A lactobacillus muciappilus and uses thereof

Abstract

This invention discloses a strain of *Lactobacillus mucosa* and its uses. In this invention, *Lactobacillus mucosa* (… Limosilactobacillus mucosae The JZL-P316 strain, with accession number CGMCC No. 38004, is the first strain of *Lactobacillus mucosa* isolated from healthy pig feces. This strain metabolizes *Lactobacillus mucosa* to produce 4-hydroxyphenylacetic acid under the action of the substrate salidroside. Furthermore, this invention provides the use of *Lactobacillus mucosa* in the preparation of 4-hydroxyphenylacetic acid under the action of salidroside. The synthesis of 4-hydroxyphenylacetic acid using *Lactobacillus mucosa* of this invention under the action of salidroside not only achieves environmental friendliness and sustainability but also demonstrates the advantage of precise targeting in its mechanism of action; moreover, it is efficient and low-cost, meeting the growing demand for 4-hydroxyphenylacetic acid in the pharmaceutical, pesticide, and fine chemical industries.

Description

Technical Field

[0001] This invention relates to the field of microbiology, specifically to a mucosal lactobacillus and its uses. Background Technology

[0002] Mucosal lactobacillus ( Limosilactobacillus mucosae *Lactobacillus mucosa* is the type strain of the genus *Lactobacillus*, widely distributed in the human gut, oral cavity, vagina, and fermented foods. Besides its use in taxonomic research, it also possesses probiotic functions such as regulating host flora, enhancing immunity, and inhibiting pathogenic bacteria. Studies have shown that in a piglet model of diarrhea, its extracellular vesicles can alleviate ETEC K88-induced diarrhea and improve gut microbiota imbalance by regulating macrophage phenotype. Therefore, *Lactobacillus mucosa* has significant value in the intervention of intestinal diseases and in the study of probiotic mechanisms.

[0003] 4-Hydroxyphenylacetic acid (4-HPAA), a key organic synthetic intermediate, is widely used in the pharmaceutical, pesticide, and dye industries. In the pharmaceutical field, representative drugs synthesized from it include: the cardiovascular drug atenolol (whose active ingredient is 4,7-dihydroxyisoflavones, clinically used to treat hypertension-related diseases); the anti-inflammatory and analgesic drug benzoxetine (suitable for rheumatoid arthritis, osteoarthritis, and other inflammatory diseases); and the antibiotic cefoperazone sodium (which causes cell death by blocking bacterial cell wall synthesis). In pesticides, insecticides derived from this intermediate possess multiple effects, including contact, repellency, and antifeedant properties, and are safe for warm-blooded animals, have low fish toxicity, good photostability, and a long residual effect.

[0004] In recent years, with the rapid development of my country's pharmaceutical industry, the market demand for 4-hydroxyphenylacetic acid and its derivatives has continued to rise, and their application areas have been constantly expanding. Although China currently has a certain production capacity, it still faces problems such as lengthy synthetic routes, low yields, and high prices. More importantly, existing production processes often use large amounts of strong acids and alkalis, resulting in large wastewater discharges and significant environmental pollution. In summary, screening intestinal microbial strains capable of synthesizing 4-hydroxyphenylacetic acid using different technologies can not only improve the yield of this compound but also provide more diverse and effective microbial resources for the intervention and treatment of various diseases. Furthermore, 4-hydroxyphenylacetic acid produced based on biological methods has the characteristics of precision, greenness, environmental friendliness, and high efficiency. In comparison, 4-hydroxyphenylacetic acid directly produced from porcine intestinal microorganisms has superior biocompatibility, thus showing greater potential in application development. Summary of the Invention

[0005] In view of the technical problems existing in the prior art, the present invention provides a mucosal lactobacillus and its uses.

[0006] The first aspect of this invention protects a strain of *Lactobacillus mucosa* JZL-P316, which is classified and named *Lactobacillus mucosa*. Limosilactobacillus mucosae The depositary institution is the China General Microbiological Culture Collection Center (CGMCC), the accession number is CGMCC No. 38004, and the deposit date is April 1, 2026.

