Lysine biosensor, strain for producing pentanediamine and application thereof

Abstract

The application relates to the field of biotechnology, in particular to a lysine biosensor, a pentanediamine-producing strain and application thereof. The application discloses a recombinant bacterium-based lysine biosensor, wherein a lysine transporter and a transcriptional activator are overexpressed in Escherichia coli; and a reporter gene controlled by an inducible promoter is simultaneously expressed; the reporter gene can visualize the concentration of amino acids. The application further discloses a recombinant bacterium for dynamically regulating pentanediamine synthesis and a method for regulating pentanediamine synthesis. The above disclosure can realize more efficient synthesis of 1,5-pentanediamine than constitutive expression, enhance the adaptability between the utilization of a synthesis precursor lysine and the synthesis of 1,5-pentanediamine with cell toxicity, and effectively improve the yield of 1,5-pentanediamine.

Description

Technical Field

[0001] This application relates to the field of biotechnology, specifically to lysine biosensors, strains that produce pentanediamine, and their applications. Background Technology

[0002] Metabolic engineering, as one of the core fields of modern biotechnology, aims to use genetic engineering techniques to directionally modify the metabolic networks of microorganisms, constructing engineered strains that efficiently synthesize target products while maintaining normal cell growth. Traditional metabolic engineering strategies, such as gene overexpression or attenuation, are often based on static regulation concepts and are difficult to adapt to the complex and variable metabolic environment within cells. This often leads to metabolic network imbalance, resulting in the accumulation of intermediate metabolites and cytotoxic effects. Especially in the product synthesis stage, the negative feedback inhibition of cell growth by toxic metabolites has become a key bottleneck limiting the efficiency of biomanufacturing.

[0003] With the rapid development of synthetic biology, dynamic regulation technology offers a new approach to solving the aforementioned problems. This technology, relying on synthetic biology tools such as biosensors and gene circuits, constructs a metabolic sensing and feedback regulation system. This system can monitor intracellular metabolite concentrations in real time and dynamically adjust gene expression levels according to cellular metabolic status, thereby optimizing metabolic flux distribution and improving product yield while ensuring cell viability. This intelligent metabolic regulation strategy provides strong support for the high efficiency and precision of biomanufacturing.

[0004] 1,5-Pentanediamine, a decarboxylation product of lysine, is an important monomer for bio-based materials and is widely used in the synthesis of high-performance polyamides (such as the PA5X series) and other polymers. However, a critical technical bottleneck exists in the direct fermentation production of pentanediamine: the poor synergy between the utilization of lysine, the precursor of pentanediamine, and the biosynthesis of the product pentanediamine. Specifically, the efficient conversion of lysine, as a direct precursor of pentanediamine, is key to increasing its yield. However, pentanediamine itself is cytotoxic, and its accumulation inhibits cell growth and metabolic activity, thus affecting the further utilization of lysine and the continuous synthesis of pentanediamine. This contradictory relationship between growth and product synthesis severely limits the industrial production efficiency of pentanediamine. To address these challenges in the biomanufacturing of pentanediamine, constructing a lysine biosensor and applying it to the dynamic regulation of pentanediamine synthesis presents a promising solution. Lysine biosensors can specifically identify and respond to changes in intracellular lysine concentration, and convert lysine concentration information into regulated gene expression signals through signal transduction mechanisms, thereby achieving dynamic regulation of the pentanediamine synthesis pathway.

[0005] In *Escherichia coli*, the lysine decarboxylation system (cadCBA) is a typical lysine-responsive system. This system is activated in acidic (pH 5.8) and lysine-rich environments, achieving the conversion of lysine to pentanediamine through a series of complex regulatory mechanisms. Specifically, when intracellular lysine concentration increases, the lysine transporter LysP binds to lysine, leading to the release of the membrane-integrated transcription activator CadC, which is bound to Lysine. CadC, a member of the ToxR-like protein family, can directly bind to the DNA in the cadBA promoter region, inducing the cadBA operon (P... cad The expression of lysine decarboxylase (CadA) encoded by the cadBA operon and the lysine / pentanediamine antitransporter (CadB) work together to decarboxylate lysine to pentamethylenediamine, and then transport pentamethylenediamine to the extracellular environment via CadB, thereby improving the extracellular pH environment and reducing the intracellular concentration of pentamethylenediamine, thus mitigating its cytotoxic effects.

[0006] Based on the above mechanism, by constructing a lysine biosensor and coupling it with cadBA or other related regulatory elements, precise dynamic regulation of the pentanediamine synthesis pathway can be achieved. For example, when the intracellular lysine concentration increases, the lysine biosensor triggers the activation of the cadBA system, promoting pentanediamine synthesis; while when pentanediamine accumulates to a certain level, the expression level of the cadBA system is reduced through a feedback inhibition mechanism, decreasing further pentanediamine synthesis, thereby maintaining the balance between cell growth and product synthesis. Summary of the Invention

[0007] Based on the above, and considering the significant application value of pentanediamine in the field of biomanufacturing and the technical bottlenecks in its production process, this application aims to propose a dynamic regulation strategy for a lysine biosensor based on recombinant bacteria. This strategy involves constructing a lysine biosensor, coupling it with cadBA or other relevant regulatory elements, and then precisely coupling it with the pentanediamine synthesis pathway to achieve a dynamic balance between cell growth and product synthesis. For example, when intracellular lysine reaches a certain concentration, cadBA expression is activated, promoting pentanediamine synthesis and thus maintaining the balance between cell growth and product synthesis. This strategy of dynamically regulating pentanediamine synthesis can address the problem of poor synergy between the utilization of lysine, a precursor in pentanediamine synthesis, and the synthesis of cytotoxic pentanediamine, thereby significantly improving the industrial production efficiency of pentanediamine.

[0008] The primary objective of this application is to provide a lysine biosensor based on recombinant bacteria for regulating the expression and synthesis of downstream lysine derivatives.

[0009] Furthermore, the host cell of the recombinant bacteria can be a microorganism derived from the genera Escherichia, Corynebacterium, Streptomyces, or Pseudomonas.

[0010] Specifically, the Escherichia coli may be K12 / MG1655 or a derivative thereof.

[0011] Furthermore, the recombinant bacteria is an *E. coli* strain that overexpresses lysine transporters and transcription activators; it also expresses a reporter gene controlled by an inducible promoter. This reporter gene allows for visualization of amino acid concentration changes through fluorescence intensity variations.

[0012] Specifically, the lysine transporter is lysP, and its gene sequence is shown in SEQ ID NO.1.

[0013] Specifically, the transcription activator is cadC, and its gene sequence is shown in SEQ ID NO.2.

[0014] Furthermore, the 453rd amino acid of the transcription activator cadC is mutated from tyrosine to isoleucine (the 1411th base of the cadC gene is mutated from G to A), and the 471st amino acid is mutated from aspartic acid to asparagine (the 1357th base of the cadC gene is mutated from T to A).

[0015] Furthermore, the cadCBA operon in the recombinant bacteria is inactivated or its activity is reduced, thus decreasing the impact of the lysine decarboxylation product pentanediamine on the sensor.

[0016] Furthermore, the promoters for lysP and cadC are selected from the group consisting of Anderson promoter, L promoter, trc promoter, T5 promoter, lac promoter, tac promoter, or T7 promoter.

[0017] Furthermore, the promoters that combine with lysP and cadC are from the Anderson promoter series, and the promoter strength of lysP should be higher than that of cadC.

[0018] Specifically, the promoter of the reporter gene is P. cad The gene sequence is shown in SEQ ID NO.3.

[0019] Specifically, affected by P cad The regulated fluorescent protein tags include GFP, YFP, CFP, RFP, mcherry, mOrange, and one or more of various derived fluorescent proteins.

[0020] Specifically, the fluorescent protein tag is GFPuv, and its gene sequence is shown in SEQ ID NO.4.

[0021] Specifically, the amino acid in question is lysine.

[0022] The second objective of this application is to provide the application of the recombinant bacteria-based lysine biosensor of the first objective of this application in the detection and dynamic regulation of lysine.

