A cp23 monoclonal antibody hybridoma cell strain and application of the monoclonal antibody in preparation of colloidal gold test paper strip for rapid detection of cryptosporidium parvum

Abstract

The application discloses a CP23 monoclonal antibody hybridoma cell strain and application of the monoclonal antibody in preparation of a colloidal gold test strip for rapidly detecting Cryptosporidium parvum. The application takes the secreted antigen CP23 of Cryptosporidium parvum as a target, and obtains a cell strain 44H1-1 stably secreting an antibody through a hybridoma technology. The CP23 monoclonal antibody is prepared based on the cell strain, and a colloidal gold immunochromatography test strip for detecting and identifying Cryptosporidium parvum in a clinical fecal sample is established. The test strip can rapidly detect Cryptosporidium parvum in a fecal sample, and a result can be obtained in only 10-15 minutes, the detection limit is 1x10 4 Oocysts / gram of feces, the sensitivity is high, there is no cross reaction with human Cryptosporidium, coccidia and other pathogens, the specificity is good, the stability is high, compared with a nested PCR detection method, the test strip has better sensitivity and specificity, can be used for on-site rapid screening without professional equipment, and provides technical support for early diagnosis and batch screening of cryptosporidiosis.

Description

Technical Field

[0001] This invention relates to the field of biological and pathogen detection technology, and more specifically, to the application of a CP23 monoclonal antibody hybridoma cell line and its monoclonal antibody in the preparation of a rapid detection strip for Cryptosporidium microsporidium colloidal gold. Background Technology

[0002] Cryptosporidium ( Cryptosporidium Cryptosporidium microsporidium (Spp.) is an important zoonotic parasitic protozoan that can cause varying degrees of diarrhea in humans and many animals, and even death. Among them, Cryptosporidium microsporidium (Spp.) is particularly important. Cryptosporidium parvum Cryptosporidium parvum, a highly pathogenic parasite, is a major cause of diarrheal disease outbreaks in humans and animals. Its life cycle is complex, involving multiple developmental stages including trophozoite, schizont, gametophyte, and oocyst. Mature oocysts possess strong environmental resistance, and waterborne and foodborne transmission are its two key routes of transmission. In recent years, Cryptosporidium parvum has become a major pathogen causing large-scale diarrheal outbreaks in calves, exhibiting significant regional subtype differences. Nizoralazole is currently the only drug approved by the U.S. Food and Drug Administration (FDA) for treatment, but its efficacy has certain limitations. Therefore, timely and accurate detection of Cryptosporidium parvum is crucial for the rapid diagnosis and control of cryptosporidiosis.

[0003] Current detection methods, both domestically and internationally, are cumbersome to operate and rely on expensive instruments and equipment. Commercial reagent kits are imported and costly, making them unsuitable for rapid on-site testing and large-scale sample screening. While existing immunochromatographic methods for detecting Cryptosporidium microsporidium offer advantages such as speed and simplicity, they also have key limitations, including insufficient sensitivity, risk of specificity and cross-reactivity, and limited species coverage. Timely and accurate detection of Cryptosporidium microsporidium in fecal samples still faces multiple challenges: Cryptosporidium oocysts are tiny and morphologically similar to other components or parasites in feces (such as microsporidia), easily leading to confusion and misdiagnosis; low and unstable excretion rates can result in false negatives; the accuracy of the test results is highly dependent on sample quality, typically requiring fresh feces, but the complex composition of fecal samples can interfere with detection, leading to false positives; and the varying reagent kits and detection methods used in existing studies make cross-sectional comparisons difficult.

[0004] The core challenge in achieving rapid detection of Cryptosporidium parvum in feces lies in simultaneously meeting the requirements of both speed and accuracy. Rapid methods (such as ICT) have limitations in sensitivity, while accurate methods (such as PCR) struggle to meet the demands for speed and simplicity. For instance, existing publicly available Cryptosporidium antibody test strips rely on the Cryptosporidium CP23-GP15 tandem recombinant protein. This approach utilizes the recombinant protein to detect antibodies following pathogen infection, resulting in low sensitivity. Furthermore, this technique requires simultaneous ELISA detection using both CP23 and GP15 antigens to effectively reduce false negatives and improve the detection rate. Existing commercial kits, such as those from Savia... ® Cryptosporidium rapid detection kit, Xpect TM Cryptosporidium detection kits generally have a sensitivity of 85% and a specificity of over 90%, but they are expensive and have long lead times. Currently, there is a lack of methods and products in China that can rapidly and immediately detect the Cryptosporidium pathogen itself (specific antigens), making it difficult to meet the actual needs of early clinical diagnosis and epidemiological screening.