[0007] This bacterium is a strictly anaerobic strain isolated and purified from pig feces. It has the advantages of rapid reproduction (this strain can rapidly achieve OD exponential growth in a short period of time), stable metabolism (it has the function of producing 4-hydroxyphenylacetic acid in vitro without significant attenuation), and high production of 4-hydroxyphenylacetic acid (compared with Lactobacillus conjugatus).

[0008] In some embodiments, the 16S rDNA sequence of the *Lactobacillus mucosae* is shown in SEQ ID NO.1.

[0009] A second aspect of the present invention protects a culture obtained from the above-mentioned *Lactobacillus mucosae*.

[0010] A third aspect of the present invention protects a microbial agent comprising the above-mentioned *Lactobacillus mucosae* or the above-mentioned culture.

[0011] The fourth aspect of the present invention protects the use of the above-mentioned mucosal lactobacillus or the above-mentioned culture or the above-mentioned microbial agent in the preparation of 4-hydroxyphenylacetic acid.

[0012] The fifth aspect of this invention protects a method for preparing 4-hydroxyphenylacetic acid, comprising the following steps: In an anaerobic atmosphere, using 15-25 g / L rhodioloside as a substrate, the above-mentioned *Lactobacillus mucosae* or the above-mentioned microbial inoculum was cultured to obtain 4-hydroxyphenylacetic acid.

[0013] In some embodiments, the culture medium used during cultivation contains one or more of peptone, dehydrated calf brain extract, dehydrated calf heart extract, sodium chloride, glucose, and disodium hydrogen phosphate.

[0014] In some embodiments, the culture medium comprises 5-15.0 g / L peptone, 7-18 g / L dehydrated calf brain extract, 1-10 g / L dehydrated calf heart extract, 1-10 g / L sodium chloride, 1-4 g / L glucose, and 1-5 g / L disodium hydrogen phosphate.

[0015] In some specific embodiments, the culture medium consists of 10.0 g / L peptone, 12.5 g / L dehydrated calf brain extract, 5.0 g / L dehydrated calf heart extract, 5.0 g / L sodium chloride, 2.0 g / L glucose, 2.5 g / L disodium hydrogen phosphate, and a pH of 7.4 ± 0.2.

[0016] In some embodiments, the culture medium used during cultivation comprises one or more of the following: casein peptone, yeast extract, sodium bicarbonate, cysteine, dipotassium bicarbonate, potassium dihydrogen carbonate, sodium chloride, ammonium sulfate, magnesium sulfate heptahydrate, calcium chloride, resazurin, heme, biotin, cobalamin, para-aminobenzoic acid, folic acid, pyridoxine, thiamine, riboflavin, and glucose.

[0017] In some embodiments, the culture medium comprises 0.5-1.5 g / L casein peptone, 1-5 g / L yeast extract, 2-6 g / L sodium bicarbonate, 0.5-1.5 g / L cysteine, 0.1-1 g / L dipotassium bicarbonate, 0.1-1 g / L potassium dihydrogen carbonate, 0.5-1.3 g / L sodium chloride, 0.5-1.3 g / L ammonium sulfate, 0.01-0.9 g / L magnesium sulfate heptahydrate, 0.01-0.9 g / L calcium chloride, 0.001 g / L resazurin, 0.01 g / L heme, 0.01 g / L biotin, 0.00001 g / L cobalamin, 0.00003 g / L para-aminobenzoic acid, 0.00005 g / L folic acid, 0.00015 g / L pyridoxine, and 0.01-0.1 g / L thiamine. g / L, riboflavin 0.01~0.1 g / L and glucose 1~4 g / L.

[0018] In some specific embodiments, the culture medium comprises 1.0 g / L casein peptone, 2.5 g / L yeast extract, 4.0 g / L sodium bicarbonate, 1.0 g / L cysteine, 0.45 g / L dipotassium bicarbonate, 0.45 g / L potassium dihydrogen carbonate, 0.9 g / L sodium chloride, 0.9 g / L ammonium sulfate, 0.09 g / L magnesium sulfate heptahydrate, 0.09 g / L calcium chloride, 0.001 g / L resazurin, 0.01 g / L heme, 0.00001 g / L biotin, 0.00001 g / L cobalamin, 0.00003 g / L para-aminobenzoic acid, 0.00005 g / L folic acid, 0.00015 g / L pyridoxine, 0.05 g / L thiamine, 0.05 g / L riboflavin, and 2.0 g / L glucose.