[0023] The third objective of this application is to provide a genetically engineered recombinant bacterium that produces pentanediamine.

[0024] The genetically engineered recombinant bacteria replaces the reporter gene element gfpuv of the lysine sensor provided in the first objective of this application with any or two or more related genes or combinations thereof in the lysine synthesis pathway or downstream metabolic pathway, thereby regulating the expression of the corresponding target gene.

[0025] Furthermore, the genes related to lysine synthesis or metabolism are selected from gene expression regulatory protein genes related to lysine synthesis, membrane transport protein genes related to lysine synthesis, or protein genes directly related to the synthesis of lysine derivatives.

[0026] Furthermore, the genes related to lysine synthesis or metabolism include, but are not limited to, the phosphoenolpyruvate carboxylase gene ppc, with the gene sequence shown in SEQ ID NO. 11; the aspartate aminotransferase gene aspC; the aspartate kinase III gene lysC, with the gene sequence shown in SEQ ID NO. 12; the aspartate-semialdehyde dehydrogenase gene asd, with the gene sequence shown in SEQ ID NO. 14; the 4-hydroxy-tetrahydrophosphoric acid synthase gene dapA, with the gene sequence shown in SEQ ID NO. 13; the 4-hydroxy-tetrahydrophosphoric acid reductase dapB; the tetrahydrophosphoric acid succinylase gene dapD; the N-acetylsino-ornithine transaminase / N-succinyldiaminoheptane transaminase gene dapC; the diaminoheptane epimerase gene dapF; the diaminoheptane decarboxylase gene lysA, with the gene sequence shown in SEQ ID NO. 15; and the lysine decarboxylase I cadA. Lysine: One or more of the following: pentanediamine reverse transporter cadB, lysine decarboxylase II ldcC, ptsG system encoding gene, and lysine efflux transporter lysO.

[0027] In some specific embodiments, the genes related to lysine synthesis or metabolism are Escherichia coli lysine decarboxylase cadA, whose gene sequence is shown in SEQ ID NO.5, and lysine-pentanediamine reverse transporter gene cadB, whose gene sequence is shown in SEQ ID NO.6.

[0028] Specifically, the phosphoenolpyruvate carboxylase encoded by ppc can supplement oxaloacetate in the tricarboxylic acid cycle, and oxaloacetate is an important precursor for lysine synthesis.

[0029] Specifically, aspartate kinase III, encoded by lysC, is one of the three aspartate kinase activities that catalyze the first step in the biosynthesis of lysine and homoserine, as well as indirect methionine and threonine.

[0030] In some specific implementations, to reduce the feedback inhibition of lysC by lysine, the recombinant bacteria overexpress lysC. T344M The lysC gene's 1031st base was changed from C to T.

[0031] 4-Hydroxy-tetrahydrophosphoric acid synthase, encoded by dapA, is the first enzyme specific to lysine biosynthesis and catalyzes the condensation of pyruvate and aspartic β-semialdehyde in lysine synthesis.

[0032] To reduce the feedback inhibition of dapA by lysine, in some specific implementation schemes, recombinant bacteria are overexpressed with dapA. H56K The 56th amino acid codon of the dapA gene was changed from CAT to AAA.

[0033] Specifically, asd encodes aspartate-halfaldehyde dehydrogenase, which performs an intermediate step in the homoserine biosynthesis pathway to generate L-aspartate-halfaldehyde.

[0034] Specifically, lysA encodes diaminoheptane decarboxylase, which catalyzes the final step in lysine biosynthesis, namely the decarboxylation of meso-diaminoheptane to produce lysine.

[0035] Specifically, plasmids containing the aforementioned genes are introduced into recombinant bacteria to increase the expression levels of these genes.

[0036] In some specific implementations, the recombinant bacteria inactivate the relevant genes in the pentamethylenediamine degradation pathway.

[0037] Specifically, the speE gene is the final step in catalyzing the biosynthesis of the polyamine spermine and is one of the pathways for the degradation of pentamethylenediamine.

[0038] Specifically, the speE gene encoding spermine synthase was inactivated, and its sequence is shown in SEQ ID NO.7.

[0039] Specifically, the speG gene encoding spermidine N-acetyltransferase, whose gene sequence is shown in SEQ ID NO.8, was inactivated. This gene is one of the pathways for pentamethylenediamine degradation.

[0040] Specifically, the puuA gene encoding glutamate-putrescine ligase, whose sequence is shown in SEQ ID NO.10, was inactivated. This gene is one of the pathways for the degradation of pentanediamine.

[0041] Specifically, the ygjG gene encoding pentanediamine / putrescine transaminase was inactivated. The gene sequence is shown in SEQ ID NO.9. This gene is one of the pathways for the degradation of pentanediamine.

[0042] The inactivation includes, but is not limited to, reducing the expression activity of the target gene and / or knocking out part of the coding sequence of the target gene, thereby causing the gene to lose its expression activity.

[0043] The fourth objective of this application is to provide a method for dynamically regulating the synthesis of lysine derivatives.

[0044] In some specific implementations, the recombinant strains provided in the third objective of this application are used as pentanediamine engineered bacteria in order to dynamically regulate the synthesis of lysine derivatives.

[0045] Furthermore, while dynamically regulating the synthesis of pentanediamine using a lysine biosensor in the recombinant bacteria, the bacteria are simultaneously cultured in a fermentation medium. This fermentation medium can be a rich culture medium or an inorganic salt medium. The medium contains a carbon source, a nitrogen source, metal ions, antibiotics, and other nutrients. As a carbon source, sugars such as glucose, lactose, and galactose can be used; alcohols such as glycerol and mannitol can also be used; or organic acids such as gluconic acid, citric acid, and succinic acid can also be used. As a nitrogen source, inorganic nitrogen sources such as ammonia and ammonium sulfate can be used; or organic nitrogen sources such as corn steep liquor, yeast extract, and peptone can also be used. Inorganic ions include one or more of the following: iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, and potassium. Other nutrients include vitamins such as biotin, vitamin B1, and pyridoxal phosphate.

[0046] Furthermore, the carbon source in the fermentation medium is glucose.

[0047] Specifically, the fermentation medium can be: 20.0 g / L glucose, 5.0 g / L yeast extract, 8.0 g / L ammonium sulfate, 2.0 g / L potassium dihydrogen phosphate, 80 g / L MOPS, 2.0 g / L magnesium sulfate heptahydrate, 2 mL / L trace element mixture (TSM), with the remainder being water. Before use, adjust the pH of the medium to 7.0 with 12 mL of ammonia water.

[0048] More specifically, the trace element mixture (TSM) consists of: FeSO4·7H2O 6 g, CaCl2 1.35 g, ZnSO4·7H2O 0.8 g, MnSO4·4H2O 1.5 g, CuSO4·5H2O 0.15 g, and (NH4)6Mo7O 24Dissolve 0.2 g of 4H2O, 0.1 g of H3BO3, 0.25 g of CoCl2·6H2O, and 10 mL of 35% HCl in deionized water and bring the volume to 1 L.

[0049] The specific cultivation method is as follows: The recombinant bacteria or recombinant bacteria containing the lysine biosensor are streaked onto a culture medium plate and incubated statically; bacterial growth on the plate is picked and inoculated into the culture medium, then cultured with shaking to obtain a primary seed culture; the primary seed culture is inoculated into a fermentation medium and cultured with shaking. During the cultivation process, the pH of the reaction system is maintained at neutral; the glucose content is controlled during cultivation, and glucose is added when the glucose content in the system falls below the concentration required to maintain cell growth; the gas flow meter and stirring speed are controlled.

[0050] In some specific implementations, the culture conditions may be: 37 ℃, 220 rpm shaking culture for 24-36 h.

[0051] The specific cultivation conditions can be as follows: inoculate the seed culture into the fermentation medium at an inoculation rate of 1%, and culture at 37 ℃ and 220 rpm for 24-36 h with shaking.

