An engineered extracellular vesicle, methods of making and uses thereof

Abstract

The present application belongs to the field of biological medicine, and particularly relates to an engineered extracellular vesicle, a preparation method and use thereof, the vesicle is loaded with a functional RNA molecule or a derivative thereof, and the amount of the functional RNA molecule in the vesicle is significantly increased compared with a corresponding vesicle of a natural source, and in some embodiments, the vesicle is derived from mesenchymal stem cells during apoptosis. The engineered extracellular vesicle of the present application can induce or promote the clearance of senescent mesenchymal stem cells, reduce the proportion of senescent cells and the load of senescence-associated secretory phenotype, and restore the osteogenic differentiation ability of senescent mesenchymal stem cells.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to an engineered extracellular vesicle, its preparation method, and its uses. Background Technology

[0002] Age-related bone loss and osteoporosis are closely related to the aging of the bone marrow microenvironment. With increasing age, bone marrow mesenchymal stem cells (MSCs) gradually exhibit decreased proliferative capacity, weakened osteogenic differentiation potential, and enhanced age-related secretory phenotypes (SASPs). Senescent MSCs can continuously secrete inflammatory factors such as IL-1β, IL-6, and TNF-α, amplifying local inflammation and oxidative stress in the bone marrow, inhibiting normal osteoogenesis, and accelerating bone microstructural degeneration. Therefore, reducing the burden on senescent MSCs and improving the aging bone microenvironment are important directions for treating age-related bone loss.

[0003] Senescent cell clearance strategies can reduce SASP and the inflammatory microenvironment at their source by removing abnormally accumulated senescent cells. Compared to strategies that simply enhance osteogenic signaling, selectively clearing senescent MSCs holds promise for more effectively reshaping the bone marrow microenvironment and restoring bone regeneration potential. However, traditional small-molecule senescent cell clearance drugs often suffer from off-target toxicity, insufficient tissue selectivity, and limited safety windows, making it difficult to meet the long-term or periodic intervention needs of elderly patients with chronic diseases. Summary of the Invention

[0004] To address at least some of the technical problems existing in the prior art, the present invention provides an engineered extracellular vesicle, its preparation method, and its uses, as detailed below.

[0005] In a first aspect, the present invention provides an engineered extracellular vesicle loaded with a functional RNA molecule or a derivative thereof, wherein the amount of functional RNA molecule in the engineered extracellular vesicle is significantly increased compared with the corresponding vesicle from a natural source, wherein the vesicle is derived from mesenchymal stem cells during apoptosis, and the nucleotide sequence of the functional RNA molecule is GUGCGUGGUGGCUCGAGGCGGGG.

[0006] In some embodiments, the mesenchymal stem cells include at least one of bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, umbilical cord mesenchymal stem cells, and dental pulp mesenchymal stem cells.

[0007] In some embodiments, the extracellular vesicles have a particle size of 100-1000 nm.

[0008] In some implementations, the vesicle membrane surface expresses markers including CD9, CD63, CD81, and Fas.

[0009] In some embodiments, the zeta potential of the extracellular vesicles is -10 to -60 mV.

[0010] A second aspect of the invention provides a pharmaceutical composition comprising the aforementioned engineered extracellular vesicles and a pharmaceutically acceptable carrier.

[0011] A third aspect of the present invention provides a method for preparing the aforementioned engineered extracellular vesicles, comprising: (1) Introduce a functional RNA molecule or its mimicry with the nucleotide sequence GUGCGUGGUGGCUCGAGGCGGG into mesenchymal stem cells to obtain engineered mesenchymal stem cells overexpressing the RNA molecule. (2) Inducing apoptosis in the engineered mesenchymal stem cells to induce them to reach mid-apoptosis; (3) Collect apoptotic vesicles containing the engineered mesenchymal stem cells in the mid-apoptotic phase to obtain engineered mid-apoptotic extracellular vesicles loaded with the functional RNA molecules.

[0012] In a fourth aspect, the present invention provides the use of the aforementioned engineered extracellular vesicles in the preparation of a medicament for treating age-related bone loss, osteoporosis of the elderly, or age-related bone regeneration disorders.

[0013] In some embodiments, the drug includes sterile vesicle suspensions, lyophilized formulations, hydrogel complexes, sustained-release systems, bone repair scaffold complexes, injectable or oral formulations.

[0014] In some implementations, the drug is administered systemically or topically, depending on the indication.