[0019] In some specific embodiments, the culture medium contains 20 g / L of the substrate rhodioloside.

[0020] In some embodiments, the anaerobic atmosphere consists of nitrogen, carbon dioxide, and hydrogen.

[0021] In some embodiments, the volume ratio of nitrogen, carbon dioxide, and hydrogen is (6-10):1:1. Preferably, the volume ratio of nitrogen, carbon dioxide, and hydrogen is 8:1:1.

[0022] In some embodiments, the culture temperature is 30-40 °C. Preferably, the culture temperature is 37 °C.

[0023] In some embodiments, the culture time is 24 to 55 hours. Preferably, the culture time is 48 hours.

[0024] In some implementations, the culture process also includes separation and purification.

[0025] A sixth aspect of the present invention protects a primer for amplifying the above-mentioned *Lactobacillus mucosae*, comprising the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0026] Compared with the prior art, the present invention has the following beneficial effects: This invention marks the first time that *Lactobacillus mucosa* JZL-P316, capable of producing 4-hydroxyphenylacetic acid (4-HPA), has been isolated from the pig intestine, and its functional characteristics have been systematically confirmed through in vitro single-strain fermentation experiments. This discovery possesses significant innovation and application value, primarily in the following aspects: First, the novel *Lactobacillus mucosa* strain isolated in this invention provides a stable, green, and efficient biological source for the large-scale production of 4-HPA. Compared to traditional chemical synthesis methods, biosynthesis offers significant advantages such as environmental friendliness, resource renewability, precise processes, and high efficiency. By optimizing culture conditions, the yield of 4-HPA can be significantly increased, meeting the growing demand for 4-HPA in the pharmaceutical, pesticide, and fine chemical industries. Attached Figure Description

[0027] Figure 1 This image shows a morphological observation of the *Lactobacillus mucosae* strain JZL-P316 in Example 1 of the present invention; scale bar: 20µm.

[0028] Figure 2 This shows the growth curves of *Lactobacillus mucosa* JZL-P316 at different time points in Example 2 of the present invention.

[0029] Figure 3 This shows the growth curves of *Lactobacillus mucosa* JZL-P316 with the substrate rhodioloside added at different time periods in Example 2 of the present invention.

[0030] Figure 4 The mass spectrum of the 4-hydroxyphenylacetic acid standard in Example 3 of the present invention is shown.

[0031] Figure 5 This shows the mass spectrum of 4-hydroxyphenylacetic acid in the supernatant of YCFAG of *Lactobacillus mucosa* JZL-P316 in Example 3 of the present invention.

[0032] Figure 6 This shows the mass spectrum of 4-hydroxyphenylacetic acid in the supernatant of *Lactobacillus mucosa* JZL-P316 in YCFAG with added rhodioloside, as described in Example 3 of the present invention.

[0033] Figure 7 This shows the content of 4-hydroxyphenylacetic acid in the supernatant of the control group, the mucosal lactobacillus intervention group, and the conjugated lactobacillus intervention group after culturing in YCFAG medium in Example 3 of the present invention; ns indicates no significant difference.

[0034] Figure 8 This shows the content of 4-hydroxyphenylacetic acid in the supernatant of YCFAG medium supplemented with rhodioloside in the control group, mucosal lactobacillus intervention group, and conjugated lactobacillus intervention group in Example 3 of the present invention; ns indicates no significant difference, and ** indicates p < 0.01. Detailed Implementation

[0035] The following are specific embodiments of the present invention, which further describe the technical solution of the present invention. However, the content of the present invention is not limited to the scope described in the embodiments. Any changes or equivalent substitutions that do not depart from the concept of the present invention are included within the protection scope of the present invention.

[0036] The culture medium used in the embodiments of this application is as follows: The formula for BHI liquid culture medium containing calf brain and heart extract is as follows (per 1 L): 10.0 g peptone; 12.5 g dehydrated calf brain extract powder; 5.0 g dehydrated calf heart extract powder; 5.0 g sodium chloride; 2.0 g glucose; 2.5 g disodium hydrogen phosphate; adjust the pH to 7.4±0.2; bring the volume to 1 L; and autoclave at 121℃ for 15 min.

