Recombinant corynebacterium glutamicum for efficient production of 2-pyrrolidone and application thereof

Abstract

The application discloses a recombinant corynebacterium glutamicum for efficiently producing 2-pyrrolidone and application thereof. 、 The acetyl lactate synthase, the phosphoacetyl transferase, the acetic acid kinase, the lactate dehydrogenase and the succinate semialdehyde dehydrogenase are knocked out in the corynebacterium glutamicum, most byproduct generation and gamma-aminobutyric acid degradation are blocked, the 2-pyrrolidone synthesis path key enzyme carnitine coenzyme A ligase and glutamate decarboxylase are overexpressed at the genome level, the carbon flow to the 2-pyrrolidone is greatly enhanced, the pyruvate dehydrogenase E1 subunit is integrated on this basis 、 The gamma-aminobutyric acid inner transport protein 、 The electron transport chain cytochrome bc1 complex further enhances the supply of intracellular cofactors, and an efficient 2-pyrrolidone production strain is constructed. The 2-pyrrolidone accumulation amount of the recombinant strain constructed by the application reaches 75.7 g / L, and the production intensity is 1.05 g / L / h in a 5 L fermenter for 72 h.

Description

Technical Field

[0001] This invention relates to a recombinant Corynebacterium glutamicum for the efficient production of 2-pyrrolidone and its applications, belonging to the field of bioengineering technology. Background Technology

[0002] 2-Pyrrolidone is a structurally simple cyclic lactam compound with a relative molecular mass of 85.10 and the molecular formula C4H7NO. The 2-pyrrolidone molecule contains both a highly reactive amide ring and a methylene alkyl structure, exhibiting excellent polar solubility, biocompatibility, and polymerizability, making it highly valuable in fields such as green organic solvents, bio-based biodegradable polymers, pharmaceutical intermediates, pesticide adjuvants, lithium battery electrolytes, and water treatment chelating agents. Currently, in industrial applications, 2-pyrrolidone is mainly used as a high-end extraction solvent, a polypyrrolidone monomer, and a raw material for drug synthesis. In addition, it can be used as a textile leveling agent, catalyst carrier, electronic cleaning agent, and resin modifying ingredient, widely supporting the fine chemical, biopharmaceutical, and new energy industries. With the rapid development of bio-based materials and green manufacturing industries, and the continuous iteration and scaling up of new processes, the downstream application scenarios of 2-pyrrolidone are expanding year by year, and domestic market demand continues to rise.

[0003] The domestic 2-pyrrolidone industry suffers from high market concentration due to limitations in production capacity and product quality associated with traditional chemical synthesis routes. Current industrial-scale preparation primarily relies on chemical methods, utilizing butyrolactone and liquid ammonia for high-temperature, high-pressure catalytic synthesis. However, traditional chemical synthesis processes have significant drawbacks: the reactions require harsh high-temperature, high-pressure conditions, resulting in high equipment investment and energy costs; numerous reaction byproducts and lengthy separation and purification processes; reliance on fossil-based butyrolactone as raw material, leading to high carbon emissions and contradicting the development trend of biomanufacturing; and a significant shortage of high-purity food-grade and pharmaceutical-grade 2-pyrrolidone production capacity, with a high dependence on imports for high-purity solid products. Therefore, developing a mild, low-carbon, and highly selective microbial fermentation synthesis route has become a necessity for the industry's development.

[0004] In recent years, the field of metabolic engineering both domestically and internationally has conducted extensive and systematic research on the microbial synthesis of 2-pyrrolidone, with *Corynebacterium glutamicum* (…) being a key example. Corynebacterium glutamicum Due to its mature fermentation process, food-grade chassis, and strong adaptability for industrial scale-up, it has become the most mainstream engineered strain for producing 2-pyrrolidone. In existing research, Deng Yu's team has used... C. glutamicum Using MG1655 as the starting platform, through rational metabolic modification and reconstruction of the central carbon metabolism module to enhance GABA precursor supply, coupled with the exogenous CoA transferase catalytic pathway, the final 2-pyrrolidone fermentation yield reached 62.5 g / L; Zhang Xueli et al. used... C. glutamicumUsing ATCC 8739 as the host, an acetic acid bypass was constructed to supplement intracellular acetyl-CoA, balancing the supply of precursor GABA and coenzyme, and increasing the yield of the target product to 70.2 g / L.