[0015] This invention enhances the expression level of functional RNA in mesenchymal stem cell-derived apoptotic vesicles (e.g., MS-apoVs), enabling them to act more effectively on senescent MSCs as a novel apoptotic vesicle preparation (apoVs). This induces or promotes the clearance of senescent MSCs, thereby reducing the proportion of senescent cells and SASP load, and restoring the osteogenic differentiation capacity of senescent MSCs. In some embodiments, engineered apoVs can more effectively induce programmed apoptosis in senescent MSCs compared to ordinary MS-apoVs, thus reducing the proportion of senescent MSCs. After the clearance of senescent MSCs, the SASP load in the bone marrow microenvironment decreases, the inflammatory senescent microenvironment is improved, and osteogenic-related markers (e.g., RUNX2, ALP, ARS, etc.) are restored or enhanced in in vitro experiments. Therefore, this invention can be used to prepare drugs or pharmaceutical compositions targeting age-related bone loss, senile osteoporosis, or age-related bone regeneration disorders. Attached Figure Description

[0016] Figure 1 The quality characterization of the enhanced MS-apoVs (Aug-apoVs) is shown. Figure 1 a shows the general morphology of Aug-apoVs observed by TEM (scale bar 200 nm). Figure 1 b represents the particle size distribution of Aug-apoVs detected by NTA; Figure 1 c represents the zeta potential of Aug-apoVs detected by NTA; Figure 1 d represents a comparison of the yields of exos and Aug-apoVs derived from MSCs measured by BCA. Figure 1 e represents the relative abundance of total miRNAs in equal amounts of exos and Aug-apoVs determined by qRT-PCR; Figure 1 f represents the results of Western blot detection of the markers of Aug-apoVs, CD9, CD63, CD81, and Fas. Figure 1 gj illustrates the construction of MSCs overexpressing or knocking down miRNAs using lipo3000 transfection technology, and the efficiency of overexpression (g) or knockdown (i) in MSCs was detected; after extracting mid-apoptotic apoVs, the effectiveness of miRNA overexpression (h) or knockdown (j) in MS apoVs was detected; mid-apoptotic apoVs overexpressing miRNAs were named augmented apoVs (Aug-apoVs), and mid-apoptotic apoVs knocked down by miRNAs were named miRNA(-) apoVs. (ns) p >0.05, * p <0.05,** p <0.01, *** p <0.001) Figure 2 The miRNA protection and receptor cell delivery validation of enhanced MS-apoVs are shown. Figure 2 a) is an RNase degradation experiment, which demonstrates that miRNA is protected in the lipid bilayer; Figure 2 b shows the uptake of PKH26 (red) labeled Aug-apoVs by senescent MSCs under a confocal microscope after 24 hours of co-incubation with Aug-apoVs. Figure 2 c shows the miRNA delivery efficiency in senescent MSCs co-incubated with NC-apoVs, Aug-apoVs, and miRNA(-) apoVs, respectively, as detected by qRT-PCR. (ns) p >0.05, * p <0.05,** p <0.01, ***p <0.001 (Scale bar, 50 μm) Figure 3 Enhanced MS-apoVs were shown to be more effective at clearing senescent MSCs. Figure 3 a and b show the β-galactosidase staining of senescent MSCs after co-incubation with Aug-apoVs and miRNA(-) apoVs (a) and the quantitative results of the proportion of senescent cells (b). Figure 3 c represents the quantitative detection of caspase-3 activity after co-incubation of senescent MSCs with Aug-apoVs and miRNA(-) apoVs; Figure 3 Images d and e show the TUNEL staining (d) and quantification (e) of senescent MSCs after the addition of Aug-apoVs and miRNA(-) apoVs. (ns) p >0.05, * p <0.05,** p <0.01, *** p <0.001 (Scale bar, 100 μm) Figure 4 The enhanced MS-apoVs were shown to have a stronger osteogenic capacity in vitro than the ordinary MS-apoVs. Figure 4 Figure ac shows the ALP quantification (a), ARS quantification (b), and ALP and ARS staining results (c) of senescent MSCs after the addition of Aug-apoVs and miRNA(-) apoVs.

[0017] Figure 5 The enhanced MS-apoVs were shown to have a stronger osteogenic capacity in vivo than the ordinary MS-apoVs.