[0037] Modified YCFAG medium: Casein peptone 1.0 g / L, yeast extract 2.5 g / L, sodium bicarbonate 4.0 g / L, cysteine ​​1.0 g / L, dipotassium bicarbonate 0.45 g / L, potassium dihydrogen carbonate 0.45 g / L, sodium chloride 0.9 g / L, ammonium sulfate 0.9 g / L, magnesium sulfate heptahydrate 0.09 g / L, calcium chloride 0.09 g / L, resazurin 0.001 g / L, heme 0.01 g / L, biotin 0.00001 g / L, cobalamin 0.00001 g / L, para-aminobenzoic acid 0.00003 g / L, folic acid 0.00005 g / L, pyridoxine 0.00015 g / L, thiamine 0.05 g / L, riboflavin 0.05 g / L, glucose 2.0 g / L; adjust volume to 1. L, sterilized at 121℃ under high temperature and pressure for 15 minutes.

[0038] The 4-hydroxyphenylacetic acid (4-HPAA) standard in this application was purchased from Shanghai Yuanye Biotechnology Co., Ltd., product number: S31340-25g.

[0039] In the embodiments of this application, the substrate rhodioloside was purchased from Puxicon Reagent Company (catalog number: S10254-100MG), dissolved in autoclaved and filtered ddH2O, with a stock solution concentration of 10 mg / mL and a working concentration of 0.2 mg / mL.

[0040] In the embodiments of this application, *Lactobacillus mucosa* ( Limosilactobacillus mucosae The 16S rDNA sequencing sequence of JZL-P316 is shown in SEQ ID NO.1.

[0041] SEQ ID NO.1:

[0042] Example 1: Screening, identification and preservation of Lactobacillus mucosa strain JZL-P316 1.1 Sample Source Select feces from healthy 30-day-old pigs in Nanyang, Henan Province.

[0043] 1.2 Isolation and purification of strains Approximately 8 g of fresh fecal sample was collected in a 50 mL sterile tube and immediately sent to the laboratory for bacterial isolation. Approximately 2 g of fecal sample was pre-placed in a 37 ℃ anaerobic workstation and, after nitrogen equilibration, transferred to 4 mL of sterile PBS buffer. The sample was vortexed and allowed to stand for 4-5 min until large fecal particles settled to the bottom. Then, a serial dilution was performed in the anaerobic workstation, and 10 g samples were selected for further analysis. 4 10 5 10 6 Three different dilution gradients were used. For each gradient, 100 μL of supernatant was evenly spread onto BHI agar medium and incubated at 37 °C for 24–50 h in an anaerobic workstation.

[0044] After cultivation, plates with single colonies were selected from BHI agar medium. Typical colonies with different shapes and colors were labeled and then purified a second or even third time on BHI agar medium. Subsequently, single colonies with different shapes and colors were picked and amplified in brain heart infusion medium. The amplified bacterial solutions were used for cryopreservation (50% glycerol), morphological observation, and 16S rDNA sequencing identification.

[0045] 1.3 Morphological observation The purified strain was cultured in BHI liquid medium and Gram staining was performed on the strain using a Gram staining kit (Beijing Aoboxing Biotechnology Co., Ltd., catalog number 04-001).

[0046] Spread 5 μL of bacterial suspension evenly onto a clean, grease-free glass slide, allow it to air dry, and then fix it with an alcohol lamp. After fixing, stain the sample with crystal violet for 1 min, rinse with water; add Gram's iodine solution for 1 min of enzyme staining, rinse with water; decolorize with 95% ethanol for 30 s, rinse with water; counterstain with safranin solution for 1 min, rinse with water, and wipe dry before microscopic examination.

[0047] Gram-stained bacterial strain samples were observed under a 100× objective lens and a 30× eyepiece. Figure 1 A Gram-positive, short rod-shaped strain was obtained.

[0048] 1.4 16S rDNA Identification The bacterial culture solution after amplification was used as a template for PCR amplification, and PCR reaction experiments of 16S rDNA were carried out using the universal bacterial primers 27F and 1492R.