[0052] Furthermore, the lysine biosensor testing method involves measuring the relative luminescence value of green fluorescent protein (GFP) using a Spark® multi-mode microplate reader. Three 200 μL aliquots of the fermentation broth to be tested are added to Corning96 flat black. The excitation wavelength of GFPuv is set to 395 nm with an excitation bandwidth of 20 nm, and the emission wavelength of GFPuv is set to 509 nm with an emission bandwidth of 20 nm. Other parameters are: gain manual: 60%, 50% mirror, integration time: 40 µs. The OD value of the fermentation broth is measured at a wavelength of 600 nm. The relative GFPuv value is the GFPuv value divided by the OD value. 600 .

[0053] In some specific implementation schemes, the following process control is also carried out during the cultivation process: during the cultivation process, the pH value of the reaction system is adjusted with ammonia water to maintain it at 6.8-7.0; during the cultivation process, samples are taken every 3-4 hours to detect the glucose content. When the glucose content in the system is lower than 5 g / L, glucose is added to make the glucose concentration in the system reach 10 g / L.

[0054] Furthermore, when using the lysine biosensor to dynamically regulate the synthesis of pentanediamine, a 5 L fermenter was used for scale-up culture, and the culture was carried out using the fermenter culture medium.

[0055] Specifically, the fermentation tank culture medium may consist of: 10.0 g / L glucose, 5.0 g / L yeast powder, 15.0 g / L ammonium sulfate, 2.0 g / L betaine, 1.6 g / L potassium dihydrogen phosphate, 1.5 g / L magnesium sulfate, 0.03 g / L ferrous sulfate, 0.03 g / L magnesium sulfate, 0.08 g / L pyridoxal phosphate, 2 mL / L trace element mixture (TSM), and the remainder being water.

[0056] Specifically, the composition of the fermenter culture medium feed solution may be: 625 g / L glucose, 100 g / L ammonium sulfate, 5 g / L magnesium sulfate, with the remainder being water.

[0057] Specifically, the fermentation conditions can be as follows: 37 ℃, 800 rpm shaking culture for 36-48 h.

[0058] Specifically, the fermenter culture method is as follows: the seed culture is inoculated into a 5 L fermenter with a final volume of 2 L fermenter culture medium at a seed inoculation rate of 5%, and cultured at 37 ℃ and 800 rpm for 36-48 h with shaking.

[0059] In some specific implementation schemes, the process control methods during the fermentation tank cultivation process are as follows: During the cultivation process, ammonia water is used for automatic adjustment to maintain the pH value of the reaction system at 6.8-7.0; during the cultivation process, samples are taken every 4 hours to detect the glucose content and OD of the fermentation broth. 600 When the glucose content in the system is lower than 5 g / L, glucose is added to bring the glucose concentration in the system up to 10 g / L; the gas flow meter and stirring speed are controlled to ensure that the dissolved oxygen in the fermenter is not lower than 30%.

[0060] Beneficial effects of the invention

[0061] The beneficial effects of this application are twofold. First, it yields a lysine biosensor based on *E. coli*. This lysine biosensor has great potential for detecting external lysine and for dynamically regulating the synthesis of pentanediamine. By adjusting the compatibility between various biological elements, modifying metabolic pathways, weakening bypass metabolic pathways, improving the pentanediamine tolerance of the strain, and optimizing the growth and fermentation conditions of the constructed pentanediamine-producing strain, a technical route for the de novo, economical, and efficient fermentation synthesis of pentanediamine by *E. coli* is established, providing new technical means and ideas for the green manufacturing of bio-based materials such as pentanediamine. Second, it also provides a new paradigm and reference for the development of dynamic regulation technology in the field of metabolic engineering. The implementation of this application is expected to promote the large-scale industrial production of bio-based materials such as pentanediamine, and advance the process of green chemistry and sustainable development. Attached Figure Description

[0062] Figure 1A schematic diagram illustrating the working principle of the lysine biosensor according to this application is shown.

[0063] Figure 2 The diagram shows the performance effect of the lysine biosensor according to this application.

[0064] Figure 3 A schematic diagram illustrating the dynamic regulation principle of pentanediamine according to this application is shown. Detailed Implementation

[0065] Unless otherwise specified, all experimental techniques and methods involved and employed in this application are assumed to follow generally accepted conventional technical paths and operating procedures in the field. Specifically, all experimental operations, including but not limited to molecular biology experiments, microbial culture and identification, and biochemical analysis, are performed in accordance with the standard procedures in authoritative textbooks and industry guidelines. For example, for experimental steps where specific operating conditions are not explicitly stated, they are usually performed under standard laboratory conditions, which are detailed in classic works such as *Molecular Cloning: A Laboratory Manual (3rd Edition)* (Science Press) and *Microbiology Experiments (4th Edition)* (Higher Education Press). Alternatively, the official recommendations provided by the manufacturers of the reagents, instruments, and consumables used in the experiment may be followed. Regarding the selection of experimental materials and reagents, unless otherwise specified in this embodiment, all biological materials (such as bacterial strains, cell lines, etc.), chemical reagents (including but not limited to buffers, enzyme preparations, antibodies, etc.), and experimental consumables (such as culture dishes, centrifuge tubes, pipette tips, etc.) used are procured through legal and compliant commercial channels to ensure that their quality meets experimental requirements and industry standards.

[0066] For the quantitative analysis experiments in the examples, to ensure the accuracy and reliability of the data, each experiment was independently repeated three times to eliminate the influence of random errors. Finally, the data obtained from the three repeated experiments were statistically analyzed, and the arithmetic mean was taken as the final result of that experimental group. Subsequent data processing and result interpretation were then based on this result. This process strictly adheres to the basic principles of scientific experimentation, aiming to improve the credibility and repeatability of the experimental conclusions.

[0067] Terminology Definition

[0068] The term "lysine biosensor" as used in this application refers to a highly efficient detection tool designed based on a specific molecular mechanism. Specifically, the lysine biosensor constructed based on the *E. coli* K12 / MG1655 strain refers to a three-tiered response mechanism formed by integrating the lysine transporter LysP, the transcription factor CadC, and a fluorescent reporter module. When the extracellular lysine concentration increases, LysP specifically recognizes and transports lysine into the cell, triggering intracellular lysine enrichment. CadC, as a pH-responsive transcription factor, undergoes a conformational change under lysine induction, activating the natural promoter P. cadIt drives downstream gene expression. Lysine biosensors can couple lysine transport with transcriptional regulation, enabling precise conversion of lysine concentration signals into fluorescence signals.

[0069] As used in this application, the term "Lysine-specific permease Protein (LysP)" refers to a class of membrane transport proteins with high substrate selectivity. Under pH stress, LysP can sense changes in extracellular lysine concentration. LysP-mediated lysine uptake activates a conformational change in CadC, enhancing its binding to P. cad The promoter binding ability initiates the expression of acid-resistant genes such as cadBA.

[0070] As used in this application, "CadC (Cadmium-responsive and Lysine-dependent transcriptional Activator)" is a dual-mode transcriptional activator that combines metal ion response and lysine metabolism regulation. Its activity regulation mechanism is highly dependent on the synergistic effect of intracellular and extracellular environmental signals. CadC consists of an N-terminal effector-binding domain (EBD), a hinge region, and a C-terminal DNA-binding domain (DBD).

[0071] The following are specific embodiments.