[0018] Figure 6 The results show ARS staining and quantification, RUNX2 immunofluorescence and senescence-related β-galactosidase staining and quantification, CDKN1a immunofluorescence results, and cell migration and invasion results of early, middle and late apoVs as carriers for osteogenic induction. Figure 6 a shows the morphology of MSCs at different stages of apoptosis induction under an optical microscope (scale bar, 100 μm). Figure 6 b and c show the ARS staining (b) and ARS quantification (c) of senescent MSCs after the addition of osteogenic induction and ES, MS or LS apoVs. Figure 6 d shows RUNX2 immunofluorescence images of senescent MSCs after the addition of osteogenic induction and ES, MS or LS apoVs; Figure 6 e and f show the results of β-galactosidase staining (e) and quantitative analysis of the proportion of senescent cells (f) after adding ES, MS or LS apoVs to senescent MSCs; Figure 6 g indicates the quantification of miRNA expression of SEQ ID NO: 1 nucleotide in ES, MS or LS apoVs; Figure 6 h shows immunofluorescence images of CDKN1a in senescent MSCs after the addition of ES, MS, or LS apoVs; Figure 6 i and j show the results of the invasive ability crystal violet staining (i) and migration ability scratch assay (j) of senescent MSCs after the addition of ES, MS, or LS apoVs. (ns) p >0.05, * p <0.05,** p <0.01, *** p <0.001 (Scale bar, 100 μm) Detailed Implementation Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] In this text, the term "senescence-associated secretory phenotype (SASP)" refers to the phenomenon where senescent cells secrete a variety of inflammatory factors, chemokines, and proteases. These mainly include: pro-inflammatory cytokines such as IL-6, IL-1α / β, and TNF-α, which drive chronic low-grade inflammation ("inflammatory senescence"); chemokines such as IL-8 (CXCL8), MCP-1 (CCL2), and MIP-1α (CCL3), which recruit immune cells to the sites where senescent cells are located; and growth factors such as VEGF, FGF, TGF-α, and HGF, which influence tissue repair and fibrosis.

[0022] In the text, the term "replicative senescence" refers to the phenomenon that normal diploid cells, after undergoing a limited number of population doublings in continuous in vitro culture, enter an irreversible state of decline, including slowed proliferation, growth arrest, and loss of stemness and differentiation capacity. It is also known as cellular senescence.

[0023] In this text, "functional RNA molecule" refers to miRNA or miRNA derivative. The term "miRNA derivative" refers to a molecule that has undergone structural modification or alteration based on a naturally occurring mature miRNA sequence, but retains or enhances the same biological function, including but not limited to: (a) miRNA mimics, i.e., double-stranded RNA molecules containing a guide strand completely identical to the mature miRNA; (b) chemically modified miRNAs, such as those containing 2'-O-methyl groups, locked nucleic acids (LNAs), phosphate thioesters, etc.; (c) miRNA precursors, such as pri-miRNAs or pre-miRNAs, which can produce the mature miRNA after processing by cellular ribonucleases; and (d) functionally equivalent sequence variants that have at least 90% sequence identity with the mature sequence of the miRNA and retain its biological function. The term "sequence identity" refers to the percentage of nucleotide residues in a candidate sequence that are identical to those in a reference sequence after optimal alignment.

[0024] Unless otherwise stated, the term "quantity" as used in this invention includes relative quantities and absolute quantities.

[0025] Engineered extracellular vesicles In one aspect, the present invention provides isolated engineered extracellular vesicles (sometimes referred to herein as enhanced MS-apoVs) loaded with functional RNA molecules or derivatives thereof, wherein the amount (or expression level) of the functional RNA molecules is significantly increased compared with the corresponding vesicles of natural origin; wherein the vesicles are derived from mesenchymal stem cells, and the nucleotide sequence of the functional RNA molecules is GUGCGUGGUGGCUCGAGGCGGGG.

[0026] In this invention, "separated" means a substance and / or entity isolated from at least some of the components initially associated with it (whether in nature or / or in an experimental setting), and / or artificially produced, prepared, and / or manufactured. The separated substance and / or entity may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or 100% of the other components initially associated with it. In some embodiments, the purity of the separated reagent is greater than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%, or 100%. If a substance is substantially free of other components, the substance is "pure."

[0027] In some embodiments, the vesicles may be obtained by secretion from engineered cells, which are mesenchymal stem cells, particularly apoptotic mesenchymal stem cells.

[0028] In some embodiments, the mesenchymal stem cells are selected from bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, umbilical cord mesenchymal stem cells, or dental pulp mesenchymal stem cells, preferably bone marrow mesenchymal stem cells, and more preferably mid-apoptotic bone marrow mesenchymal stem cells.