[0005] In order to overcome the above-mentioned problems in the existing technology, and to establish a faster and more accurate colloidal gold immunochromatographic test strip product and method, which is of great significance for the early diagnosis and rapid screening of cryptosporidiosis, this invention application is hereby proposed. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art. The present invention provides a CP23 monoclonal antibody hybridoma cell line and its monoclonal antibody in the preparation of a colloidal gold test strip for rapid detection of Cryptosporidium microsporidium.

[0007] The first objective of this invention is to provide a CP23 monoclonal antibody hybridoma cell line 44H1-1.

[0008] A second objective of this invention is to provide a CP23 monoclonal antibody.

[0009] A third objective of this invention is to provide a method for preparing CP23 monoclonal antibodies.

[0010] A fourth objective of this invention is to provide the application of the CP23 monoclonal antibody hybridoma cell line 44H1-1 or the CP23 monoclonal antibody.

[0011] The fifth objective of this invention is to provide a rapid detection strip for dendritic microsporidia.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution: This invention provides a CP23 monoclonal antibody hybridoma cell line ( Mus musculus hybridomaThe hybridoma cell line 44H1-1 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 19, 2026, with accession number GDMCC No. 68357.

[0013] This invention targets the Cryptosporidium microsporidium secretory antigen CP23 (encoded by the cgd4_3620 gene on chromosome 4). Through hybridoma technology, cell fusion and subclonal screening were performed, ultimately identifying a stable antibody-secreting cell line, 44H1-1, with the antibody subtype being IgG1 and all light chains being κ. The monoclonal antibody prepared based on this cell line can recognize a single epitope of a specific antigen, exhibiting higher batch-to-batch consistency and quality controllability. Simultaneously, using an anti-CP23 polyclonal antibody as the gold-labeled antibody and the anti-CP23 monoclonal antibody 44H1-1 as the detection line antibody, a colloidal gold immunochromatographic test strip was established for the detection and identification of Cryptosporidium microsporidium in clinical fecal samples. This test strip can rapidly detect Cryptosporidium microsporidium in fecal samples, obtaining results in just 10-15 minutes, with a detection limit of 1×10⁻⁶. 4 The test strip exhibits high sensitivity (1 oocyst / gram of feces), shows no cross-reactivity with other pathogens such as Cryptosporidium and Coccidia, and demonstrates good specificity. It can be stored for over 2 months at both low temperature (4℃) and room temperature (25℃), demonstrating good stability. Using this test strip to test 60 fecal samples, with nested PCR results as a reference, the sensitivity was 90.9% and the specificity was 93.9%, making it suitable for rapid on-site screening of Cryptosporidium in clinical fecal samples. This invention successfully established a novel colloidal gold immunochromatographic detection method based on Cryptosporidium CP23 protein in the CP23 monoclonal antibody hybridoma cell line 44H1-1. This method possesses high sensitivity, specificity, and stability, and requires no specialized equipment, providing technical support for the early diagnosis and mass screening of cryptosporidiosis.

[0014] This invention provides a CP23 monoclonal antibody, which is prepared from hybridoma cell line 44H1-1.

[0015] This invention provides a method for preparing CP23 monoclonal antibody. The method involves injecting cell line 44H1-1 into the peritoneal cavity of experimental mice, collecting the ascites fluid, centrifuging it, and then purifying the supernatant to obtain the monoclonal antibody. Specifically, 7 days after injecting phytidine into the peritoneal cavity of experimental mice, the mice are injected with hybridoma cell line 44H1-1. When the peritoneum of the mice becomes noticeably distended, the ascites fluid is collected. After centrifugation, the supernatant is purified to obtain the CP23 monoclonal antibody.

[0016] This invention provides the application of the above-mentioned hybridoma cell line or CP23 monoclonal antibody in the detection of Cryptosporidium microsporidium for non-disease treatment diagnosis purposes, or in the preparation of products for rapid detection of Cryptosporidium microsporidium.

[0017] Preferably, the product is a test kit or a colloidal gold test strip.

[0018] This invention provides a colloidal gold test strip for rapid detection of Cryptosporidium microsporidium, wherein the detection line of the test strip is coated with the CP23 monoclonal antibody prepared above.