[0072] Example 1: Construction of an Escherichia coli lysine biosensor

[0073] The working principle of the lysine biosensor is as follows: The lysine biosensor in E. coli includes, in sequence, the lysine transporter lysP, the transcription activator cadC, and the promoter P. cad And green fluorescent protein gfpuv. The lysine transporter lysP is located on the cell membrane. In the absence of lysine, LysP may maintain its physical association with the downstream transcription activator CadC through conformational changes or interaction with specific proteins, forming a complex. When lysine or lysine hydrochloride is present in the external environment, LysP, as a high-affinity transporter, rapidly recognizes and binds to these substrates, triggering conformational changes or signal transduction. Lysine binding not only promotes the transport activity of LysP but also leads to its dissociation from CadC. The released cadC exposes its DNA-binding domain and activation domain, i.e., it transitions from an inactive state to an activated state. This conformational change enables cadC to specifically recognize and bind to the inducible promoter P. cad The upstream regulation area, and enhance P cad The promoter's transcriptional activity initiates downstream signal transduction. In activated P... cadDriven by the promoter, the downstream green fluorescent protein gene gfpuv is transcribed to produce a precursor mRNA. Subsequently, the mRNA is translated into the mature green fluorescent protein Gfpuv, causing it to accumulate intracellularly and emit a fluorescent signal. Gfpuv is a modified green fluorescent protein with high fluorescence quantum yield, photostability, and low sensitivity to the cellular environment. Its fluorescence signal intensity is directly proportional to the expression level of Gfpuv, directly reflecting the extracellular lysine concentration.

[0074] I. Construction of Escherichia coli MG1655 / pBR322-P J23109- lysP- P J23114- cadC D471N,Y453I - P cad -gfpuv strain

[0075] Using the Uniclone One Step Seamless Cloning Kit, plasmids can be constructed based on the principle of homologous recombination. This allows for the recombination of any DNA fragment containing overlapping regions at the vector ends into a linearized vector, without being restricted by restriction enzyme sites. Primers were designed according to the kit instructions to obtain gene fragments capable of homologous recombination, thus completing seamless cloning.

[0076] Using the genome of *Escherichia coli* K12 MG1655 (ATCC number 700926) as a template, the lysP gene of MG1655 was amplified using upstream primer W1 and downstream primer W2. P was introduced into lysP using upstream primer W3 and downstream primer W2. J23109 Promoter. cadC-P was amplified using upstream primer W4 and downstream primer W5. cad Gene fragment, using upstream primer W6 and downstream primer W5 as cadC-P cad Introducing P J23114Promoter. Using pET-28a-fpuv as a template and W7 and W8 as upstream and downstream primers, the gfpuv fragment was amplified. Using plasmid pBR322 (NEB, catalog number N3033S) as a template and W9 and W10 as upstream and downstream primers, the linearized plasmid pBR322 was amplified. The above fragment was then subjected to homologous recombination using a Uniclone One Step Seamless Cloning Kit (Beijing Jinsha Biotechnology Co., Ltd., catalog number SC612). During this process, 200 μL of EC135 competent cell suspension was taken from a -70℃ freezer and thawed at room temperature, then immediately placed on ice. The homologous recombination DNA product was transferred into EC135 competent cells, gently mixed, and incubated on ice for 25 minutes. Then, a heat shock was performed at 42℃ for 90 seconds, and the cells were quickly returned to ice and incubated for 2-3 minutes. Add 700 μL of antibiotic-free sterile medium (such as LB) to an EP tube and incubate at 37°C with shaking at 200 rpm for 60 minutes to allow the bacteria to recover to a normal growth state and express the plasmid-encoded chloramphenicol resistance gene. Spread the culture onto LB agar plates containing 25–35 μg / mL chloramphenicol. After the bacterial culture is completely absorbed by the medium, invert the plates and incubate overnight at 37°C until single colonies appear.

[0077] Then, using upstream primer W11 and downstream primer W12, the EC135 / pBR322-P J23109- lysP- P J23114- cadC - P cad Colony identification using -gfpuv was performed, and agarose gel electrophoresis results showed correct identification. The plasmid pBR322-P... J23109- lysP- P J23114- cadC - P cad The -gfpuv gene was transduced into MG1655 electrocompetent cells (genotype K12 F-lambda-ilvG-rfb-50 rph-1, derived from W1485, a K12 derivative strain). Colony PCR, plasmid extraction and restriction enzyme digestion verification, and sequencing confirmed successful gene transfer and correct plasmid construction, yielding pSensor-1. The primers used are shown in Table 1.

[0078] Table 1 Primer Information

[0079]

[0080] II. Construction of Escherichia coli MG1655 / pBR322-P J23109- lysP- P J23114- cadC D471N - P cad -gfpuv strain

[0081] The introduced point mutation is cadC D471N The mutation occurred in the codon corresponding to amino acid position 471 of the cadC gene. Using the NEB point mutation kit (Q5® Site-Directed Mutagenesis Kit, catalog number E0552S), the plasmid pBR322-P was used according to the kit instructions. J23109- lysP- P J23114- cadC-P cad Using -gfpuv as a template, upstream primer W13 and downstream primer W14 were designed. Primer lengths are typically 25–45 bp, with a sequence of at least 10–15 bp added to both sides of the base to be mutated. Primer sequences W13 and W14 contain the base sequence of the mutation site. Placing the mutation primers centrally in the target gene ensures efficient and specific PCR amplification, thus successfully introducing cadC. D471N Point mutation.

[0082] The PCR reaction program used was: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, annealing at 55–65℃ (determined according to the primer Tm value) for 30 s, extension at 72℃ (extension time 3 min), for a total of 25–30 cycles; final extension at 72℃ for 5 min. Sequencing confirmed that the mutation site had been correctly introduced. Then, the plasmid pBR322-P, which had the correct sequencing results, was applied. J23109- lysP- P J23114- cadC D471N - P cad- gfpuv was transfected into MG1655 competent cells according to the method described in section 1 above to obtain pSensor-2. The primers used are shown in Table 2.

[0083] Table 2 Primer Information

[0084]

[0085] III. Construction of Escherichia coli MG1655 / pBR322-P J23109 lysP- P J23114 cadC D471N,Y453I - P cad gfpuv strains

[0086] Following the method described in section II, using the NEB Q5® Site-Directed Mutagenesis Kit, upstream primer W15 and downstream primer W16 were designed according to the kit instructions, with plasmid pBR322-P J23109-lysP- P J23114- cadC D471N - P cad -gfpuv is a template that imports cadC Y453I Point mutation.

[0087] Sequencing verification confirmed that the mutation site had been correctly introduced. The plasmid pBR322-P, which had the correct sequencing results, was then used. J23109- lysP- P J23114- cadC D471N, Y453I -P cad pSensor-3 was obtained by transfecting MG1655 competent cells with -gfpuv. The primers used are shown in Table 3.

[0088] Table 3 Primer Information

[0089]

[0090] IV. Construction of Escherichia coli MG1655△cadCBA / pBR322-P J23109- lysP- P J23114- cadC D471N,Y453I -P cad- gfpuv.

[0091] Similarly, following the method described in section II, primers W17 and W18 were designed to mutate the pTargetF vector using the NEB Q5® Site-Directed Mutagenesis Kit, according to the kit instructions. The mutated N20 sequence was TTGTTGCCGGTAATATGATG, and the pTargetF vector targeting the knockout of the cadCBA gene was named pTargetF-△cadCBA.

[0092] Then, using the E. coli MG1655 chromosome as a template, the upstream sequence of cadCBA in MG1655 was amplified using upstream and downstream primers W19 and W20. The downstream sequence of the cadCBA gene was amplified using primers W21 and W22 with the reagents and methods in the mutation pTargetF. The two fragments of the upstream and downstream homologous arms of the above-mentioned cadCBA gene were ligated by overlapping PCR using primers W19 and W22 to obtain the combination of the two DNA fragments Donor△cadCBA as a template for gene editing.

[0093] The pCas9 plasmid (Addgene, catalog number 62225) was electroporated into MG1655 competent cells. After cell recovery, the cells were plated onto plates containing 50 mg / L kanamycin and cultured overnight at 30 °C to obtain the strain MG1655 / pCas9. MG1655 / pCas9 bacterial colonies were picked and placed in 500 mL shake flasks containing 50 mL of LB medium with kanamycin, and cultured at 30 °C with shaking at 220 rpm. When the culture medium OD... 600 When the OD value of the culture medium was 0.2, arabinose with a final concentration of 10 mM was added for induction. 600 Competent cells were prepared at a concentration of 0.5. 2 μL of pTargetF-△cadCBA plasmid and 10 μL of Donor△cadCBA template DNA were electroporated into the prepared MG1655 / pCas9 competent cells. The cells were then plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30°C. Single colonies were identified using upstream and downstream primers W23 and W24, and the PCR products were sequenced to verify correct size. Single colonies with the cadCBA gene knocked out and correctly sequenced were selected, and 0.5 mM arabinose was added to eliminate the pTargetF-△cadCBA plasmid, yielding *E. coli* MG1655△cadCBA / pCas9. Competent cells were then prepared using the same method as described above.