[0005] However, the aforementioned high-yield strains all rely on IPTG as a chemical inducer. IPTG is expensive and cannot be completely degraded, significantly increasing the cost of fermentation raw materials and making post-processing purification of the product more difficult, severely limiting the large-scale industrial application of these strains. Therefore, constructing a stable Corynebacterium glutamicum engineered strain that does not require IPTG induction to achieve low-cost, highly stable fermentation synthesis of 2-pyrrolidone is a key technical challenge that urgently needs to be solved in this field. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a high-yield 2-pyrrolidone-producing strain of *Corynebacterium glutamicum*, and a method for producing 2-pyrrolidone using this strain. This invention involves knocking out byproduct pathway genes in *Corynebacterium glutamicum* cells and overexpressing a key enzyme in the 2-pyrrolidone synthesis pathway (glutamate decarboxylase) in the genome. EC GAD 、 Carnitine-CoA ligase ECCaiC And increase the content of intracellular cofactors (pyruvate dehydrogenase E1 subunit) aceE, Electron transport chain cytochrome bc1 complex qcrABC ) and GABA content (γ-aminobutyric acid internal transporter) gadP The relevant genes were identified, enabling the efficient production of 2-pyrrolidone and laying the foundation for its industrial production.

[0007] This invention is achieved through the following technical solution: The first objective of this invention is to provide a recombinant Corynebacterium glutamicum for the efficient production of 2-pyrrolidone, wherein the recombinant Corynebacterium glutamicum is produced by knocking out or weakening the acetolactate synthase encoding gene in the Corynebacterium glutamicum host. pqo Phosphoacetyltransferase encoding gene pta Acetylkinase encoding gene ackA, lactate dehydrogenase encoding gene ldhA succinate semialdehyde dehydrogenase encoding gene gabD It also overexpressed the carnitine-coenzyme A ligase encoding gene. EC CaiC, gene encoding glutamate decarboxylase EC GAD 、 Pyruvate dehydrogenase E1 subunit encoding gene aceE, γ-aminobutyric acid internal transporter encoding gene gadP, Electron transport chain cytochrome bc1 complex encoding gene qcrABC .

[0008] In one embodiment of the present invention, the overexpression is the expression of each coding gene on the genome.

[0009] In one embodiment of the present invention, the carnitine-coenzyme A ligase encoding gene... EC CaiC in pqo The site is used for expression of the gene encoding glutamate decarboxylase. EC GAD in pta site expression 、 Pyruvate dehydrogenase E1 subunit encoding gene aceE exist ackA site expression 、 γ-aminobutyric acid internal transporter encoding gene gadP exist ldhA site expression 、 Electron transport chain cytochrome bc1 complex encoding gene qcrABC exist gabD The site is expressed.

[0010] In one embodiment of the present invention, the recombinant Corynebacterium glutamicum further includes plasmid overexpression of a 2-copy carnitine-coenzyme A ligase-encoding gene. EC CaiC and 1 copy of the gene encoding glutamate decarboxylase EC GAD.

[0011] In one embodiment of the present invention, the plasmid is the Corynebacterium glutamicum-Escherichia coli shuttle expression plasmid pZK, which uses pCRB12 as a backbone and inserts into the parA-parB-parS plasmid distribution system. gapA, tuf The expression unit consists of a strong constitutive promoter and the E. coli rrnB T1-T2 dual terminator.

[0012] In one embodiment of the present invention, the carnitine-coenzyme A ligase EC The CaiC nucleotide sequence is shown in SEQ ID NO. 1, and the glutamate decarboxylase... EC The nucleotide sequence of GAD is shown in SEQ ID NO.2, and the pyruvate dehydrogenase E1 subunit is described. aceE The nucleotide sequence is as shown in SEQ ID NO.3, describing the γ-aminobutyric acid internal transporter. gadP The nucleotide sequence is as shown in SEQ ID NO.4, describing the electron transport chain cytochrome bc1 complex. qcrABC The nucleotide sequence is as shown in SEQ ID NO.5.