[0019] The colloidal gold test strip provided by this invention uses a sandwich method for detection. Specific antibodies and control antibodies (such as goat anti-rabbit / mouse IgG) are immobilized on a nitrocellulose membrane (NC membrane) using a spotting technique. The test line (T line) is coated with CP23 monoclonal antibody, and the control line (C line) is coated with goat anti-rabbit IgG. The probe uses CP23 rabbit polyclonal antibody. After the probe is mixed with the sample, it binds to the antigen in the sample to form an antigen-antibody complex. The test strip is then inserted into the sample processing solution. The antigen-antibody complex binds to the monoclonal antibody coated on the test line, forming an "antibody-antigen-antibody" sandwich structure, resulting in specific binding and color development. A positive result is indicated by simultaneous color development of the control line (C line) and the test line (T line). The degree of color development of the T line is positively correlated with the concentration of the sample antigen.

[0020] Preferably, the probe is a colloidal gold-labeled CP23 rabbit polyclonal antibody, and the control line is coated with goat anti-rabbit / mouse IgG.

[0021] More preferably, the CP23 rabbit polyclonal antibody is obtained by purifying the serum of rabbit polyclonal antibodies obtained by immunizing New Zealand white rabbits with CP23 recombinant protein.

[0022] More preferably, the method for preparing the CP23 rabbit-derived polyclonal antibody is as follows: (1) Animal immunization: CP23 recombinant protein was mixed with an equal volume of adjuvant, emulsified, and then injected subcutaneously into the back of New Zealand white rabbits for immunization. The second to fourth immunizations were performed on days 14, 21, and 28 after the first immunization. Blood was collected from the ear vein on day 7 after the fourth immunization and serum was separated to obtain rabbit polyclonal antibody serum. (2) Polyclonal antibody purification: Protein A+G agarose was packed into the column, the column was equilibrated with TBS buffer, the rabbit polyclonal antibody serum obtained in step (1) was filtered through a 0.45 μm filter and added to the chromatography column, inverted and mixed, then washed with TBS buffer to remove non-specific proteins, and then the antibody was eluted with glycine. The collected antibody was ultrafiltered and concentrated, and the buffer was changed with PBS buffer to obtain the anti-CP23 rabbit polyclonal antibody.

[0023] More preferably, the concentration of the CP23 rabbit polyclonal antibody used in the probe is 50~200 μg / mL.

[0024] Preferably, the test strip further comprises a colloidal gold-labeled probe, a detection line, a control line, a sample pad, absorbent paper, an NC film, and a PVC base plate.

[0025] Furthermore, in addition to the test strips, the test products also contain other test reagents, such as sample diluent, antibody diluent, sample pad treatment solution, blocking agent, and probe solution.

[0026] More preferably, the probe solution is prepared as follows: take colloidal gold solution, adjust the pH to 8, add 100 μg / mL CP23 rabbit polyclonal antibody, mix well, let stand at room temperature for 20 min, add blocking agent, block at room temperature for 20 min, centrifuge at 4℃ for 20 min, discard the supernatant, then add colloidal gold-labeled CP23 rabbit polyclonal antibody reconstitution solution, mix well to obtain the probe.

[0027] Preferably, the sample diluent is prepared by adding 50 mL of PBS and 250 μL of Tween-20 to 0.5 g of BSA powder.

[0028] Preferably, the sample pad treatment solution consists of 5 mL of 10% BSA, 5 mL of 10% PVP, 3 mL of 10% Tween-20, 20 mL of 0.5 mol / L pH 7.4 phosphate buffer, and 67 mL of ultrapure water.

[0029] Preferably, the sealing agent is selected from 10% BSA, 10% PEG2000, 10% skim milk powder or 10% glycine.

[0030] More preferably, the sealing agent is 10% PEG2000.

[0031] Preferably, the optimal antibody diluent is 0.5% BSA.

[0032] Preferably, the pH value of the gold-labeled antibody is 7-9, and the labeling concentration is 5-15 μg / mL.

[0033] More preferably, the pH value of the gold-labeled antibody is 8, and the labeling concentration is 10 μg / mL.

[0034] Preferably, the coating concentration of the C-line and T-line antibodies is 0.25~1 mg / mL.

[0035] More preferably, the optimal concentration for line C is 0.5 mg / mL, and the optimal concentration for line T is 0.5 mg / mL.

[0036] Preferably, the preparation method of the colloidal gold test strip includes the following steps: (1) Sample pad pretreatment: cut to a width of 15 mm, soak the sample pad with sample pad treatment solution, dry overnight at 37°C for 12 h, and store in a sealed container at room temperature; (2) Antibody coating on NC membrane: Anti-CP23 mouse monoclonal antibody was coated onto the NC membrane as T line using a membrane coating instrument, and goat anti-rabbit IgG antibody was coated onto the NC membrane as C line. The membrane was dried overnight at 37°C. (3) Pretreatment of absorbent paper: cut to a width of 25 mm, seal and store at room temperature; (4) Assembly: Assemble the sample pad, NC membrane and absorbent paper on the PVC base plate, seal and store at room temperature, and keep dry.