[0094] The prepared *E. coli* MG1655△cadCBA / pCas9 was inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The culture was then diluted and plated onto LB agar plates containing 50 mg / L kanamycin to obtain *E. coli* MG1655△cadCBA with pCas9 plasmid eliminated (to avoid genomic instability or off-target effects caused by its long-term presence). The plasmid pBR322-P... J23109- lysP- P J23114- cadC D471N,Y453I - P cad -Gfpuv was transformed into Escherichia coli MG1655△cadCBA, and the resulting strain was named pSensor-lys.

[0095] This strain knocked out the cadCBA operon, reducing the impact of the lysine decarboxylation product pentanediamine on the sensor, while ensuring that the expression of the sensor element cadC was entirely derived from the plasmid pBR322-P. J23109- lysP- P J23114- cadC D471N,Y453I -P cad- gfpuv, regulated by plasmids and unaffected by the genome, exhibits stable and sensitive expression and can be used for the quantitative detection of lysine. The primers used are shown in Table 4.

[0096] Table 4 Primer Information

[0097]

[0098] Example 2: Verification of the fermentation culture performance of the E. coli lysine biosensor pSensor-lys

[0099] The lysine biosensor pSensor-lys prepared in Example 1 was streaked onto a solid LB agar plate containing 50 mg / L kanamycin and incubated statically at 37 °C for 12 h. Bacterial growth on the plate was picked and inoculated into liquid LB agar, and cultured with shaking at 37 °C and 220 rpm for 12 h to obtain the seed culture. The seed culture was then inoculated into fermentation medium at a 1% inoculation rate and cultured with shaking at 37 °C and 220 rpm.

[0100] The fermentation medium formula is as follows: glucose 20.0 g / L, yeast powder 5.0 g / L, ammonium sulfate 8.0 g / L, potassium dihydrogen phosphate 2.0 g / L, MOPS 80 g / L, magnesium sulfate heptahydrate 2.0 g / L, trace element mixed solution (TSM) 2 mL / L, and the remainder is water. Before use, adjust the pH of the medium to 7.0 with 12 mL of ammonia water.

[0101] After fermentation at 37 ℃ and 220 rpm for 12 h with shaking, different concentration gradients of lysine hydrochloride were added to each group of culture media: 0 mM, 0.01 mM, 0.05 mM, 0.1 mM, 0.5 mM, 1 mM, 5 mM, 10 mM, 25 mM, 50 mM, 100 mM, 150 mM, 200 mM, 300 mM, and 500 mM. Three replicates were set up for each concentration, and the culture was continued. During subsequent cultivation, samples were taken every 4 h, and the pH of the reaction system was adjusted with ammonia to maintain it at 6.8-7.0. Glucose content was detected using an SBA-40D biosensor analyzer. When the glucose content in the system fell below 5 g / L, glucose was added to bring the glucose concentration in the system up to 10 g / L to maintain the viability of the strain. Simultaneously, 200 μL of the fermentation broth to be tested was added to each well of a Corning 96 flat black (96-well black polystyrene microplate). The excitation wavelength of GFPuv was set to 395 nm with an excitation bandwidth of 20 nm, and the emission wavelength of GFPuv was set to 509 nm with an emission bandwidth of 20 nm. Other parameters were: gain manual: 60%, 50% mirror, integration time: 40 µs. The OD value of the fermentation broth was measured at a wavelength of 600 nm. The relative GFPuv value is the GFPuv value divided by the OD value. 600Through the above experiments, the response characteristics of the pSensor-lys strain at different lysine concentrations can be systematically evaluated, the optimal detection range and performance parameters of the sensor can be determined, and experimental basis can be provided for subsequent applications. Ultimately, the performance of the lysine biosensor is as follows: Figure 2 As shown. From Figure 2 As can be seen, the fluorescence intensity increases with increasing lysine hydrochloride concentration, indicating that the sensor has a positive response to the increase of lysine, demonstrating its good sensitivity. Furthermore, the experimental data showed a good linear relationship within the lysine hydrochloride concentration range of 5 to 200 mM, indicating that the sensor's response is linear within this concentration range and can be used for quantitative analysis.

[0102] Example 3: Application of lysine sensor in pentamethylenediamine metabolic engineering

[0103] I. Construction of Lysine Production Plasmid

[0104] Using the Uniclone One Step Seamless Cloning Kit, plasmids were constructed using the homologous recombination method described in Example 1 above. Through recombinase action, DNA fragments containing a 15-25 bp overlap region at the vector ends were directionally recombinated with a linearized vector, thereby allowing any DNA fragment containing an overlap region at the vector ends to be recombinated into the linearized vector, achieving seamless insertion of any DNA fragment without restriction of restriction enzyme sites. Primers were designed according to the kit instructions to obtain gene fragments capable of homologous recombination, completing the seamless cloning process.

[0105] 1. Construction of lysine production plasmid pACYC184-P J23107- lysC T344M -P J23110- lysA - P J23105- dapA H56K -P J23105- asd-P J23105- ppc.

[0106] Using the genome of Escherichia coli MG1655 as a template, the lysC of MG1655 was amplified using upstream and downstream primers W25 and W26. T344M The upstream fragment of the gene was amplified using upstream and downstream primers W27 and W28 to amplify the lysC of MG1655. T344M Downstream fragment of the gene. Using upstream and downstream primers W29 and W28, lysC... T344M The upstream and downstream fragments of the lysC gene were ligated using overlap PCR, and the upstream and downstream fragments of the lysC gene were ligated with P. J23107 Promoter fusion, and P added to lysC J23107Promoter. Using the *E. coli* MG1655 genome as a template, the lysA gene fragment of MG1655 was amplified using upstream and downstream primers W30 and W31, and P was added to lysA using upstream and downstream primers W32 and W31. J23110 The promoter simultaneously binds the lysA gene to P J23110 Promoter fusion was performed; ultimately, two genes were inserted into the linearized plasmid pACYC184 via homologous recombination. Using plasmid pACYC184 as a template and primers W44 and W45 as primers, the linearized plasmid pACYC184 was amplified. The above fragment was then subjected to homologous recombination using the Uniclone One Step Seamless Cloning Kit, followed by transformation into EC135 competent cells. After recovery, the cells were plated and allowed to grow single colonies. Primers WY48 and WY49 were used to insert the EC135 / pACYC184-P... J23107- lysC T344M -P J23110- Colony PCR was performed using lysA. Sequencing results were correct, yielding the lysine production plasmid WYE101. Primers used are shown in Table 5.

[0107] Table 5 Primer Information

[0108]

[0109] Then, the lysine production plasmid pACYC184-P was constructed. J23107- lysC T344M -P J23110- lysA - P J23105- dapA H56K -P J23105- asd

[0110] Similarly, following the method described in section 1 above, using the E. coli MG1655 genome as a template, primers W33 and W34 were used to amplify the dapA of MG1655. H56K Upstream fragment of the gene was amplified using primers W35 and W36 to amplify dapA of MG1655. H56K Downstream fragment of the gene, using primers W37 and W36 to dapA H56K The upstream and downstream fragments were ligated using overlap PCR, and dapA was used. H56K Upstream and downstream segments of the gene and P J23105 Promoter fusion, and also for dapA H56K Add P J23105 Promoter; using the *E. coli* MG1655 genome as a template, the *asd* gene fragment of MG1655 was amplified using primers W38 and W39, and P was added to *asd* using primers W40 and W39. J23105The promoter simultaneously binds the asd gene to P J23105 Promoter fusion was performed, and the fusion fragment was ultimately inserted into the linearized plasmid pACYC184 via homologous recombination; the plasmid pACYC184-P J23107- lysC T344M -P J23110- Using lysA as a template and W31 and W46 as primers, the linearized plasmid pACYC184-P was amplified. J23107- lysC T344M -P J23110- lysA. The above fragment was subjected to homologous recombination using the Uniclone One Step Seamless Cloning Kit, then transformed into EC135 competent cells. After recovery, the cells were plated and allowed to grow single colonies. Primers WY48 and WY49 were used to target EC135 / pACYC184-P J23107- lysC T344M -P J23110- lysA - P J23105- dapA H56K -P J23105- Colony PCR identification was performed using asd. Sequencing results were correct, yielding the lysine production plasmid WYE102. Primers used are shown in Table 6.

