Ichthyophthirius multifiliis* infection. Simultaneously, the fermentation supernatant of *Delfordia tsurugi* DT W19 can effectively kill *Ichthyophthirius multifiliis* cyst precursors and predators, interrupting the life cycle of *Ichthyophthirius multifiliis* and reducing infectivity. Therefore, the aforementioned products for the prevention or treatment of Ichthyophthirius multifiliis may contain *Delfordia tsurugi* DT W19, and / or the fermentation supernatant of *Delfordia tsurugi* DT W19 (or the active ingredient in the supernatant).

[0012] Fifthly, the present invention provides a method for preventing or treating Ichthyophthirius multifiliis disease, specifically by soaking fish in a bacterial solution containing *Delfordia tsurugi* DT W19. In some embodiments of the present invention, *Delfordia tsurugi* DT W19 is cultured in BHI liquid medium, and the resulting bacterial solution, after appropriate dilution, is used to soak the fish, allowing *Delfordia tsurugi* DT W19 to colonize the fish, thereby achieving an antiparasitic effect.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: The Tsuruhata Delford strain DT W19 provided by this invention was completely isolated from rainbow trout gills by the inventors. This strain has excellent resistance to Ichthyophthirius multifiliis and is easy to use. It can effectively resist Ichthyophthirius multifiliis invasion by direct soaking, thereby reducing the occurrence of disease. Attached Figure Description

[0014] To more clearly illustrate the technical solution of the present invention, the accompanying drawings used in the present invention will be briefly described below. Obviously, the drawings described below are merely some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.

[0015] Figure 1 The sequence alignment results of the *Delfordia tsurugi* strain isolated in Example 1; Figure 2 The images show the culture and staining results of *Delfordia tsurugi* isolated in Example 1. A represents the solid culture result, and B represents the staining result. Figure 3 The results of the analysis of the in vivo colonization effect of *Delfordia tsurugi* in Example 2; Figure 4 The results of the in vitro insecticidal activity of *Delfordia tsurugi* in Example 3 are shown. A represents the insecticidal activity against the cyst precursor of *Ichthyophthirius multifiliis*, and B represents the insecticidal activity against *Ichthyophthirius multifiliis* predators. Figure 5 The results of the in vivo insecticidal activity of *Delfordia tsurugi* in Example 4 are shown. A represents the preventive effect against *Ichthyophthirius multifiliis* infection, and B represents the therapeutic effect against *Ichthyophthirius multifiliis* infection. Explanation of reference numerals in the attached figures: express p <0.05, express p <0.01, express p <0.001, significance was calculated using the unpaired Student's t-test. Detailed Implementation

[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the invention.

[0017] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they shall be performed in accordance with the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.

[0018] Example 1 This example demonstrates the acquisition and identification of *Delfordia tsurugi* DT W19. The specific experimental procedure and identification results are as follows: Rainbow trout were infected with Ichthyophthirius multifiliis, and gill mucosa samples from surviving infected trout were obtained for isolation and purification. The inventors isolated four strains of Delfordia (…). Delftia The sequence was then amplified by PCR using 16S rRNA primers, and the obtained sequence was compared with existing sequences. The results are as follows: Figure 1 As shown, 4 plants were found. Delftia All belong to Tsuruhada Delfordia ( Delftia tsuruhatensis ), and named them DT W9, DT W19, DT W38, and DT W43.

[0019] The four isolated *Delfordia tsurugi* strains were further cultured and stained. For solid-state culture, the bacteria preserved at -80℃ were removed, thawed, and a small amount was streaked onto BHI solid medium using an inoculation loop. The culture was then incubated upside down at 37℃ for 24 h. For liquid-state culture, the bacteria preserved at -80℃ were removed, thawed, and 10 μL was added to 1 mL of BHI liquid medium. The culture was then incubated at 37℃ on a shaker at 200 rpm for 24 h. The staining method includes the following steps: (1) Smear: Before smearing, wipe the slide with alcohol to ensure it is clean and free of oil. When smearing, first add a drop of sterile water to the slide, then use a cooled inoculation loop to take a small amount of bacteria from the solid culture medium and mix it with the sterile water on the slide. Spread the mixture from the center outwards, with the thickness just enough to make it slightly turbid to the naked eye. The smear should be thin and uniform. (2) Primary stain: Use crystal violet for primary staining for 1 minute. (3) Wash: Rinse with tap water. (4) Mordant: Use iodine solution for mordant staining for an appropriate time (60s). (5) Wash: Rinse with tap water and absorb the water with absorbent paper. (6) Decolorize: Add a few drops of 95% alcohol and gently shake to decolorize. The alcohol decolorization time should be appropriate (30s). (7) Counterstain: Use safranin staining solution for 1 minute, then rinse with tap water. (8) Dry and examine under a microscope.

[0020] The culture and staining results of four strains of *Delfordia tsurugi* are as follows: Figure 2 As shown: This bacterium forms round, smooth, yellow colonies on solid culture medium. Figure 2 A); After Gram staining of a single colony, the bacterial cells appear pink ( Figure 2 B) indicates that the bacterium is Gram-negative and that the bacterial cell is rod-shaped.