[0037] This invention also provides a method for rapid detection of Cryptosporidium microsporidium in fecal samples. The fecal sample is added to a sample diluent and stirred thoroughly. After centrifugation, the fecal supernatant is collected and diluted 4-128 times with the sample diluent. A probe is then added and incubated for 5-10 minutes. The test strip is then inserted and allowed to stand at room temperature for 10-15 minutes until the C and T lines on the test strip stabilize. The color development is observed. If both the C and T lines develop color, the result is positive. If the C line develops color but the T line does not, the result is negative. If no C line appears, the result is invalid and retesting is required.

[0038] Therefore, this invention also provides the application of anti-CP23 rabbit polyclonal antibody in the preparation of rapid detection products for cryptospores.

[0039] The present invention has the following beneficial effects: This invention targets the Cryptosporidium microsporidium secretory antigen CP23. Using hybridoma technology, a stable antibody-secreting cell line, 44H1-1, was obtained. Based on the CP23 monoclonal antibody prepared from this cell line, a colloidal gold immunochromatographic test strip was developed for the detection and identification of Cryptosporidium microsporidium in clinical stool samples. This test strip exhibits good specificity and sensitivity, requires no expensive equipment, and uses simple and low-cost raw materials. Detection and results can be completed and read within 10-15 minutes, making it suitable for clinical screening and rapid on-site testing. The detection limit of this test strip is 1×10⁻⁶. 4 The method yields 1 oocyst per gram of feces, exhibiting high sensitivity; it shows no cross-reactivity with other pathogens such as Cryptosporidium and Coccidia, demonstrating good specificity; the test strips can be stored for >2 months at both low temperature (4℃) and room temperature (25℃), exhibiting good stability. Using this method to test 60 fecal samples, with nested PCR results as a reference, the sensitivity was 90.9% and the specificity was 93.9%, indicating that this method is suitable for rapid on-site screening of Cryptosporidium in clinical fecal samples. This invention provides simple and rapid on-site detection technology support for early clinical diagnosis and large-scale epidemiological screening of Cryptosporidium. Attached Figure Description

[0040] Figure 1 Sequence alignment diagram after optimization for the CP23 codon.

[0041] Figure 2 The image shows the optimized CP23 recombinant plasmid.

[0042] Figure 3 Indirect immunofluorescence detection of hybridoma cell supernatant (DIC: differential interference; Hoechst staining of cell nuclei (blue); Anti-CP23: positive hybridoma cell supernatant, recognizing CP23 protein (green); scale bar is 2 μm).

[0043] Figure 4 ELISA detection of hybridoma cell supernatant (the horizontal axis in the figure represents the dilution of positive hybridoma cell supernatant; the vertical axis represents the OD of positive hybridoma cell supernatant). 450 ).

[0044] Figure 5 IFA localization microscope image for hybridoma cell screening (DIC: differential interference; Hoechst staining of cell nuclei (blue); Anti-CP23: supernatant of positive hybridoma cells, recognizing CP23 protein (green); scale bar is 2 μm).

[0045] Figure 6 SDS-PAGE identification of purified antibody (44H1-1) (M: marker; red arrows: indicate heavy and light chains of monoclonal antibody, with larger molecular weight bands representing heavy chains and smaller molecular weight bands representing light chains; a: antibody gradient elution; flow-through: flow-through buffer; wash: wash buffer; 1-6: 6 elution buffers; b: antibody concentration; mAb: concentrated CP23 monoclonal antibody).

[0046] Figure 7 Indirect immunofluorescence detection of purified antibody (44H1-1) (DIC: differential interference; Hoechst staining of cell nuclei (blue); Anti-CP23: anti-CP23 monoclonal antibody, recognizing CP23 protein (green); scale bar is 2 μm).

[0047] Figure 8 The image shows the confocal microscopy tomographic results of sporozoite swelling after purification of antibody (44H1-1) (Hoechst staining of cell nuclei (blue); Anti-CP23: anti-CP23 monoclonal antibody, recognizing CP23 protein (green); NHS staining of sporozoites (red)).

[0048] Figure 9 This is a schematic diagram of the structure of a colloidal gold test strip.

[0049] Figure 10This serves as the standard for interpreting the results of colloidal gold test strips.

[0050] Figure 11 The results show the determination of the optimal pH value for the gold-labeled antibody (the amount of K2CO3 added from left to right in the figure is 0, 1, 3, 5, 7, 9, 11 μL).