[0013] In one embodiment of the present invention, the carnitine-coenzyme A ligase ECCaiCExpression is initiated by a promoter with a nucleotide sequence as shown in SEQ ID NO. 6 or SEQ ID NO. 7, wherein the glutamate decarboxylase is... EC GAD is expressed using a promoter with a nucleotide sequence as shown in SEQ ID NO.7.

[0014] In one embodiment of the present invention, the host of Corynebacterium glutamicum is Corynebacterium glutamicum S9114.

[0015] A second objective of the present invention is to provide the use of the recombinant Corynebacterium glutamicum in the production of 2-pyrrolidone.

[0016] In one embodiment of the present invention, the application is to use the recombinant Corynebacterium glutamicum as a substrate to ferment and produce 2-pyrrolidone.

[0017] In one embodiment of the present invention, during fermentation, the fermentation medium consists of: 6-10 g / L yeast extract, 40-60 g / L ammonium sulfate, 0.4-0.6 g / L dipotassium hydrogen phosphate trihydrate, 0.8-1.2 g / L potassium dihydrogen phosphate, 30-50 g / L glucose, 0.01-0.03 g / L manganese sulfate monohydrate, 0.4-0.6 g / L disodium hydrogen phosphate, 2.4-2.6 g / L magnesium sulfate heptahydrate, 70-90 mg / L biotin, and 2-4 mM PLP.

[0018] The beneficial effects of this invention are: The recombinant Corynebacterium glutamicum constructed in this invention can produce high levels of 2-pyrrolidone at the plasmid level within a short time using glucose as a substrate. The fermentation process of this strain is convenient to operate; in shake-flask fermentation, the yield reaches 8.55 g / L after 48 hours; in a 5 L fermenter, the yield reaches 75.7 g / L after 72 hours of fermentation, with a production intensity of 1.05 g / L / h. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 for C. glutamicum S9114 Retrofit Strategy Diagram; Figure 2 The results of fermentation of engineered strain CG-5.1 in a 500 mL Erlenmeyer flask; Figure 3 The results of fed-batch fermentation of engineered strain CG-5.1 in a 5 L fermenter. Detailed Implementation

[0021] The present invention will be further illustrated below with specific examples. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0022] Table 1. Plasmids used in this application

[0023] pZK is a Corynebacterium glutamicum-Escherichia coli shuttle expression plasmid. The vector backbone is constructed based on pCRB12, and the Corynebacterium replication module is derived from the natural endogenous plasmid pCASE1 of Corynebacterium casei JCM12072. This replicon carries a complete natural parA-parB-parS plasmid distribution system, unlike commonly used vectors such as pXMJ19 (pBL1) and pEC-XK99E (pGA1) which lack a distribution system. This improves the plasmid segregation and loss problem during high-density, long-term fed-batch fermentation. The pZK vector retains the E. coli ColE1 type replicon ori and the kanamycin resistance gene Kan. R These are used for plasmid amplification and selection markers, respectively. The expression unit uses... gapA, tuf A strongly constitutive promoter, paired with a lac operator, connects downstream to the target gene. EC CaiC、 EC GAD; transcription termination is accomplished by the tandem E. coli rrnB T1-T2 double terminator, reducing transcription readthrough effect; BglII serves as the core cloning restriction site for the insertion and assembly of the target gene.

[0024] Table 2. Strains involved in this application

[0025] C. glutamicum Strain S9114 is a traditional strain used in the industrial production of glutamic acid in China and can be purchased from domestic preservation institutions.

[0026] Table 3 Primers and Sequences

[0027] LBGB medium: 5 g / L NaCl, 5 g / L dehydrated calf heart extract, 10 g / L peptone, 12.5 g / L dehydrated calf brain extract, 2 g / L glucose, 2.5 g / L disodium hydrogen phosphate.

[0028] Primary seed culture medium: 5 g / L NaCl, 5 g / L dehydrated calf heart extract, 10 g / L peptone, 12.5 g / L dehydrated calf brain extract, 2 g / L glucose, 2.5 g / L disodium hydrogen phosphate.

[0029] Secondary seed culture medium: 10 g / L corn steep liquor, 10 g / L yeast extract, 15 g / L ammonium sulfate, 0.5 g / L dipotassium hydrogen phosphate trihydrate, 1 g / L potassium dihydrogen phosphate, 30 g / L glucose, 0.02 g / L manganese sulfate monohydrate, 0.5 g / L disodium hydrogen phosphate, 2.5 g / L magnesium sulfate heptahydrate, 10 g / L calcium carbonate.