[0049] 27F (SEQ ID NO. 2): AGAGTTTGATCCTGGCTCAG; 1492R (SEQ ID NO. 3): TACGGCTACCTTGTTACGACTT.

[0050] The PCR reaction experimental system (50 μL) was as follows: template: 1 μL, 27 F: 2 μL, 1492 R: 2 μL, 2×Rapid TaqMaster Mix: 25 μL, ddH2O: 20 μL.

[0051] The PCR reaction program was as follows: pre-denaturation 95℃: 5 min, denaturation 95℃: 15 s, annealing 55℃: 15 s, extension 72℃: 1 min 30 s, denaturation, annealing, and extension steps were repeated 30 times, final extension 72℃: 5 min, and stored at 10℃.

[0052] After the PCR reaction was completed, the PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for 16S rDNA sequencing. The sequencing results are shown in SEQ ID NO.1. The sequence was then compared with the BLAST sequence on the website of the National Center for Biotechnology Information (NCBI). The results showed that the sequence matched that of the type strain in GenBank. Limosilactobacillus mucosae With a homology of over 99%, the selected strain was identified as *Lactobacillus mucosa*.

[0053] Based on morphological analysis and 16S rDNA analysis, strain JZL-P316 was identified as *Lactobacillus mucosa*. The taxonomic name of this strain is *Lactobacillus mucosa* (…). Limosilactobacillus mucosae JZL-P316, deposited at: China General Microbiological Culture Collection Center, deposited at: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, deposit number: CGMCC No. 38004, deposited on April 1, 2026.

[0054] Mucosal lactobacillus (Lactobacillus mucosae) was isolated from pig fecal samples. Limosilactobacillus mucosae The strain JZL-P316 was subjected to 16S rDNA sequencing, and the results are shown in SEQ ID NO.1.

[0055] Example 2: Growth Performance Study The preparation method of *Lactobacillus mucosa* JZL-P316 bacterial suspension in this invention is as follows: First, in a 37℃ anaerobic workstation, *Lactobacillus mucosa* JZL-P316 preserved in glycerol tubes is streaked onto a BHI agar plate. After activation 1-2 times, single colonies are picked and cultured overnight in 1 mL of BHI liquid medium until the bacterial suspension concentration reaches 10⁻⁶. 9 ~10 10 The concentration is approximately CFU / mL, used as a bacterial suspension. In actual use, the concentration can be adjusted using conventional methods.

[0056] The isolation and culture of the above-mentioned strains were carried out at 37°C in an anaerobic workstation with a gaseous environment of 80% nitrogen (N2), 10% carbon dioxide (CO2), and 10% hydrogen (H2). Under these conditions, 100 μL of the activated strains were inoculated into 1 mL of YCFAG medium and 1 mL of YCFAG medium supplemented with 20 mg / mL rhodioloside substrate, respectively.

[0057] This assay was performed using a high-throughput real-time microbial analysis system (Model: MicroScreen-S). The bacteria were statically anaerobic at 37 ℃, with shaking to mix the cells and OD values ​​measured every 20 min. Data were collected and growth curves were plotted after 48 h of continuous monitoring. Under these conditions, *Lactobacillus mucosa* JZL-P316 and *Lactobacillus mucosa* JZL-P316 with the substrate rhodioloside showed growth curves at different time points. Figure 2 , 3 ).

[0058] from Figure 3 It can be seen that the period from 0 to 1 hour is the lag phase, the period from 1 to 4 hours is the logarithmic growth phase, the period from 4 to 10 hours is the stationary phase, and the period from 10 to 48 hours is the decline phase.

[0059] Example 3: Preparation of 4-hydroxyphenylacetic acid To verify the ability of the *Lactobacillus mucosa* strain JZL-P316 to produce 4-hydroxyphenylacetic acid, an in vitro transformation experiment was conducted.

[0060] 3.1. The *Lactobacillus mucosa* strain JZL-P316 can produce 4-hydroxyphenylacetic acid. Lactobacillus mucosa strain JZL-P316 was activated overnight in 1 mL BHI liquid medium and cultured until the OD600 reached 0.6. Then, the bacterial culture was centrifuged at 10,000 rpm for 10 min to remove the supernatant. An equal volume of sterile, enzyme-free 0.9% NaCl was added to the culture medium, and the bacterial cells were washed with sterile, enzyme-free 0.9% NaCl. This process was repeated twice, and the culture medium was replaced with YCFAG medium and YCFAG medium supplemented with 20 mg / mL rhodioloside substrate. The culture was carried out at 37 ℃ under anaerobic and dark conditions for 24-48 h before centrifugation.