[0029] In some embodiments, the extracellular vesicles have a particle size of 100-1000 nm, such as 100 nm, 120 nm, 140 nm, 160 nm, 180 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, 500 nm, 550 nm, 600 nm, 700 nm, 800 nm, 900 nm, 1000 nm; preferably 180-210 nm, such as 180 nm, 190 nm, 200 nm, 210 nm.

[0030] In some implementations, the vesicle membrane surface expresses CD9, CD63, CD81, and Fas markers.

[0031] In some embodiments, the zeta potential of the extracellular vesicles is -10 to -60 mV, for example -10 mV, -20 mV, -30 mV, -40 mV, -50 mV, -60 mV; preferably -32 to -36 mV, for example -32 mV, -33 mV, -34 mV, -35 mV, -36 mV.

[0032] Pharmaceutical Composition In one aspect, the present invention provides a pharmaceutical composition comprising the above-described engineered extracellular vesicles and a pharmaceutically acceptable carrier.

[0033] The term "pharmaceuticalally acceptable" refers to a carrier, excipient, or stabilizer that is non-toxic to cells or mammals exposed to the doses and concentrations used, or has a level of toxicity that is acceptable to those skilled in the art. Non-limiting examples of pharmaceutically acceptable excipients include at least one of buffers, osmolarity regulators, and antioxidants. For example, a pharmaceutically acceptable excipient may contain one or more of the following: antioxidants, such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides, proteins, such as serum albumin; gelatin; immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids; carbohydrates, such as glucose, mannose, or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming antiions, such as sodium; and nonionic surfactants, such as Tween and polyethylene glycol (PEG).

[0034] Preparation method In one aspect, the present invention provides a method for preparing the aforementioned vesicles, comprising: (1) Introduce a functional RNA molecule or its mimicry with the nucleotide sequence GUGCGUGGUGGCUCGAGGCGGG into mesenchymal stem cells to obtain engineered mesenchymal stem cells overexpressing the RNA molecule. (2) Inducing apoptosis in the engineered mesenchymal stem cells to induce them to reach mid-apoptosis; (3) Collect apoptotic vesicles containing the engineered mesenchymal stem cells in the mid-apoptotic phase to obtain engineered mid-apoptotic extracellular vesicles loaded with the functional RNA molecules.

[0035] In some embodiments, the construction of engineered cells includes: introducing exogenous polynucleotides encoding the functional RNA molecule into mesenchymal stem cells to obtain mesenchymal stem cells overexpressing the functional RNA molecule; or transfecting the functional RNA molecule or its mimicry into mesenchymal stem cells to obtain mesenchymal stem cells loaded with the functional RNA molecule; or using a CRISPR system to target the promoter / enhancer region of a target gene to initiate endogenous transcription and obtain mesenchymal stem cells overexpressing the functional RNA molecule.

[0036] In some embodiments, miRNA mimics are introduced into donor MSCs to obtain mesenchymal stem cell-derived apoptotic vesicles during enhanced apoptosis, wherein the miRNA mimics include: The positive strand: has the nucleotide sequence shown in SEQ ID NO: 1; Antisense strand: It has the nucleotide sequence shown in SEQ ID NO: 2.

[0037] Step (2) of the present invention further includes inducing apoptosis in the engineered cells to obtain mesenchymal stem cells in the mid-apoptotic phase. Any suitable inducing agent can be used, examples of which include, but are not limited to, astrosporin, etoposide, cisplatin, and doxorubicin. The induction time is not particularly limited and can be adjusted according to the type of stem cells and the specific inducing agent; for example, the induction time can be 1-10 hours, preferably 2-8 hours, and more preferably 3-5 hours. The method for determining whether the mesenchymal stem cells are in the mid-apoptotic phase can be performed by methods known in the art, such as morphological observation.

[0038] In step (3) of this invention, engineered extracellular vesicles loaded with the functional RNA molecules are obtained by differential centrifugation. The specific steps and parameters of differential centrifugation are not particularly limited; in an exemplary embodiment, differential centrifugation includes the following steps: (a) Centrifuge the culture medium containing mesenchymal stem cells in the mid-apoptotic stage obtained in step (2) at the first speed for the first time to obtain the first supernatant; (b) Centrifuge the first supernatant at the second speed for a second time to obtain the second supernatant; (c) Centrifuge the second supernatant at the third speed for the third time and collect the precipitate; (d) The precipitate was resuspended in an aqueous solvent and centrifuged at the fourth speed for the fourth time to obtain engineered extracellular vesicles loaded with the functional RNA molecules.