[0051] Figure 12 The results show the determination of the optimal labeling amount of gold-labeled antibody (the amount of gold-labeled antibody added from left to right in the figure is 0, 5, 10, 15, and 20 μg respectively).

[0052] Figure 13 The results show the determination of the concentration of the C line on the test strip (in the figure, - represents a negative sample; + represents a positive sample; from left to right, the concentrations of the antibody in the C line are 0.25, 0.5, and 1 mg / ml respectively).

[0053] Figure 14 The results show the determination of the T-line concentration of the test strip (in the figure, - represents a negative sample; + represents a positive sample; the concentrations of the T-line antibody from left to right are 0.25, 0.5, and 1 mg / mL, respectively).

[0054] Figure 15 The results show the determination of the optimal antibody dilution (in the figure, - represents negative samples; + represents positive samples; 1 is 0.01M PBS (pH 7.4); 2 is 0.01M Tris-HCl (pH 7.4); 3 is 0.5% BSA (pH 7.4); 4 is 0.01M PB (pH 7.4); 5 is 0.01M BB (pH 7.4)).

[0055] Figure 16 The results show the determination of the optimal sealing agent (in the figure, - represents negative samples; + represents positive samples; 1 is 10% BSA; 2 is 10% PEG2000; 3 is 10% skim milk powder; 4 is 10% glycine).

[0056] Figure 17 The results show the determination of the optimal sample pad (in the figure, - represents a negative sample; + represents a positive sample; 1 is B8964; 2 is GF2; 3 is SB08; 4 is SB06; 5 is RB65).

[0057] Figure 18 The results of colloidal gold immunochromatographic assay of fecal samples at different dilution ratios are shown in the figure (from left to right, the dilution ratios of positive fecal samples are 1:1, 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, and 1:512).

[0058] Figure 19The results of sensitivity testing for colloidal gold immunochromatography are shown in the figure (the fecal test results of the same Cryptosporidium microsporidium strain at different infection stages; OPG: oocyst excretion per gram of feces).

[0059] Figure 20 The results of the specific assays for colloidal gold immunochromatography are shown in the figure (1 is a positive fecal sample of coccidia; 2 is a positive fecal sample of Strigiformes brevicornu; 3 is a positive fecal sample of Angiostrongylus cantonensis; 4 is a positive fecal sample of Cryptosporidium hominis; and 5 is a positive fecal sample of Cryptosporidium microsporidium).

[0060] Figure 21 The results of the repeatability test for colloidal gold immunochromatographic assay are shown in the figure (- represents negative samples; + represents positive samples; the strips are divided into 6 groups, with 3 strips in each group prepared from different batches, 1-3 are 3 different negative stool samples, and 4-6 are 3 different positive stool samples).

[0061] Figure 22 The results of the stability test for colloidal gold immunochromatographic assay are shown in the figure (- represents negative samples; + represents positive samples; from top to bottom, the test strips were stored for 0, 1, and 2 months; from left to right, the test strips were stored under low temperature (4℃), room temperature (25℃), and high temperature (37℃) conditions).

[0062] Figure 23 The results of colloidal gold immunochromatographic analysis of some cow feces samples are shown in the figure (a in the figure shows some feces samples that tested positive by PCR; b shows some feces samples that tested negative by PCR). Detailed Implementation

[0063] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0064] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0065] All experimental animals used in the examples were housed in a standard SPF-grade environment, in accordance with animal welfare and related ethical requirements. Female multiparous BALB / c mice aged 10–12 weeks were purchased from Zhuhai Beston Biotechnology Co., Ltd.

[0066] All fecal samples used in the examples were preserved by our research group. Mouse fecal samples were frozen at -20°C, and cattle fecal samples were collected from different-sized farms in Yunnan and frozen at -20°C.

[0067] Preparation of sample diluent: Weigh 0.5 g BSA powder, add 50 mL PBS and 250 μL Tween-20, mix well, and store at 4℃.

[0068] Preparation of sample pad treatment solution: Pipette 5 mL of 10% BSA, 5 mL of 10% PVP, 3 mL of 10% Tween-20, 20 mL of 0.5 mol / L pH 7.4 phosphate buffer and 67 mL of ultrapure water, mix thoroughly and use immediately.