[0030] Fermentation medium: 8 g / L yeast extract, 50 g / L ammonium sulfate, 0.5 g / L dipotassium hydrogen phosphate trihydrate, 1 g / L potassium dihydrogen phosphate, 40 g / L glucose, 0.02 g / L manganese sulfate monohydrate, 0.5 g / L disodium hydrogen phosphate, 2.5 g / L magnesium sulfate heptahydrate, 80 mg / L biotin, 3 mM PLP.

[0031] Cell concentration determination: Dilute an appropriate amount of fermentation broth and measure the OD using a UV spectrophotometer at a wavelength of 600 nm. 600 express.

[0032] Table 4. HPLC detection conditions for GABA

[0033] Table 52 HPLC detection conditions for pyrrolidone

[0034] Table 6. HPLC detection conditions for acetic acid and lactic acid

[0035] Conversion rate = (yield × fermentation broth volume) / total sugar consumed during fermentation.

[0036] Production intensity: 2-pyrrolidone yield per unit time, production intensity = yield (g / L) / fermentation time (h).

[0037] The technical solution of the present invention will be described in detail below with reference to specific embodiments. In the following embodiments, unless otherwise specified, the reagents, materials and equipment used can be purchased commercially, prepared by conventional methods, or commonly used in the industry.

[0038] Example 1: Constructing a genome knockout pqo Genes and integration EC CaiC's engineered strain CG-1 by C. glutamicum Using strain S9114 as the starting strain, a method was constructed to knock out the enzyme encoding phosphoacetyltransferase. pqo Genes and integration of carnitine-CoA ligase EC The CaiC engineered strain CG-1. All gene editing operations were performed using pK18 mobsacB gene editing technology.

[0039] The specific method is as follows: (1) with C. glutamicum Using the genome of the S9114 type strain as a template, primers △ were used... pqo- Up-F, △ pqo- Up-R, △ pqo- Down-F and △ pqo- Down-R amplification pqo Gene upper and lower homologous arms, then using primer P gapA - Ec CaiC-F and P gapA - Ec CaiC-R integrates the upper and lower arms into pqo Knockout box; (2) Verify the correct pK18-△ pqo:: P gapA -EC CaiC plasmid electrotransfer C. glutamicum In the S9114 model strain, after electroporation, it was cultured at 30℃ for 6 h and then plated on LBGB plates containing kanamycin. After culturing at 30℃ for 24-36 h, single colonies were picked for verification. (3) Using the validation primer "pK18-YZ-T and..." pqo "-YZ-B" and "pK18-YZ-B and" pqo Colony PCR was performed using "-YZ-T" to identify the bacteria, and the correct transformants were obtained by sequencing. (4) After transferring the correct transformant into LBGB medium containing kanamycin and culturing for 3 h, it was spread on LBGB plates containing 15% sucrose to eliminate the pK18 plasmid. The correct transformant CG-1 was obtained by streaking the plates.

[0040] Example 2: Constructing a genome knockout pta Genes and integrationEC GAD engineered strain CG-2 Constructed using Example 1 C. glutamicum CG-1 was the starting strain, and the enzyme encoding phosphoacetyltransferase was knocked out. pta Genes and integration of glutamate decarboxylase EC GAD, engineered strains C. glutamicum CG-2. All gene editing operations were performed using pK18 mobsacB gene editing technology.

[0041] The specific method is as follows: (1) with C. glutamicum Using the genome of the S9114 type strain as a template, primers △ were used... pta- Up-F, △ pta- Up-R, △ pta- Down-F and △ pta- Down-R amplification pta Gene upper and lower homologous arms, then using primer P gapA - Ec GAD-F and P gapA - Ec GAD-R integrates the upper and lower arms into pta Knockout box; (2) Verify the correct pK18-△ pta:: P gapA -EC GAD plasmid electrotransfer C. glutamicum After electroporation, the CG-1 strain was cultured at 30℃ for 6 h and then plated on LBGB plates containing kanamycin. After culturing at 30℃ for 24-36 h, single colonies were picked for verification. (3) Using the validation primer "pK18-YZ-T and..." pta "-YZ-B" and "pK18-YZ-B and" pta Colony PCR was performed using "-YZ-T" to identify the bacteria, and the correct transformants were obtained by sequencing. (4) After transferring the correct transformant into LBGB medium containing kanamycin and culturing for 3 h, it was spread on LBGB plates containing 15% sucrose to eliminate the pK18 plasmid. The correct transformant CG-2 was obtained by streaking the plates.