[0039] In a preferred embodiment, the first speed is 500-1000 g, preferably 600-1000 g, and even more preferably 700-900 g; the first time is 1-20 minutes, preferably 5-20 minutes, and even more preferably 5-15 minutes.

[0040] In a preferred embodiment, the second speed is 1000-15000 g, preferably 1000-10000 g, even more preferably 1000-5000 g, and further preferably 1000-3000 g; the second time is 1-20 minutes, preferably 5-20 minutes, and even more preferably 5-15 minutes.

[0041] In a preferred embodiment, the third speed is 10,000-20,000 g, preferably 12,000-18,000 g, even more preferably 14,000-18,000 g, and further preferably 15,000-17,000 g; the third time is 10-50 minutes, preferably 20-50 minutes, and even more preferably 20-40 minutes.

[0042] In a preferred embodiment, the fourth speed is 10,000-20,000 g, preferably 12,000-18,000 g, even more preferably 14,000-18,000 g, and even more preferably 15,000-17,000 g; the fourth time is 10-50 minutes, preferably 20-50 minutes, and even more preferably 20-40 minutes.

[0043] In this invention, the aqueous solvent is not particularly limited, and can be any sterile buffer (such as PBS).

[0044] use In one aspect of the invention, the use of a therapeutically effective amount of the aforementioned vesicles in the preparation of a medicament for treating or improving age-related bone loss, osteoporosis of the elderly, or age-related bone regeneration disorders in subjects in need is provided.

[0045] In some implementations, the vesicles are apoptotic vesicles (apoVs).

[0046] In some embodiments, the Aug-apoVs are also provided for use in the preparation of drugs that eliminate senescent MSCs, reduce the proportion of SA-β-gal positive cells in the bone marrow microenvironment, reduce SASP load, induce apoptosis in senescent MSCs, and enhance the osteogenic differentiation capacity of MSCs.

[0047] In some embodiments, the drug is a sterile vesicle suspension, a lyophilized preparation, a hydrogel complex, a sustained-release system, a bone repair scaffold complex, an injectable preparation, or an oral preparation.

[0048] In some implementations, the drug is administered systemically or topically, depending on the indication.

[0049] The term "subject" as used in this invention refers to any animal (such as a mammal), including but not limited to humans, non-human primates, rodents, and the like, who are about to receive a specific treatment. Generally, "subject" and "patient" are used interchangeably in this invention, both referring to the subject of the study.

[0050] As used herein, the term "effective amount" refers to the amount of a drug or pharmaceutical agent that elicits a biological or pharmaceutical response in a tissue, system, animal, or human, as sought by, for example, an investigator or clinician. Furthermore, the term "therapeutic effective amount" refers to the amount that causes improved treatment, cure, prevention, or reduction of disease, symptom, or side effects, or reduces the rate of progression of the disease or condition, compared to a corresponding subject who did not receive that amount. The term also includes, within its scope, amounts that effectively enhance normal physiological function. Generally, the effective amount as used herein varies depending on various factors, such as the given drug or composition, pharmaceutical preparation, route of administration, type of disease or symptom, subject being treated, etc., but can still be routinely determined by those skilled in the art.

[0051] The term "treatment" as used in this invention refers to improvement of a condition before or after the onset of a disease or dysfunction. This degree of relief or prevention, measured by any standard technique, is at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, or 100% compared to an untreated control group under equivalent conditions. Beneficial or desired clinical outcomes include, but are not limited to, the following, whether detectable or undetectable: symptom relief, reduction in disease severity, stabilization of the disease state (i.e., no worsening), delay or slowing of disease progression, improvement or mitigation of the disease state, and reduction (whether partial or complete).

[0052] The therapeutic dosage of the present invention can vary widely. Generally, the dosage of the drug of the present invention is well known to those skilled in the art. For a person weighing 60 kg, the daily dose of the drug, based on the amount of functional RNA molecules loaded therein, is typically 0.1-50 μg. Preferably, the dose used for administration is 0.2-10 μg / kg (functional RNA / body weight). It can be administered as a single dose once daily, or divided into multiple doses daily, or at intervals. The dose can be administered as a single dose or divided into several doses, such as two, three, or four doses. The administered dose is within the predictable range of clinicians or laboratory personnel, and the optimal dosage can be obtained by appropriately adjusting the dose, for example, through efficacy and safety testing.