[0069] Example 1: Preparation of monoclonal antibodies against Cryptosporidium microsporidium 1. Preparation of recombinant Cryptosporidium CP23 protein Codon optimization was performed on the CP23 protein, and the optimized sequence SQE ID NO.1 is: 5-'ATGGGTTGTAGCAGCAGCAAACCGGAAACGAAAGTGGCGGAAAACAAAAGCGCGGCGGATGCAAATAAACAGCGTGAACTGGCAGAAAAGAAGGCACAGCTGGCGAAAGCAGTTAAAAACCCGGCACCGATTAGCAATCAGGCACAGCAGAAACCAGAAGAACCAAAGAAGAGCGAACCGGCACCAAACAATCCGCCTGCAGCAGATGCACCGGCAGCACAGGCACCTGCAGCACCTGCAGAACCTGCACCACAGGATAAACCAGCAGATGCACCTGCAGCCGAAGCACCAGCAGCAGAACCAGCAGCACAGCAGGATAAACCGGCAGATGCA-3'; The optimized CP23 sequence alignment is as follows: Figure 1 As shown, optimization can improve protein purification efficiency.

[0070] Using the previously prepared pET-28a-CP23 plasmid as a DNA template, and employing amplification primers CP23-CF (SQE ID NO. 2): 5-'gggcagcagcATGGGTTGTAGCAGCAGC-3' and CP23-CR (SQE ID NO. 3): 5-'TACAACCCATgctgctgcccatggtatatc-3', the plasmid was seamlessly ligated using homologous recombination to construct the pET-28a-CP23-C-6 × His plasmid carrying a 6 × His tag at the C-terminus of the CP23 protein. The plasmid was then transformed into BL21(DE3) competent cells, and after slow transformation, the cells were cultured to OD. 600To achieve a concentration of 0.6-0.8, 1 mM IPTG was added and the mixture was induced at 37 ℃ for 6 h. The induced bacterial culture was then sonicated. Samples were prepared as uninduced, induced, supernatant, and precipitated protein for protein expression identification. The optimal elution concentration was determined using a gradient elution of imidazole solutions at 40 mM, 80 mM, 160 mM, 240 mM, 320 mM, 400 mM, and 480 mM. The CP23 recombinant protein was obtained after dialysis concentration. The CP23 recombinant plasmid map is shown below. Figure 2 As shown.

[0071] 2. Animal immunization The prepared CP23 recombinant protein was mixed with an equal volume of adjuvant (Freud's complete adjuvant), emulsified, and then administered to Balb / c mice via subcutaneous injection at multiple sites on the back. The initial immunization was performed at a dose of 50 μg / mouse / dose. Second and third immunizations were performed on days 14 and 28, respectively, at a dose of 25 μg / mouse / dose. Seven days after the third immunization, serum was collected and separated. Antibody titers in the serum were detected using an indirect ELISA method. Two mice with the highest serum titers (up to 1:512000) were selected for cell fusion.

[0072] 3. Cell fusion Spleen cells from mice with the highest serum titers after the third immunization were selected and placed in fusion flasks at a ratio of 5:1 with SP2 / 0 myeloma cells. After centrifugation at 1000 rpm for 5 min, the supernatant was discarded, the cell pellet was reconstituted by tapping, and 1 mL of 50% PEG fusion agent preheated to 42℃ was added along the flask wall. Serum-free DMEM medium was slowly added to terminate the fusion. After standing for 10 min, the cells were centrifuged at 1000 rpm for 5 min. The cell pellet was resuspended in HAT medium, mixed, and 100 μL of the mixture was added to each well of a 96 cell culture plate containing feeder cells prepared the previous day. The plates were then incubated in a constant temperature CO2 incubator.

[0073] 4. Screening and subcloning of hybridoma cell lines (1) Enzyme-linked immunosorbent assay (ELISA): Cell culture supernatant from single cell clusters was used for indirect ELISA detection to screen for positive hybridoma cells after fusion. Coating antigen: Cell culture supernatant was diluted to 5 μg / mL with coating buffer, 100 μL per well, and coated overnight at 4℃. 300 μL PBST was added to each well, and the cells were washed 3 times for 5 min each time and then patted dry. Blocking: 100 μL 1% BSA was added to each well and blocked at 37℃ for 2 h. The cells were washed 3 times with PBST and then patted dry. Sample dilution: Mouse serum before and after immunization was serially diluted 1:1000 at the initial concentration, with 3 replicates for each serum sample. The cells were incubated at 37℃ for 1 h, washed 3 times with PBST for 5 min each time, and then patted dry. Secondary antibody incubation: HRP-labeled goat anti-mouse secondary antibody was diluted 1:1000, 100 μL per well, and incubated at 37℃ for 1 h. The cells were washed 3 times with PBST for 5 min each time and then patted dry. Color development: Add 50 μL of TMB chromogenic solution to each well, react in the dark for 10 min, then add 50 μL of ELISA stop solution and measure OD using a microplate reader. 450 A positive result is defined as P / N ≥ 2.1 (positive well / negative well ≥ 2.1).