[0111] Table 6

[0112]

[0113] 3. Construction of lysine production plasmid pACYC184-P J23107- lysC T344M -P J23110- lysA - P J23105- dapA H56K -P J23105- asd-P J23105- PPC

[0114] Following the method described in section 1 above, using the *E. coli* MG1655 genome as a template, the *ppc* gene fragment of MG1655 was amplified using primers W41 and W42, and *P* was added to *ppc* using primers W43 and W42. J23105 Promoter; using plasmid pACYC184-P J23107- lysC T344M -P J23110- lysA - P J23105- dapA H56K -P J23105- Using asd as a template and W44 and W47 as primers, the linearized plasmid pACYC184-P was amplified. J23107- lysCT344M -P J23110- lysA - P J23105- dapA H56K -P J23105- The above fragment was homologously recombined using the Uniclone One Step Seamless Cloning Kit, then transformed into EC135 competent cells, and after recovery, plated and allowed to grow single colonies.

[0115] Primers WY48 and WY49 were used to target EC135 / pACYC184-P J23107- lysC T344M -P J23110- lysA - P J23105- dapA H56K -P J23105- asd-P J23105- Colony PCR was performed using ppc for identification. Sequencing was then performed, and the results were correct. The primers used for the lysine production plasmid WYE103 are shown in Table 7.

[0116] Table 7

[0117]

[0118] II. Construction of plasmids for pentamethylenediamine production

[0119] Using the Uniclone One Step Seamless Cloning Kit, plasmids were constructed based on the homologous recombination principle described in Example 1 above. Recombinase activity enabled the directional recombination of DNA fragments containing overlapping vector ends with a linearized vector. This allows for the recombination of any DNA fragment containing overlapping vector ends into the linearized vector, achieving seamless insertion of any DNA fragment without restriction of restriction enzyme sites. Primers were designed according to the kit instructions to obtain gene fragments capable of homologous recombination, thus completing seamless cloning.

[0120] 1. Production of plasmid pBR322-P for pentamethylenediamine J23109- lysP- P J23114- cadC D471N,Y453I - P cad- cadBA and pBR322-P trc- The construction of cadBA.

[0121] pBR322-P J23109- lysP- P J23114- cadC D471N,Y453I - P cad- Using gfpuv as a template, primers W50 and W51 amplified linear pBR322-P.J23109- lysP- P J23114- cadC D471N,Y453I - P cad Fragment; Using the E. coli MG1655 genome as a template, the cadBA gene fragment of MG1655 was amplified using primers W52 and W53; using the Uniclone One Step Seamless Cloning Kit, the two fragments were homologously recombinated and transformed into EC135 competent cells to obtain EC135 / pBR322-P J23109- lysP- P J23114- cadC D471N,Y453I - P cad -cadBA.

[0122] Using pBR322 as a template, primers W54 and W51 amplified the linear pBR322 fragment; using the E. coli MG1655 genome as a template, primers W55 and W53 amplified the cadBA gene fragment of MG1655, and added P trc Promoter; Using the Uniclone One Step Seamless Cloning Kit, the two fragments were homologously recombinated and transformed into EC135 competent cells to obtain EC135 / pBR322-P trc- cadBA.

[0123] For EC135 / pBR322-P J23109- lysP-P J23114- cadC D471N,Y453I -P cad -cadBA and EC135 / pBR322-P trc Colony PCR identification was performed using -cadBA, and the sequencing results were correct, yielding the pentanediamine production plasmids WYE104 and WYE105. The primers used are shown in Table 8.

[0124] Table 8

[0125]

[0126] III. Modification of the Pentylene Diamine Metabolic Bypass

[0127] 1. Construct strain Escherichia coli MG1655△cadCBA△speE

[0128] Following the above method, primers W56 and W57 were designed to mutate the pTargetF vector using the NEB Q5® Site-Directed Mutagenesis Kit (catalog number E0552S) according to the kit instructions. The mutated N20 sequence, CGCTTTAAGCTGGTGATCGA, must match the PAM sequence (NGG) of the target speE gene. The speE gene sequence was then knocked out, and the mutated pTargetF was named pTargetF-△speE.

[0129] Using E. coli MG1655 chromosome as a template, primers W58 and W59 were used to amplify the upstream sequence of MG1655 speE, and primers W60 and W61 were used to amplify the downstream sequence of the speE gene. Using primers W58 and W61, the two fragments of the above speE upstream and downstream sequences were ligated by overlap PCR to obtain the combination of the two DNA fragments Donor△speE as a template for gene editing.

[0130] Take 2 μL of pTargetF-△speE plasmid and 10 μL of Donor△speE template DNA, electroporate into E. coli MG1655△cadCBA / pCas9 competent cells, plate them on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubate at 30°C. Use primers W62 and W63 to identify single colonies, and sequence to verify the correct PCR product size. Select single colonies with the speE gene knocked out and correctly sequenced, add 0.5 mM arabinose to eliminate the pTargetF-△speE6 plasmid, obtain E. coli MG1655△cadCBA△speE / pCas9, and prepare competent cells according to the above method for later use.

[0131] Escherichia coli MG1655△cadCBA△speE / pCas9 was inoculated into antibiotic-free LB liquid medium and cultured at 37 °C for 12 hours. The culture was then diluted and plated onto LB agar plates to obtain E. coli MG1655△cadCBA△speE with the pCas9 plasmid eliminated. Knockout of the speE gene reduced the pentanediamine metabolic bypass. Primers used are shown in Table 9.

[0132] Table 9

[0133]

[0134] 2. Construct strain Escherichia coli MG1655 △cadCBA △speE △speG

[0135] Following the same method and steps described above, primers W64 and W65 were designed to mutate the pTargetF vector using the NEB Q5® Site-Directed Mutagenesis Kit (catalog number E0552S) according to the kit instructions. The mutated N20 sequence was CGCTTTAAGCTGGTGATCGA, and the mutated pTargetF was named pTargetF-△speG.

[0136] Using E. coli MG1655 chromosome as a template, the upstream sequence of speG in MG1655 was amplified using primers W66 and W67, and the downstream sequence of the speG gene was amplified using primers W68 and W69. The two fragments were then ligated by overlap PCR using primers W66 and W69 to obtain the combined DNA fragment Donor△speG, which served as a template for gene editing.

[0137] Take 2 μL of pTargetF-△speG plasmid and 10 μL of Donor△speG template DNA, electroporate into E. coli MG1655△cadCBA△speE / pCas9 competent cells, plate them on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubate at 30 ℃. Identify single colonies using primers W70 and W71, and sequence to verify the correct PCR product size. Select single colonies with the speG gene knocked out and correctly sequenced, add 0.5 mM arabinose to eliminate the pTargetF-△speG plasmid, and obtain E. coli MG1655△cadCBA△speE△speG / pCas9. Prepare competent cells according to the above method for later use.

[0138] Escherichia coli MG1655△cadCBA△speE△speG / pCas9 was inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The culture was then diluted and plated on LB agar plates to obtain E. coli MG1655△cadCBA△speE△speG with the pCas9 plasmid eliminated. Knockout of the speG gene further reduced the pentanediamine metabolic bypass. The primers used are shown in Table 10.