[0042] Example 3: Constructing a genome knockout ackA Genes and integration aceE engineered strain CG-3 Constructed using Example 2 C. glutamicum CG-2 was the starting strain, and the gene encoding acetate kinase was knocked out. ackA Genes and integration into pyruvate dehydrogenase complex I aceE Constructing engineered strainsC. glutamicum CG-3. All gene editing operations were performed using pK18 mobsacB gene editing technology.

[0043] The specific method is as follows: (1) with C. glutamicum Using the genome of the S9114 type strain as a template, primers △ were used... ackA- Up-F, △ ackA- Up-R, △ ackA- Down-F and △ ackA- Down-R amplification ackA Gene upper and lower homologous arms, then using primer P gapA - aceE -F and P gapA - aceE -R merges the upper and lower arms into ackA Knockout box; (2) Verify the correct pK18-△ ackA:: P gapA - aceE plasmid electrotransfer C. glutamicum After electroporation, the CG-2 strain was cultured at 30℃ for 6 h and then plated on LBGB plates containing kanamycin. After culturing at 30℃ for 24-36 h, single colonies were picked for verification. (3) Using the validation primer "pK18-YZ-T and..." ackA "-YZ-B" and "pK18-YZ-B and" ackA Colony PCR was performed using "-YZ-T" to identify the bacteria, and the correct transformants were obtained by sequencing. (4) After transferring the correct transformant into LBGB medium containing kanamycin and culturing for 3 h, it was spread on LBGB plates containing 15% sucrose to eliminate the pK18 plasmid. The correct transformant CG-3 was obtained by streaking the plates.

[0044] Example 4: Constructing a genome knockout ldhA Genes and integration EC GadP engineered strain CG-4 Constructed using Example 3 C. glutamicum CG-3 was the starting strain, and the enzyme encoding lactate dehydrogenase was knocked out. ldhA Genes and integration of γ-aminobutyric acid internal transporter EC GadP, constructing engineered strains C. glutamicum CG-4. All gene editing operations were performed using pK18 mobsacB gene editing technology.

[0045] The specific method is as follows: (1) with C. glutamicum Using the genome of the S9114 type strain as a template, primers △ were used...ldhA- Up-F, △ ldhA- Up-R, △ ldhA- Down-F and △ ldhA- Down-R amplification ldhA Gene upper and lower homologous arms, then using primer P gapA - EC GadP-F and P gapA - EC GadP-R integrates the upper and lower arms into ldhA Knockout box; (2) Verify the correct pK18-△ ldhA:: P gapA - EC GadP plasmid electrotransfer C. glutamicum After electroporation, the CG-3 strain was cultured at 30℃ for 6 h and then plated on LBGB plates containing kanamycin. After culturing at 30℃ for 24-36 h, single colonies were picked for verification. (3) Using the validation primer "pK18-YZ-T and..." ldhA "-YZ-B" and "pK18-YZ-B and" ldhA Colony PCR was performed using "-YZ-T" to identify the bacteria, and the correct transformants were obtained by sequencing. (4) After transferring the correct transformant into LBGB medium containing kanamycin and culturing for 3 h, it was spread on LBGB plates containing 15% sucrose to eliminate the pK18 plasmid. The correct transformant CG-4 was obtained by streaking the plates.

[0046] Example 5: Constructing a genome knockout gabD Genes and integration qcrABC engineered strain CG-5 Constructed using Example 4 C. glutamicum GA-4 was the starting strain, and the enzyme encoding succinate semialdehyde dehydrogenase was knocked out. gabD Genes and integration into the cytochrome bc1 complex qcrABC Constructing engineered strains C. glutamicum CG-5. All gene editing operations were performed using pK18 mobsacB gene editing technology.