[0021] Example 2 This example tested the in vivo colonization effect of *Dalfordii* DT W19. The specific experimental procedure and results are as follows: Delfordia tsurugi DT W19 was added to BHI liquid medium and cultured at 37°C with a shaker at 200 rpm for 36 h. The Delfordia tsurugi bacterial solution was then diluted 1:100 and used to soak rainbow trout. The bacterial solution was changed daily for two weeks. The Delfordia tsurugi load in the gills of the rainbow trout was then measured. The detection method was as follows: DNA was extracted from the gill tissue of the treated rainbow trout and amplified using Delfordia tsurugi-specific primers; the upstream primer was TTTCAATCTCACCGTGCCGT (SEQ ID NO.1), and the downstream primer was TGCGAGATTTCGCCGTTTTC (SEQ ID NO.2).

[0022] Test results as follows Figure 3 As shown, *Delfordia tsurugi* DT W9, DT W19, DT W38, and DT W43 can all colonize well on the surface of gill tissue.

[0023] Example 3 This example tests the in vitro insecticidal activity of *Delfordia tsurugi* DT W19. The specific experimental procedure and results are as follows: The Delfordia tsurugi culture, which had been cultured for 36 hours (culture method as in Example 2), was centrifuged at 4000 g for 10 min. The supernatant was collected, filtered through a 0.22 μm filter membrane, and then used for later use.

[0024] For the activity assay of anti-Ichthyophthirius multifiliis cyst precursor: First, collect Ichthyophthirius multifiliis cyst precursors and add them to a 24-well culture plate at a rate of 30 per well. Then, dilute BHI liquid culture medium and bacterial supernatant at ratios of 1:8, 1:12, 1:16, 1:20, 1:24, and 1:28 and add them to the culture plate. After 4 hours of treatment, the mortality rate of the cyst precursors is counted.

[0025] For the activity test against Ichthyophthirius multifiliis predators: First, Ichthyophthirius multifiliis predators were collected and added to 24-well culture plates at a rate of 3000 predators / well. Then, BHI liquid culture medium and bacterial supernatant were diluted at ratios of 1:24, 1:32, 1:40, 1:48, 1:56, and 1:64. After 4 hours of treatment, the mortality rate of the predators was counted.

[0026] Test results as follows Figure 4 As shown, the DT W19 bacterial supernatant exhibited the best in vitro insecticidal effect compared to the other three strains of Delfordia tsurugi.

[0027] Example 4 This example tests the in vivo insecticidal effect of *Delfordia delphinidin* DT W19. The specific experimental procedure and results are as follows: (1) Prevention effect test Rainbow trout were soaked in a 1:100 dilution of Delfordia tsurugi cultured for 36 h (culture method as in Example 2). The bacterial solution was changed daily and soaked for 2 weeks. After that, the trout were infected with Ichthyophthirius multifiliis. Samples were taken 7 days after infection and the load of Ichthyophthirius multifiliis in the gill tissue of the rainbow trout was detected using an optical dissecting microscope.

[0028] Test results as follows Figure 5 As shown in A, all four strains of Delftobacterium tsurugi showed preventive effects against Ichthyophthirius multifiliis infection, with DTW19 showing the best effect.

[0029] (2) Detection of treatment effect First, rainbow trout were infected with Ichthyophthirius multifiliis. 12 hours after infection, rainbow trout were soaked in a 36-hour culture of Delfordia tsurugi (culture method as in Example 2) diluted at a ratio of 1:100. The bacterial solution was changed daily. The load of Ichthyophthirius multifiliis in the gill tissue of rainbow trout was detected 7 days after infection.

[0030] Test results as follows Figure 5 As shown in B, all four strains of Delfoglioella tsurugi were effective in treating Ichthyophthirius multifiliis infection, with DTW19 showing the best efficacy.

[0031] In summary, *Delfordia tsurugi* can colonize the surface of gill tissue well. Not only does its fermentation supernatant have excellent killing activity against Ichthyophthirius multifiliis cyst precursors and predators, but it can also effectively reduce the load of Ichthyophthirius multifiliis in gill tissue during infection, thereby achieving the prevention and treatment of Ichthyophthirius multifiliis disease.

[0032] It should be noted that the present invention is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments that have the same structure and perform the same effects as the technical concept within the scope of the present invention are included within the scope of the present invention. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of the present invention, are also included within the scope of the present invention.

Claims

1. A strain of *Delfordia tsuruha*, characterized in that, The Delfordia tsurugi is... Delftia tsuruhatensis DT W19 is deposited at the China Center for Type Culture Collection with accession number CCTCC NO: M20252609.

2. A microbial inoculant, characterized in that, Contains the *Delfordia tsurugi* as described in claim 1.

3. A fermentation product, characterized in that, It is prepared from the *Delfordia tsurugi* as described in claim 1 or the microbial agent as described in claim 2.

4. The fermentation product according to claim 3, characterized in that, The fermentation product is the fermentation supernatant, or the product obtained by concentrating and / or drying the fermentation supernatant.

5. The use of the *Delfordia tsurugi* DT W19 as described in claim 1 or the microbial agent as described in claim 2 in the preparation of products for the prevention and treatment of Ichthyophthirius multifiliis disease.

6. A product for the prevention or treatment of Ichthyophthirius multifiliis infection, characterized in that, The supernatant contains the *Delfordia tsurugi* DT W19 as described in claim 1, and / or the bacterial supernatant containing the *Delfordia tsurugi* DT W19 as described in claim 1.

Images