[0053] Alternatively, the dosage can also be calculated based on the total protein concentration of the extracellular vesicles. In liquid formulations for administration, the concentration of the extracellular vesicles is typically 0.1-100 μg / mL (total protein content). For a 60 kg person, the total protein content of the vesicles in a single dose is typically 0.5-50 μg. In specific embodiments, those skilled in the art can determine the vesicle concentration using the BCA method or similar protein quantification methods and convert it to the corresponding functional RNA dose based on the actual drug loading. In some preferred embodiments, the vesicles are Aug-apoVs, and the in vitro cell culture dosage of Aug-apoVs is 100-250 ng / mL; the in vivo dosage for mice is 20 μg Aug-apoVs per 30 g body weight.

[0054] Example 1 This embodiment illustrates the preparation and characterization of enhanced MS-apoVs.

[0055] I. Methods 1. Culture of donor MSCs: Commercially available human bone marrow mesenchymal stem cells (hBMSCs) were used as donor cells (purchased from Sciencell) and expanded under sterile conditions. α-MEM medium with 10% FBS and 1% penicillin-streptomycin was used.

[0056] 2. Enhancement Treatment: miRNA mimics were transfected into donor MSCs using Lipofectamine 3000 (Lipo3000; Invitrogen). Specifically, transfection was performed when the cells reached 80%-90% confluence. In this example, an NC control group, a miRNA enhancement group, and a miRNA knockdown group were included. The miRNA inhibitor was also transfected using Lipo3000. During transfection, Lipo3000 and the mimics / inhibitor were used in equal volumes: 2 μL / well for 12-well plates, 5 μL / well for 6-well plates, 10 μL / plate for 6 cm culture dishes, and 20 μL / plate for 10 cm culture dishes. Forty-eight hours post-transfection, miRNA levels in donor MSCs were detected by qRT-PCR to confirm overexpression or knockdown efficiency. Sequence information is as follows: NC: Justice Chain: 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 3); Antisense chain: 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO: 4); miRNA mimics: Justice Chain: 5'-GUGCGUGGUGGCUCGAGGCGGGG-3' (SEQ ID NO: 1); Antisense chain: 5'-CCGCCUCGAGCCACCACGCACUU-3' (SEQ ID NO: 2); miRNA inhibitors: 5'-CCCCGCCUCGAGCCACCACGCAC-3' (SEQ ID NO: 5).

[0057] 3. Induction of donor MSCs into meta-apoptosis: Apoptosis was induced in enhanced MSCs. α-MEM medium containing 500 nmol / L staurosporine (STS, Enzo Life Sciences) was added to the MSCs, and apoptosis was induced for 4 hours, until meta-apoptotic morphology appeared and MS-apoVs could be stably obtained. The time point for determining the meta-apoptotic stage induced by STS was based on the literature Li P, et al. Bioact Mater. 2025 Dec 10; 58:236-251.

[0058] 4. Gradient centrifugation method for collecting enhanced MS-apoVs: The specific steps are as follows: (1) Centrifuge at 800 g and 4℃ for 10 minutes and collect the supernatant; (2) Centrifuge the supernatant obtained in step (1) at 2000 g and 4℃ for 10 minutes and collect the supernatant; (3) Centrifuge the supernatant obtained in step (2) at 16000 g and 4℃ for 30 minutes and collect the precipitate; (4) The precipitate obtained in step (3) was washed with sterile PBS and centrifuged at 16000 g and 4℃ for 30 minutes to obtain enhanced MS-apoVs (Aug-apoVs).

[0059] 5. Quality testing and preservation: Particle size distribution and zeta potential were detected by NTA, vesicle morphology was observed by TEM, markers such as CD9, CD63, CD81, and Fas were detected by Western blot, vesicle protein concentration was detected by BCA, and miRNA expression level was detected by qRT-PCR.

[0060] II. Results The vesicles are mainly 100-1000 nm in size, with an average size of about 180-210 nm and a zeta potential of about -32 to -36 mV. They exhibit typical vesicle morphology and express or carry biomarkers such as CD9, CD63, CD81, and Fas. BCA assays showed that the yield of apoVs from MSCs was significantly higher than that from exosomes; qRT-PCR assays showed that the relative abundance of miRNAs in an equal amount of apoVs was higher than that in exosomes. Compared with NC MS-apoVs, the miRNA content in Aug-apoVs was significantly increased. These results demonstrate that the present invention yields a novel MS-apoVs formulation with a clearly enhanced content of key components.

[0061] The obtained vesicles can be resuspended in sterile PBS and used fresh, or stored for a short period at 4°C, or further frozen / lyophilized as needed for the formulation.

[0062] Example 2 This embodiment demonstrates the miRNA protection and receptor cell delivery validation of Aug-apoVs (enhanced MS-apoVs).