[0047] The specific method is as follows: (1) with C. glutamicum Using the genome of the S9114 type strain as a template, primers △ were used... gabD- Up-F, △ gabD- Up-R, △ gabD- Down-F and △ gabD- Down-R amplification gabD Gene upper and lower homologous arms, then using primer P gapA - qcrABC -F and PgapA - qcrABC -R merges the upper and lower arms into ldhA Knockout box; (2) Verify the correct pK18-△ gabD:: P gapA - qcrABC plasmid electrotransfer C. glutamicum After electroporation, the CG-4 strain was cultured at 30℃ for 6 h and then plated on LBGB plates containing kanamycin. After culturing at 30℃ for 24-36 h, single colonies were picked for verification. (3) Using the validation primer "pK18-YZ-T and..." gabD "-YZ-B" and "pK18-YZ-B and" gabD Colony PCR was performed using "-YZ-T" to identify the bacteria, and the correct transformants were obtained by sequencing. (4) After transferring the correct transformant into LBGB medium containing kanamycin and culturing for 3 h, it was spread on LBGB plates containing 15% sucrose to eliminate the pK18 plasmid. The correct transformant CG-5 was obtained by streaking the plates.

[0048] Example 6: Construction of overexpression on plasmid EC CaiC's engineered strain CG-5.1 Constructed using Example 5 C. glutamicum CG-5 is the starting strain, which will carry two... EC CaiC and a EC Electroporation of GAD pZK expression plasmid C. glutamicum Among CG-5 strains, engineered strains were constructed. C. glutamicum CG-5.1.

[0049] The specific method is as follows: (1) Containing EC CaiC、 EC Using plasmids from GAD and pZK vectors as templates, primers P were used respectively. gapA - EC CaiC-F, P gapA - EC CaiC - R, P gapA - EC GAD-F, P tuf - EC CaiC-F, P tuf - EC CaiC-R and P gapA - EC GAD-R amplification P gapA - EC CaiC, P tuf -EC CaiC and P gapA - EC The GAD gene was then used, and the three genes were fused into a pZK expression plasmid using primers pZK-F and pZK-R. (2) Verify the correct pZK- :: P gapA - EC CaiC :: P tuf - EC CaiC :: P gapA -EC GAD expression plasmid electrotransfer C. glutamicum After electroporation, the CG-5 strain was cultured at 30℃ for 6 h and then plated on LBGB plates containing kanamycin. After culturing at 30℃ for 24-36 h, single colonies were picked for verification. (3) Colony PCR identification was performed using the validation primers “pZK-YZ-T and pZK-YZ-B”, and the correct transformant CG-5.1 was obtained by sequencing.

[0050] Example 7: Recombinant strain C. glutamicum CG-5.1 shake-flask fermentation The recombinant strains prepared in Examples 5 and 6 were subjected to the following shake-flask procedure. C. glutamicum CG-5 and C. glutamicum CG-5.1 is used for fermentation: frozen glycerol tube → shake flask seed activation → primary shake flask seed → secondary shake flask seed → shake flask.

[0051] (1) Shake flask seed activation: Pipette 200 uL of glycerol tube into a 100 mL Erlenmeyer flask containing 30 mL of LBGB medium, and incubate at 200 r / min and 30 ℃ for 20~24 h.

[0052] (2) Primary shake-flask seed culture: 1 mL of the activated seed culture was transferred to a 500 mL Erlenmeyer flask containing 100 mL of LBGB medium and incubated at 200 r / min and 30 ℃ for 8–10 h. OD 600 Between 6.0 and 10.0.

[0053] (3) Secondary shake-flask seed culture: 1 mL of seed culture was transferred to a 500 mL Erlenmeyer flask containing 100 mL of secondary seed culture medium. The flask was incubated at 200 r / min and 30 ℃ for 6–8 h. OD 600 Between 8.0 and 10.0.

[0054] (4) 500 mL Erlenmeyer flask fermentation: The initial volume of the shake flask is 50 mL. The secondary seed liquid is inoculated into the fermentation medium at an inoculation rate of 20% (volume ratio) of the total volume. The temperature is 32 ℃. During the fermentation process, the pH is controlled by observing the color of the fermentation liquid and using ammonia water to control the pH to 7 ± 0.2. Fermentation medium: 8 g / L yeast extract, 50 g / L ammonium sulfate, 0.5 g / L dipotassium hydrogen phosphate trihydrate, 1 g / L potassium dihydrogen phosphate, 40 g / L glucose, 0.02 g / L manganese sulfate monohydrate, 0.5 g / L disodium hydrogen phosphate, 2.5 g / L magnesium sulfate heptahydrate, 80 mg / L biotin, 3 mM PLP, 8 mg / L phenol red.