[0074] (2) Indirect immunofluorescence observation: oocysts and sporozoites: Sterilize oocysts, applying 2 × 10⁻⁶ ppm per well. 5Take the required number of oocysts (wild-type Cryptosporidium microsporidium oocysts preserved in the laboratory), add 600 μL PBS and 200 μL sodium hypochlorite, and incubate on ice for 10 min. Then centrifuge at 13200 rpm for 3 min at 4°C, discard the supernatant, add 1 mL PBS, wash, centrifuge at 13200 rpm for 3 min, discard the supernatant (a small amount of supernatant can be retained to reduce oocyst loss), repeat the PBS washing process 2-3 times to remove sodium hypochlorite. Oocyst decapsulation: Add 400 μL of 1% BSA and 1.5% sodium taurocholate, mix well, incubate at 37°C for 30 min to decapsulate, centrifuge at 13200 rpm for 3 min, and discard the supernatant. Fixation and slide preparation: Add an appropriate amount of 4% paraformaldehyde to each well to resuspend the oocysts, evenly spot them onto a 6-well absorbent slide, dry and fix at 37°C (dry until slightly dry), use an immunohistochemical pen to draw lines separating each well, wash with PBS 3 times, 3 min each time, and aspirate residual water. Permeabilization and blocking: Add 20 μL of 0.5% Triton X-100 to each well, permeabilize at 37℃ for 15 min, wash 3 times with PBS, and remove residual water; add 50 μL of 1% BSA, block at 37℃ for 30 min, wash 3 times with PBS, and remove residual water. Primary antibody incubation: Add 50 μL of cell culture supernatant to each well, incubate overnight at 4℃ for 14 h, wash 5 times with PBS for 3 min each time, and remove residual water. Secondary antibody incubation: Under light-protected conditions, add 50 μL of a 1:1000 diluted mixture of goat anti-mouse fluorescent secondary antibody and Hoechst nuclear staining solution to each well, incubate at 37℃ for 1 h, wash 5 times with PBS for 3 min each time, and remove residual water. Mounting: Keeping protected from light, add 10 μL of anti-fluorescence quencher to each well, mount, and store in a humidified chamber at 4℃ protected from light. Observation: Immunofluorescence microscopy was used for observation. The corresponding fluorescence signal channel was selected according to the fluorescent secondary antibody used to observe the staining of the cell supernatant.

[0075] Cellular level: Cell culture: Place sterile, appropriately sized cell slides into well plates, add healthy, uncontaminated HCT-8 cells to each well, and incubate at 37°C in a 5% CO2 incubator. Cell infection: Sterilize oocysts as described above, infecting each well with 1×10⁵ oocysts, and incubate for 12 h, 24 h, 36 h, and 48 h respectively. Fixation, permeabilization, blocking, and antibody incubation are performed as described above. Mounting: Apply 5 μL of anti-fluorescence quencher to a glass slide, place the cell-side down of the cell slide on top, and perform mounting and observation as described above.

[0076] Indirect ELISA was used to screen for positive hybridoma cells that could secrete antibodies against CP23 protein after fusion. The ELISA results are shown in Table 1. A total of 22 positive hybridoma cells were screened.

[0077] Table 1. ELISA detection of hybridoma cell supernatant

[0078] Cell culture supernatant from the 22 positive wells obtained after ELISA was analyzed for IFA. Figure 3 As shown, sporozoite-like localization was observed in all five cell lines, 44H1, 49D6, 53H3, 54B5, and 55D2, which is consistent with the localization characteristics of CP23. This indicates that the antibodies secreted by these five cell lines can accurately recognize the natural CP23 protein. Therefore, these five hybridoma cell lines were selected for subsequent subcloning.

[0079] (3) First round of subcloning: The positive hybridoma cells selected by limiting dilution were subcloned. The cell suspension diluted with HT medium was seeded into 96-well plates with feeder cells in advance at a rate of 100 μL per well, ensuring that each well contained only 1 cell. The plates were then incubated at 37°C and 5% CO2.

[0080] (4) Second round of subcloning: Observe the cell status using an inverted microscope. After culturing for 5 to 7 days, replace half of the medium with HT medium. After culturing for 7 to 10 days, select two positive wells from each cell line that grow into single cell clusters quickly, grow well, and have regular morphology as sister subclones for the second round of subcloning. Screen out stable cell lines that can continuously secrete monoclonal antibodies by indirect ELISA retesting and IFA identification.