[0139] Table 10

[0140]

[0141] 3. Construct strain Escherichia coli MG1655 △cadCBA △speE △speG △puuA

[0142] Using the NEB Q5® Site-Directed Mutagenesis Kit (catalog number E0552S), primers W72 and W73 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is CGCTTTAAGCTGGTGATCGA, and the mutated pTargetF is named pTargetF-△puuA.

[0143] Using E. coli MG1655 chromosome as a template, the upstream sequence of the puuA gene in MG1655 was amplified using primers W74 and W75, and the downstream sequence of the puuA gene was amplified using primers W76 and W77. The two fragments were then ligated by overlap PCR using primers W74 and W77 to obtain the combined DNA fragment Donor△puuA, which served as a template for gene editing.

[0144] Take 2 μL of pTargetF-△puuA plasmid and 10 μL of Donor△puuA template DNA, electroporate into E. coli MG1655△cadCBA△speE△speG / pCas9 competent cells, plate them on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubate at 30 ℃. Identify single colonies using primers W78 and W79, and sequence to verify the correct PCR product size. Select single colonies with the puuA gene knocked out and correctly sequenced, add 0.5 mM arabinose to eliminate the pTargetF-△puuA plasmid, and obtain E. coli MG1655△cadCBA△speE△speG△puuA / pCas9. Prepare competent cells according to the above method for later use.

[0145] Escherichia coli MG1655△cadCBA△speE△speG△puuA / pCas9 was inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The culture was then diluted and plated on LB agar plates to obtain E. coli MG1655△cadCBA△speE△speG△puuA with the pCas9 plasmid eliminated. Knockout of puuA further reduced the pentanediamine metabolic bypass. The primers used are shown in Table 11.

[0146] Table 11

[0147]

[0148] 4. Construct strain Escherichia coli MG1655 △cadCBA △speE △speG △puuA △ygjG

[0149] Using the NEB Q5® Site-Directed Mutagenesis Kit (catalog number E0552S), primers W80 and W81 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence was CGCTTTAAGC TGGTGATCGA, and the mutated pTargetF was named pTargetF-△ygjG.

[0150] Using E. coli MG1655 chromosome as a template, the upstream sequence of ygjG in MG1655 was amplified using primers W82 and W83, and the downstream sequence of the ygjG gene was amplified using primers W84 and W85. The two fragments were then ligated by overlap PCR using primers W82 and W85 to obtain the combined DNA fragment Donor△ygjG, which served as a template for gene editing.

[0151] Take 2 μL of pTargetF-△ygjG plasmid and 10 μL of Donor△ygjG template DNA, and electroporate them into E. coli MG1655△cadCBA△speE△speG△puuA / pCas9 competent cells. Spread the cells on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubate at 30°C. Identify single colonies using primers W86 and W87, and sequence to verify the correct PCR product size. Select single colonies with the ygjG gene knocked out and correctly sequenced, add 0.5 mM arabinose to eliminate the pTargetF-△ygjG plasmid, and obtain E. coli MG1655△cadCBA△speE△speG△puuA△ygjG / pCas9. Prepare competent cells using the same method as above for later use.

[0152] Escherichia coli MG1655△cadCBA△speE△speG△puuA△ygjG / pCas9 was inoculated into antibiotic-free LB liquid medium and cultured at 37 °C for 12 hours. The culture was then diluted and plated onto LB agar plates to obtain E. coli MG1655△cadCBA△speE△speG△puuA△ygjG with the pCas9 plasmid eliminated. Knockout of ygjG further reduced the pentanediamine metabolic bypass. The primers used are shown in Table 12.

[0153] Table 12

[0154]

[0155] Example 4: Construction of a plasmid for dynamically regulating the synthesis of pentamethylenediamine

[0156] pSC101-P J23109 -lysP-P J23114 -cadC D471N,Y453I-P cad -cadBA-P J23107 -lysC T344M -P J23110 -lysA-P J23105 -dapA H56K -P J23105 -asd-P J23105 -ppc and pSC101-P trc -cadBA-P J23107 -lysC T344M -P J23110 -lysA-P J23105 -dapA H56K -P J23105 -asd-P J23105 -ppc build

[0157] Using plasmid pSC101 as a template and primers W88 and W89, the pSC101-ori fragment was amplified. Using plasmid pBR322-P... J23109 -lysP-P J23114 -cadC D471N,Y453I -P cad -cadBA-P J23107 -lysC T344M -P J23110 -lysA-P J23105 -dapA H56K -P J23105 -asd-P J23105 Using ppc as a template, primers W90 and W91 amplified linearized P J23107 lysC T344M -P J23110 lysA - P J23105 dapA H56K -P J23105 asd -P J23105 ppc-P J23109 lysP- P J23114 cadC D471N,Y453I -P cad -cadBA fragment;

[0158] With plasmid pBR322-P trc -cadBA-P J23107 -lysC T344M -P J23110 -lysA-P J23105 -dapA H56K -P J23105 -asd-P J23105 Using ppc as a template, primers W90 and W91 amplified linearized PJ23107 lysC T344M -P J23110 lysA -P J23105 dapA H56K -P J23105 asd -P J23105 ppc-P trc -cadBA fragment; the above two fragments were assembled with the low-copy replication initiator pSC101-ori fragment of the replication origin region of plasmid pSC101, and then transformed into EC135 competent cells. Identification was performed using primers W92 and W93, and sequencing was correct, yielding WYE106 and WYE107. The primers used are shown in Table 13.

[0159] Table 13

[0160]

[0161] Example 5: Construction of pentamethylenediamine engineered bacteria and verification of dynamic regulation of pentamethylenediamine synthesis using a lysine biosensor

[0162] I. Construction of the engineered strain of pentamethylenediamine

[0163] Three lysine production plasmids, WYE101, WYE102, and WYE103, were paired with pentanediamine production plasmids WYE104 and WYE105 and introduced into MG1655ΔcadCBA to obtain the following six pentanediamine engineered strains: PDA-1 (MG1655ΔcadCBA / WYE101| WYE104), PDA-2 (MG1655ΔcadCBA / WYE101| WYE105), PDA-3 (MG1655ΔcadCBA / WYE102| WYE104), PDA-4 (MG1655ΔcadCBA / WYE102| WYE105), PDA-5 (MG1655ΔcadCBA / WYE103| WYE104), and PDA-6 (MG1655ΔcadCBA / WYE103| WYE104). WYE105).

[0164] Furthermore, WYE106 and WYE107 were transformed into Escherichia coli MG1655△cadCBA△speE△speG△puuA△ygjG to obtain pentanediamine engineered bacteria PDA-7 and PDA-8.

[0165] II. Verification of Dynamic Regulation of Pentylene Diamine Synthesis

[0166] PDA-1, PDA-2, PDA-3, PDA-4, PDA-5, and PDA-6 were streaked onto solid LB agar plates and incubated statically at 37°C for 12 h. Bacterial growth on the plates was picked and inoculated into liquid LB agar, and cultured with shaking at 37°C and 220 rpm for 12 h to obtain the seed culture. The seed culture was then inoculated at a rate of 1% into the fermentation medium described in Example 2 and cultured with shaking at 37°C and 220 rpm.

[0167] During the cultivation process, samples were taken every 4 hours, and the pH of the reaction system was adjusted with ammonia to maintain it at 6.8-7.0. Glucose content was detected using an SBA-40D biosensor analyzer. When the glucose content in the system fell below 5 g / L, glucose was added to bring the glucose concentration to 10 g / L to maintain the viability of the strain. After 36 hours of cultivation, samples were taken, centrifuged at 12000 g for 2 minutes, and the supernatant was collected to determine the pentanediamine content.