[0055] The yield of 2-pyrrolidone was measured after 48 hours of fermentation. The results showed that after 48 hours of fermentation, C. glutamicum CG-5 and C. glutamicum The 2-pyrrolidone yields of CG-5.1 were 2.34 g / L and 8.55 g / L, respectively.

[0056] Example 8: Recombinant strain C. glutamicum CG-5.1 was subjected to fed-batch fermentation in a 5 L fermenter. The recombinant strain prepared in Example 6 was prepared according to the following loading process. C. glutamicum CG-5.1 is used for fermentation: frozen glycerol tube → shake flask seed activation → primary shake flask seed → secondary shake flask seed → fermenter.

[0057] (1) Shake flask seed activation: Pipette 200 uL of glycerol tube into a 100 mL Erlenmeyer flask containing 30 mL of LBGB medium, and incubate at 200 r / min and 30 ℃ for 20~24 h.

[0058] (2) Primary shake-flask seed culture: 1 mL of the activated seed culture was transferred to a 500 mL Erlenmeyer flask containing 100 mL of LBGB medium and incubated at 200 r / min and 30 ℃ for 8–10 h. OD 600 Between 6.0 and 10.0.

[0059] (3) Secondary shake-flask seed culture: 1 mL of seed culture was transferred to a 500 mL Erlenmeyer flask containing 100 mL of secondary seed culture medium. The flask was incubated at 200 r / min and 30 ℃ for 6–8 h. OD 600 Between 8.0 and 10.0.

[0060] (4) 5 L Dubil parallel reactor fermentation: The initial liquid volume of the fermenter was 1.5 L. The secondary seed liquid was inoculated into the fermentation medium at an inoculation rate of 20% (volume ratio) of the total volume. The temperature was 32 ℃, the initial aeration rate was 3 vvm, and ammonia water was added during fermentation to control the pH at 7 ± 0.2 and the dissolved oxygen was controlled to be not less than 30%. Fermentation medium: 8 g / L yeast extract, 50 g / L ammonium sulfate, 0.5 g / L dipotassium hydrogen phosphate trihydrate, 1 g / L potassium dihydrogen phosphate, 40 g / L glucose, 0.02 g / L manganese sulfate monohydrate, 0.5 g / L disodium hydrogen phosphate, 2.5 g / L magnesium sulfate heptahydrate, 80 mg / L biotin, 3 mM PLP.

[0061] The yield of 2-pyrrolidone was measured after 72 h of fermentation. The results showed that after 72 h of fermentation, the yield of 2-pyrrolidone could reach 75.7 g / L, with a conversion rate of 0.18 g / g and a production intensity of 1.05 g / L / h.

[0062] The sequences used in the examples are as follows: SEQ ID NO.1: EC CaiC SEQ ID NO.2: EC GAD SEQ ID NO.3: aceE SEQ ID NO.4: gadP SEQ ID NO.5: qcrABC SEQ ID NO.6: tuff Promoter fragment cccgcgcgttttagcgtgtcagtaggcgcgtagggtaagtggggtagcggcttgttagatatcttgaaatcggctttcaacagcattgatttcgatgtatttagctggccgttaccctgcgaatgtccacagggtagctggtagtttgaaaatcaacgccgttgcccttaggattcagtaactggcacattttgtaatgcgctagatctgtgtgctcagtcttccaggctgcttatcacagtgaaagcaaaaccaattcgtggctgcgaaagtcgtagccaccacgaagtccaggaggacataca SEQ ID NO.7: gapA Promoter fragment tcgctcgtctcataaaaacgaccgagcctattgggattaccattgaagccagtgtgagttgcatcacactggcttcaaatctgagactttactttgtggattcacgggggtgtagtgcaattcataattagccccattcgggggagcagatcgcggcgcgaacgatttcaggttcgttccctgcaaaaactatttagcgcaagtgttggaaatgcccccgtctggggtcaatgtctatttttgaatgtgtttgtatgattttgaatccgctgcaaaatctttgtttccccgctaaagttggggacaggttgacacggagttgactcgacgaattatccaatgtgagtaggtttggtgcgtgagttggaaaatttcgccatactcgcccttgggttctgtcagctcaagaattcttgagtgaccgatgctctgattgacctaactgcttgacacattgcatttcctacaatctttagaggagacacacc The embodiments provided above are not intended to limit the scope of the invention, nor are the described steps intended to limit the order of execution. Any obvious modifications made to the invention by those skilled in the art based on existing common knowledge also fall within the scope of protection defined by the claims.