[0063] RNase degradation experiments on enhanced MS-apoVs showed that the miRNAs within the vesicles were protected by a lipid bilayer and were not easily degraded directly by exogenous RNases, indicating that they were not free naked miRNAs, but rather stably loaded as functional molecules of apoVs. Figure 2 a).

[0064] After co-incubating enhanced MS-apoVs with senescent MSCs, vesicle uptake and cargo delivery were verified by laser confocal microscopy fluorescence tracing and qRT-PCR detection. In this embodiment, Aug-apoVs were labeled with PKH26 fluorescent dye (Umibio, UR52302), and the fluorescence signal in the recipient senescent MSCs was observed using laser confocal microscopy after 24 hours of co-incubation.

[0065] The results show that ( Figure 2 (bc) After co-incubation, the enhanced MS-apoVs were significantly taken up by senescent MSCs, and the miRNA level in the recipient senescent MSCs was significantly higher than that in the NC MS-apoVs treatment group, proving that the formulation of the present invention can effectively deliver overexpressed miRNAs to target cells.

[0066] Example 3 This embodiment demonstrates that enhanced MS-apoVs are more effective at clearing senescent MSCs.

[0067] At the same vesicle dosage, parallel comparisons were made of NC-apoVs, enhanced MS-apoVs, and miRNA knockdown MS-apoVs. Replicating senescent MSCs were co-incubated with PBS, NC-apoVs, enhanced MS-apoVs, or miRNA knockdown MS-apoVs, respectively, and the proportion of SA-β-gal positive cells (Cellular Senescence β-Galactosidase Staining Kit, Beyotime), the proportion of TUNEL positive cells (One-step TUNEL In Situ Apoptosis Kit, Elabscience), and caspase-3 activity (Caspase 3 Activity Assay Kit, Beyotime) were measured.

[0068] The results show that ( Figure 3 Compared with NC-apoVs, enhanced MS-apoVs significantly reduced the proportion of senescent cells and enhanced apoptosis-related indicators in senescent MSCs; miRNA knockdown MS-apoVs showed a weakened effect.

[0069] Example 4 This embodiment demonstrates that enhanced MS-apoVs have a stronger osteogenic capacity than ordinary MS-apoVs in vitro.

[0070] Osteogenic induction was further performed on the senescent MSCs treated in Example 3, and osteogenic indicators such as ALP staining and quantification, and ARS mineralization nodule formation and quantification were detected (BCIP / NBT alkaline phosphatase chromogenic kit (P0321S) was purchased from Beyotime Biotechnology Co., Ltd.; alkaline phosphatase (AKP) quantitative test kit (A059-3) was purchased from Nanjing Jiancheng Biotechnology Research Institute).

[0071] The results show that ( Figure 4 Enhanced MS-apoVs are more effective than ordinary MS-apoVs in restoring the osteogenic differentiation capacity of senescent MSCs; miRNA knockdown MS-apoVs have a weakened effect.

[0072] Example 5 This embodiment demonstrates that enhanced MS-apoVs have a stronger osteogenic capacity in vivo than ordinary MS-apoVs.

[0073] To further verify the effect of enhanced MS-apoVs in improving age-related bone loss in vivo, aged mice (naturally aged C57BL / 6J mice, 18 months old) were used as an in vivo evaluation model. The same concentrations of ordinary MS-apoVs (NC-apoVs) and enhanced MS-apoVs (Aug-apoVs) were prepared into injectable vesicle suspensions. Mice in each group were administered the same volume via tail vein injection for 8 consecutive weeks. After administration, the mice were sacrificed, and femoral bone samples were collected, fixed, and subjected to micro-CT scanning and 3D reconstruction.

[0074] The results show that ( Figure 5 Compared with the standard MS-apoVs treatment group, the enhanced MS-apoVs treatment group showed more continuous and denser femoral trabecular structure and more significant improvement in bone loss. These results indicate that, under the same in vivo administration conditions, enhanced MS-apoVs have a stronger ability to promote bone growth and improve age-related bone loss than standard MS-apoVs.

[0075] Example 6 This embodiment demonstrates that MS-apoVs are superior to ES / LS apoVs and supports their research foundation as enhancement vectors.

[0076] To illustrate the technical basis for selecting mid-apoptotic MS-apoVs as the miRNA enhancement vector in this invention, MSCs were cultured and apoptosis was induced by STS. Supernatants from the early (ES), mid- (MS), and late (LS) stages were collected approximately 2, 4, and 6 hours after induction, and apoVs were isolated. Under a light microscope, staged apoptotic morphological changes were observed in MSCs at different induction stages. Figure 6 a).