[0061] Add 200 μL of the supernatant to 800 μL of 50% acetonitrile solution, vortex to mix, let stand at room temperature for 5 min, and then freeze at -80℃ for 1.5 h.

[0062] After freezing, the sample was thawed at room temperature and centrifuged. The supernatant was collected and filtered for analysis using an ultra-high performance triple quadrupole liquid chromatography-mass spectrometry (HPLC) system. The detection method is described in step 3.2 for the detection of 4-hydroxyphenylacetic acid.

[0063] Metabolite identification was performed by comparing the precise molecular weight and retention time of the 4-hydroxyphenylacetic acid standard. Quantification was conducted using multiple reaction monitoring (MRM), with the MRM transition being m / z 151.00 → 107.00. The mass spectrum of the standard is shown below. Figure 4 Please refer to the mass spectrometry results of the supernatant. Figure 5 , 6 .

[0064] from Figure 4 , 5 The mass spectrometry results of samples 6 and 7 show that the 4-hydroxyphenylacetic acid in the supernatant has the same precise molecular weight and retention time as the standard, and no metabolites of the strain were detected in YCFAG medium without the addition of rhodioloside. The detection method is reliable, indicating that in the in vitro fermentation experiment, the *Lactobacillus mucosae* JZL-P316 strain can produce 4-hydroxyphenylacetic acid under the action of the substrate rhodioloside.

[0065] 3.2 Detection of 4-hydroxyphenylacetic acid in culture medium supernatant The yield of 4-hydroxyphenylacetic acid in the supernatant was further determined, and the experimental design was as follows: like Figure 7 As shown: The experimental design consists of three treatment groups (3 replicates per group): (1) Modified YCFAG medium was used as control group 1 (CON1). (2) Lactobacillus mucosa JZL-P316 was inoculated with modified YCFAG medium as the Lactobacillus mucosa intervention group; (3) Using modified YCFAG medium inoculated with Lactobacillus conjugate as a negative control group.

[0066] Treatment group (2) and treatment group (3) were respectively activated by Lactobacillus mucosa JZL-P316 or Lactobacillus conjugate in 1 mL BHI liquid medium overnight, and after being cultured until OD600 reached 0.6, 100 μL was inoculated into 1 mL YCFAG medium.

[0067] like Figure 8 As shown: The experimental design consists of three treatment groups (3 replicates per group): (1) Modified YCFAG medium with added rhodioloside was used as control group 1 (CON1). (2) Modified YCFAG medium was inoculated with Lactobacillus mucosa JZL-P316 and Rhodioloside was added; (3) Modified YCFAG medium was inoculated with Lactobacillus conjugate and Rhodiola rosea glycoside was added as a negative control group.

[0068] Treatment group (2) and treatment group (3) were respectively activated by Lactobacillus mucosa JZL-P316 or Lactobacillus conjugatus in 1 mL BHI liquid medium overnight, cultured until OD600 reached 0.6, and then 100 μL was inoculated into 1 mL modified YCFAG medium with added rhodioloside.

[0069] All the strains were cultured anaerobicly for 48 h in an anaerobic workstation at 37℃ under anaerobic and light-protected conditions. The gas conditions in the anaerobic workstation were 80% nitrogen (N2), 10% carbon dioxide (CO2), and 10% hydrogen (H2).

[0070] This analysis was performed using an ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS) system, consisting of a Waters TMACQUITY™ UPLC™ I-Class PLUS ultra-high performance liquid chromatograph coupled with an ABSCIEX 6500+ mass spectrometer. Chromatographic separation was achieved using an ACQUITY UPLC BEH C18 column (2.1 mm × 50 mm, 1.7 μm). The mobile phase included: Phase A: Contains 0.1% formic acid aqueous solution; Phase B: 0.1% formic acid acetonitrile solution.

[0071] Flow rate: 0.30 mL / min.