Claims

1. A recombinant Corynebacterium glutamicum for efficient production of 2-pyrrolidone, characterized in that, The recombinant Corynebacterium glutamicum was prepared by knocking out or weakening the acetolactate synthase encoding gene in the Corynebacterium glutamicum host. pqo Phosphoacetyltransferase encoding gene pta Acetylkinase encoding gene ackA, lactate dehydrogenase encoding gene ldhA succinate semialdehyde dehydrogenase encoding gene gabD It also overexpressed the carnitine-coenzyme A ligase encoding gene. EC CaiC, gene encoding glutamate decarboxylase EC GAD 、 Pyruvate dehydrogenase E1 subunit encoding gene aceE γ-aminobutyric acid internal transporter encoding gene gadP, Electron transport chain cytochrome bc1 complex encoding gene qcrABC .

2. The recombinant Corynebacterium glutamicum according to claim 1, characterized in that, The overexpression refers to the expression of each coding gene on the genome.

3. The recombinant Corynebacterium glutamicum according to claim 2, characterized in that, Carnitine-CoA ligase encoding gene EC CaiC in pqo The site is used for expression of the gene encoding glutamate decarboxylase. EC GAD in pta site expression 、 Pyruvate dehydrogenase E1 subunit encoding gene aceE exist ackA site expression 、 γ-aminobutyric acid internal transporter encoding gene gadP exist ldhA site expression 、 Electron transport chain cytochrome bc1 complex encoding gene qcrABC exist gabD The site is expressed.

4. The recombinant Corynebacterium glutamicum according to claim 1, characterized in that, The recombinant Corynebacterium glutamicum also includes plasmid overexpression of a 2-copy carnitine-coenzyme A ligase-encoding gene. EC CaiC and 1 copy of the gene encoding glutamate decarboxylase EC GAD.

5. The recombinant Corynebacterium glutamicum according to claim 4, characterized in that, The plasmid is the Corynebacterium glutamicum-Escherichia coli shuttle expression plasmid pZK, which uses pCRB12 as a backbone and inserts into the parA-parB-parS plasmid allocation system. gapA, tuf The expression unit consists of a strong constitutive promoter and the E. coli rrnB T1-T2 dual terminator.

6. The recombinant Corynebacterium glutamicum according to any one of claims 1 to 5, characterized in that, The carnitine-coenzyme A ligase EC The CaiC nucleotide sequence is shown in SEQ ID NO.1, and the glutamate decarboxylase... EC The nucleotide sequence of GAD is shown in SEQ ID NO.2, and the pyruvate dehydrogenase E1 subunit is described. aceE The nucleotide sequence is as shown in SEQ ID NO.3, describing the γ-aminobutyric acid internal transporter. gadP The nucleotide sequence is as shown in SEQ ID NO.4, describing the electron transport chain cytochrome bc1 complex. qcrABC The nucleotide sequence is as shown in SEQ ID NO.

5.

7. The recombinant Corynebacterium glutamicum according to claim 6, characterized in that, The carnitine-coenzyme A ligase ECCaiC Expression is initiated by a promoter with a nucleotide sequence as shown in SEQ ID NO. 6 or SEQ ID NO. 7, wherein the glutamate decarboxylase is... EC GAD is expressed using a promoter with a nucleotide sequence as shown in SEQ ID NO.

7.

8. The recombinant Corynebacterium glutamicum according to claim 1, characterized in that, The host of Corynebacterium glutamicum is Corynebacterium glutamicum S9114.

9. The use of the recombinant Corynebacterium glutamicum according to any one of claims 1 to 8 in the production of 2-pyrrolidone.

10. The application according to claim 9, characterized in that, The application involves using the recombinant Corynebacterium glutamicum as a substrate to ferment and produce 2-pyrrolidone.

Images