[0077] Replicating senescent MSCs were co-incubated with ES, MS, or LS apoVs for osteogenic induction. ARS staining and quantification, and RUNX2 immunofluorescence results showed that the MS-apoVs group had superior osteogenic capacity compared to the ES and LS groups; Transwell and scratch assays showed that MS-apoVs significantly improved the migration / invasion ability of senescent MSCs; SA-β-gal staining and CDKN1a immunofluorescence staining showed that MS-apoVs significantly reduced the senescent phenotype. Figure 6 bf, hj).

[0078] The loading amounts of RNA molecules shown in SEQ ID NO: 1 in ES-apoVs, MS-apoVs, and LS-apoVs were compared according to the same total vesicle protein content. The results showed ( Figure 6The loading of MS-apoVs was significantly higher than that of ES-apoVs and LS-apoVs, indicating that mid-apoptotic vesicles have a stage-specific preferential loading feature for the RNA molecule shown in SEQ ID NO: 1.

[0079] This invention reveals that apoptotic vesicles derived from mesenchymal stem cells in the mid-apoptotic phase exhibit a higher natural RNA loading level (as shown in SEQ ID NO: 1) compared to early and late apoptotic vesicles, indicating that mid-apoptotic vesicles have a preferential loading capacity for this RNA, although its functional significance was previously unknown. This invention, by overexpressing the RNA shown in SEQ ID NO: 1 in donor mesenchymal stem cells, further demonstrates significantly higher RNA loading in engineered mid-apoptotic vesicles compared to untreated mid-apoptotic control vesicles, exhibiting stronger pro-apoptotic effects on senescent MSCs, reduced senescence phenotype, and restored osteogenic differentiation, achieving an osteogenic enhancement effect in age-related osteoporosis that surpasses that of natural mid-apoptotic vesicles.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. These modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An engineered extracellular vesicle, characterized in that, The vesicles are loaded with functional RNA molecules or their derivatives, and the amount of functional RNA molecules in the engineered extracellular vesicles is significantly increased compared with the corresponding vesicles from natural sources. The vesicles are derived from mesenchymal stem cells during apoptosis, and the nucleotide sequence of the functional RNA molecules is GUGCGUGGUGGCUCGAGGCGGGG.

2. The engineered extracellular vesicles according to claim 1, characterized in that, The mesenchymal stem cells include at least one of bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, umbilical cord mesenchymal stem cells, and dental pulp mesenchymal stem cells, preferably bone marrow mesenchymal stem cells, and more preferably mid-apoptotic bone marrow mesenchymal stem cells.

3. The engineered extracellular vesicles according to claim 1, characterized in that, The extracellular vesicles have a particle size of 100-1000 nm, preferably 180-210 nm.

4. The engineered extracellular vesicles according to claim 1, characterized in that, The vesicle membrane surface expresses markers including CD9, CD63, CD81, and Fas.

5. The engineered extracellular vesicles according to claim 1, characterized in that, The extracellular vesicles have a Zeta potential of -10 to -60 mV, preferably -32 to -36 mV.

6. A pharmaceutical composition, characterized in that, Includes the engineered extracellular vesicles and pharmaceutically acceptable carriers as described in any one of claims 1-5.

7. The method for preparing engineered extracellular vesicles according to any one of claims 1-5, characterized in that, include: (1) Introduce a functional RNA molecule or its mimicry with the nucleotide sequence GUGCGUGGUGGCUCGAGGCGGG into mesenchymal stem cells to obtain engineered mesenchymal stem cells overexpressing the RNA molecule. (2) Inducing apoptosis in the engineered mesenchymal stem cells to induce them to reach mid-apoptosis; (3) Collect the apoptotic vesicles released by the engineered mesenchymal stem cells in the mid-apoptotic phase to obtain engineered mid-apoptotic extracellular vesicles loaded with the functional RNA molecules.

8. Use of the engineered extracellular vesicles according to any one of claims 1-5 in the preparation of a medicament for treating age-related bone loss, senile osteoporosis or age-related bone regeneration disorders.

9. The use according to claim 8, characterized in that, The drugs include sterile vesicle suspensions, lyophilized preparations, hydrogel complexes, sustained-release systems, bone repair scaffold composite preparations, injectable or oral preparations.

10. The use according to claim 9, characterized in that, The drug may be administered systemically or topically depending on the indication.

Images