[0168] The concentration of pentanediamine was determined using high-performance liquid chromatography (HPLC). Based on references (Li, et al, ...), Biotechnology for Biofuels and Bioproducts The method for amino acid detection in volume 16, Article number: 101(2023) is optimized as follows:

[0169] Samples were derivatized automatically online using o-phthalaldehyde (OPA) on an AdvanceBio AAA column (4.6 mm × 150 mm, 5 μm; Agilent Technology, USA) at 40 °C. Elution was performed at 1 mL / min using mobile phase A (10 mM Na₂HPO₄ and 10 mM Na₂B₄O₇, pH adjusted to 8.2 via HCl) and mobile phase B (methanol / acetonitrile / water) = 45:45:10 (v / v). The elution gradient was as follows: 0 to 0.35 min, 2% B; then to 13.4 min, 57% B; to 13.5 min, 100% B; 15.7 min, 100% B; 15.8 min, 2% B; 18 min, 2% B. The eluent was monitored at 338 nm. A standard curve was constructed using commercially available pentanediamine hydrochloride as a standard, and the tryptophan concentration in the samples was calculated.

[0170] PDA-7 and PDA-8 were streaked onto solid LB agar plates and incubated at 37 °C for 12 hours. Bacterial growth on the plates was picked and inoculated into liquid LB agar, and cultured at 37 °C with shaking at 220 rpm for 12 hours to obtain the primary seed culture. The primary seed culture was inoculated into the secondary seed culture fermentation medium at a 1% inoculation rate and cultured at 37 °C with shaking at 220 rpm for 6 hours. The secondary seed culture was then inoculated into a 2 L fermenter medium at a 5% inoculation rate for fermenter validation.

[0171] Fermentation tank culture medium formula: glucose 10.0 g / L, yeast extract 5.0 g / L, ammonium sulfate 15.0 g / L, betaine 2.0 g / L, potassium dihydrogen phosphate 1.6 g / L, magnesium sulfate 1.5 g / L, ferrous sulfate 0.03 g / L, magnesium sulfate 0.03 g / L, pyridoxal phosphate 0.08 g / L, trace element mixed solution (TSM) 2 mL / L, balance water. Fermentation tank culture medium feed solution: glucose 625 g / L, ammonium sulfate 100 g / L, magnesium sulfate 5 g / L, balance water.

[0172] The following process control measures were implemented during the fermentation process: Ammonia water was used for automatic adjustment to maintain the pH of the reaction system between 6.8 and 7.0; samples were taken every 4 hours to detect glucose content and fermentation broth OD. 600 When the glucose content in the system is lower than 5 g / L, glucose is added to bring the glucose concentration in the system to 10 g / L; the gas flow meter and stirring speed are controlled to ensure that the dissolved oxygen in the fermenter is not lower than 30%. Each sample is centrifuged at 12000 g for 2 minutes, the supernatant is collected, and the content of pentanediamine is detected. The results are shown in Table 14.

[0173] Table 14

[0174]

[0175] As can be seen from the table above, compared to the inductive promoter P trc The dynamic regulation of pentanediamine synthesis was observed, becoming more pronounced with increased lysine precursor supply. Specifically, strain PDA-5 showed an approximately 25.4% increase in pentanediamine production compared to PDA-6. Finally, validation was performed in a 5L fermenter, showing similar results to P... trc Compared to constitutive expression of PDA-7, under controlled conditions, PDA-8 showed superior cell growth throughout the fermentation cycle, with a peak pentamethylenediamine (PDM) yield of 33.19 g / L, approximately 48.10% higher than PDA-8. This indicates that under biosensor control, dynamic regulation of the PDM synthesis gene expression is superior to constitutive expression, balancing cell growth and PDM synthesis, resulting in a significant yield increase.

[0176] In summary, this application successfully obtained a pH-independent lysine biosensor with a maximum dynamic range of 200 mM through multi-stage modification, based on the design of an *E. coli*-based lysine biosensor. Furthermore, the constructed lysine sensor can dynamically regulate the synthesis of pentanediamine, balancing the utilization of precursor lysine with pentanediamine synthesis and effectively increasing pentanediamine yield. The lysine sensor constructed in this application and its application in dynamically regulating pentanediamine synthesis will provide a new approach for the fermentation production of pentanediamine.

[0177] It should be noted that the above embodiments are merely illustrative of specific methods of the present invention and do not limit the implementation. Those skilled in the art can make other adjustments or modifications based on these descriptions. It is neither necessary nor possible to exemplify all embodiments here. However, obvious variations or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A lysine biosensor based on recombinant bacteria, characterized in that, The lysine biosensor is constructed by overexpressing lysine transporters and transcription activators in *E. coli*, and by expressing a reporter gene controlled by an inducible promoter in *E. coli*, wherein the reporter gene allows visualization of amino acid concentrations. Preferably, the *Escherichia coli* is K12 / MG1655 or a derivative thereof; preferably, the lysine transporter is lysP, with the gene sequence shown in SEQ ID NO.1; preferably, the transcription activator is cadC, with the gene sequence shown in SEQ ID NO.2; preferably, the promoter is P. cad The gene sequence is shown in SEQ ID NO.3; preferably, the reporter gene is a fluorescent protein gene, more preferably the gfpuv gene, the gene sequence of which is shown in SEQ ID NO.4; preferably, the amino acid is lysine.

2. The lysine biosensor according to claim 1, characterized in that, The transcription factor CadC was modified by mutating amino acid 453 from tyrosine to isoleucine and amino acid 471 from aspartic acid to asparagine.

3. The lysine biosensor according to claim 1 or 2, characterized in that, The cad operon in the recombinant bacteria was inactivated or its activity was reduced.

4. The application of the lysine biosensor according to any one of claims 1-3 in the detection and dynamic regulation of lysine.

5. A recombinant strain for producing pentamethylenediamine, characterized in that, The recombinant bacteria replace the reporter gene in the lysine biosensor of claim 1 with the Escherichia coli lysine decarboxylase gene cadA, the gene sequence of which is shown in SEQ ID NO.5, and the lysine-pentanediamine reverse transporter gene cadB, the gene sequence of which is shown in SEQ ID NO.

6. The recombinant bacteria overexpressed the gene in the lysine synthesis pathway. Inactivation or reduction of the activity of regulatory genes in the pentamethylenediamine degradation pathway in the recombinant bacteria.

6. The recombinant bacteria according to claim 5, characterized in that, The regulatory genes in the pentanediamine degradation pathway include spermidine synthase gene speE, the gene sequence of which is shown in SEQ ID NO.7; spermidine N-acetyltransferase gene speG, the gene sequence of which is shown in SEQ ID NO.8; putrescine transaminase ygjG, the gene sequence of which is shown in SEQ ID NO.9; and glutamate-putrescine ligase gene puuA, the gene sequence of which is shown in SEQ ID NO.

10.

7. The recombinant bacteria according to claim 5, characterized in that, The genes in the lysine synthesis pathway include phosphoenolpyruvate carboxylase gene ppc, with the gene sequence shown in SEQ ID NO.11; aspartate kinase III lycC, with the gene sequence shown in SEQ ID NO.12; 4-hydroxy-tetrahydrophosphocholate synthase dapA, with the gene sequence shown in SEQ ID NO.13; aspartate-semialdehyde dehydrogenase asd, with the gene sequence shown in SEQ ID NO.14; and diaminoheptane carboxylate decarboxylase lysA, with the gene sequence shown in SEQ ID NO.

15.

8. A method for synthesizing 1,5-pentanediamine, comprising using the lysine biosensor according to any one of claims 1-3 or the recombinant bacteria for producing pentanediamine according to any one of claims 5-7 to synthesize 1,5-pentanediamine.

9. The method of claim 8, comprising: The recombinant bacteria or the recombinant bacteria containing the lysine biosensor were streaked onto a culture medium plate and incubated statically; bacterial growth on the plate was picked, inoculated into the culture medium, and cultured with shaking to obtain a primary seed culture. The primary seed culture was inoculated into the fermentation medium and cultured by shaking.

10. The method of claim 9, further comprising: During the cultivation process, the pH of the reaction system should be maintained at neutral. During the culture process, the glucose content is controlled. When the glucose content in the system is lower than the concentration required to maintain cell growth, glucose is added. The gas flow meter and stirring speed are also controlled.

Images