[0072] The elution procedure was as follows: initial 5% B phase; linear gradient increase to 30% B phase within 7 min; linear gradient decrease to 5% B phase within 0.1 min; equilibration to 5% B phase for 1.9 min; injection volume was 2 μL.

[0073] Mass spectrometry data were acquired via electrospray ionization negative ion mode (ESI-), with a mass scan range of 10–2000 amu in m / z.

[0074] The key mass spectrometry parameters are as follows: ion source temperature 500 ℃, ion source voltage -4500 V, curtain gas pressure 35 psi, collision gas pressure 9 psi, declustering voltage -80 V, collision voltage -20 V.

[0075] The raw data were processed using SCIEX OS 3.4.0 software for peak detection, peak alignment, and peak area integration to obtain the content of 4-hydroxyphenylacetic acid. The results are shown in [Figure number missing]. Figure 7 , 8 (Note: "**" indicates a significant difference compared to the control group at the P < 0.01 level.)

[0076] from Figure 7 and 8 It can be seen that, in the modified YCFAG medium, *Lactobacillus mucinus* JZL-P316 did not produce 4-hydroxyphenylacetic acid (4-HPA) compared to the blank medium. The addition of the substrate rhodioloside to the medium significantly increased the 4-HPA content and the concentration of 4-HPA in the supernatant. In contrast, *Lactobacillus conjugatus* does not have the ability to produce 4-HPA, indicating that the production of 4-HPA is a unique function of *Lactobacillus mucinus*.

[0077] This invention is not limited to the specific textual description above. Various changes can be made to this invention within the scope outlined in the claims, and all such changes are within the scope of this invention.

Claims

1. A strain of *Lactobacillus mucosae* JZL-P316, characterized in that, Its classification name is *Lactobacillus mucosa*. Limosilactobacillus mucosae The depositary institution is the China General Microbiological Culture Collection Center (CGMCC), the accession number is CGMCC No. 38004, and the deposit date is April 1, 2026.

2. The *Lactobacillus mucosae* as described in claim 1, characterized in that, The 16S rDNA sequence of the *Lactobacillus mucosae* is shown in SEQ ID NO.

1.

3. A culture, characterized in that, The culture was obtained from the culture of *Lactobacillus mucosae* as described in claim 1 or 2.

4. A microbial inoculant, characterized in that, The microbial agent comprises *Lactobacillus mucosae* as described in claim 1 or 2, or the culture as described in claim 3.

5. The use of the *Lactobacillus mucosae* as described in claim 1 or 2, or the culture as described in claim 3, or the microbial agent as described in claim 4, in the preparation of 4-hydroxyphenylacetic acid.

6. A method for preparing 4-hydroxyphenylacetic acid, characterized in that, Includes the following steps: In an anaerobic atmosphere, using 15-25 g / L rhodioloside as a substrate, *Lactobacillus mucosae* as described in claim 1 or the microbial agent as described in claim 4 are cultured to obtain 4-hydroxyphenylacetic acid.

7. The method according to claim 6, characterized in that, The culture medium used during cultivation contains one or more of the following: peptone, dehydrated calf brain extract, dehydrated calf heart extract, sodium chloride, glucose, and disodium hydrogen phosphate. And / or, the culture medium used during cultivation contains one or more of the following: casein peptone, yeast extract, sodium bicarbonate, cysteine, dipotassium bicarbonate, potassium dihydrogen carbonate, sodium chloride, ammonium sulfate, magnesium sulfate heptahydrate, calcium chloride, resazurin, heme, biotin, cobalamin, para-aminobenzoic acid, folic acid, pyridoxine, thiamine, riboflavin, and glucose.

8. The method according to claim 6, characterized in that, The anaerobic atmosphere consists of nitrogen, carbon dioxide, and hydrogen. And / or, the culture temperature is 30~40 ℃; And / or, after cultivation, separation and purification may also be carried out.

9. The method according to claim 8, characterized in that, The volume ratio of nitrogen, carbon dioxide and hydrogen is (6-10):1:

1.

10. A primer for amplifying *Lactobacillus mucosae* as described in claim 1, characterized in that, It includes the sequences shown in SEQ ID NO.2 and SEQ ID NO.3.

Images