[0081] Further, two rounds of subcloning were performed on the five positive hybridoma cell lines using the limiting dilution method. The culture supernatants of these five cell lines and their corresponding sister clones (a total of ten cell lines) were then re-examined using indirect ELISA. The results are as follows: Figure 4 As shown, the OD of 10 cell lines 450 Both were significantly higher than the control group, indicating that the cells could normally secrete antibodies against CP23.

[0082] Monoclonal antibody subtypes were identified in the supernatant of 10 IFA-positive hybridoma cell lines. The results showed that all antibodies were IgG1 in the heavy chain and κ in the light chain. The IFA identification results are as follows: Figure 5 As shown, sporozoite-like localization can also be clearly observed, with the 44H1-1 cell line exhibiting the strongest fluorescence signal and no nonspecific fluorescence. Therefore, the 44H1-1 cell line was selected for subsequent experiments. Simultaneously, the 44H1-1 cell line was biopreserved and identified as a CP23 monoclonal antibody hybridoma cell line. Mus musculus hybridomaIt was deposited on August 19, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No. 68357, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0083] Positive hybridoma cells obtained from screening were expanded into larger cultures, cryopreserved when they reached the logarithmic growth phase, and stored in liquid nitrogen. One month after cryopreservation, one cell line was thawed to assess the cryopreservation effect. Cell growth was observed using an inverted microscope. The results showed that after 5 weeks of continuous culture following thawing, the cells were in good condition and exhibited semi-adherent growth. IFA analysis of the cell culture supernatant showed sporozoite-like localization, consistent with CP23 localization characteristics, indicating that the cells could stably secrete antibodies against CP23.

[0084] 5. Monoclonal antibody preparation Three multiparous BALB / c mice aged 10–12 weeks were intraperitoneally injected with 0.5 mL of phytane per mouse. Seven days later, each mouse was injected intraperitoneally with 1 × 10⁻⁶ oz. 6 Collect 44H1-1 hybridoma cells. When the mouse abdominal cavity is significantly distended after about 7 days, collect the ascites fluid. Centrifuge the collected ascites fluid at 10000×g / min for 10 min and then collect the supernatant and store it at -20℃.

[0085] 6. Monoclonal antibody purification Pack Protein A+G agarose into a column, equilibrate the column with TBS buffer, filter ascites fluid through a 0.45 μm filter membrane and add it to the chromatography column, invert and mix well, wash with TBS buffer to elute non-specific proteins, then elute the antibody with glycine (50 mM pH 1.9), transfer the collected monoclonal antibody to a 10K ultrafiltration tube, centrifuge at 5000 × g / min for 30 min to concentrate the antibody, and change the medium with high-pressure PBS during the process to obtain anti-CP23 mouse monoclonal antibody 44H1-1.

[0086] 7. Monoclonal antibody identification (1) Subclass identification of monoclonal antibodies According to the instructions of the Proteintech Monoclonal Antibody Subtype Identification Kit, the subtype of monoclonal antibody 44H1-1 was determined to be IgG1 Kappa.

[0087] (2) SDS-PAGE identification of monoclonal antibodies The purified antibody was identified by SDS-PAGE, and the electrophoresis results are as follows: Figure 6 As shown, two clear protein bands are visible, with no obvious impurities, indicating that the purified antibody has high purity. The molecular weight of the heavy chain is approximately 50 kDa, and the molecular weight of the light chain is approximately 23 kDa.

[0088] (3) IFA identification of monoclonal antibodies The purified antibody was diluted at ratios of 1:1000, 1:2000, 1:4000, and 1:8000 and then subjected to IFA assay. The results are as follows: Figure 7 As shown, correct sporozoite membrane-like localization can be observed in all cases, and strong fluorescence signals are still present even at a high dilution of 1:8000, indicating that a high concentration of anti-CP23 monoclonal antibody has been successfully obtained.

[0089] (4) Identification of sporozoite swelling of monoclonal antibodies To further identify the specificity and sporozoic localization of the obtained monoclonal antibody 44H1-1, the purified antibody was diluted 1:1000 and sporozoic swelling was assessed. Confocal microscopy was used to capture tomographic images (12 layers were captured and stacked). The results are as follows: Figure 8 As shown, the sporozoites expand in size, and the fluorescence signal is distributed throughout the entire spore after multi-layer superposition (unlike the single-layer imaging of IFA), which is consistent with the localization characteristics of CP23. There is no non-specific fluorescence, indicating that a monoclonal antibody with good specificity against CP23 has been successfully obtained.

[0090] Example 2: Preparation of rabbit-derived polyclonal antibodies against Cryptosporidium microsporidium 1. Animal immunization The CP23 recombinant protein prepared in Example 1 was mixed with an equal volume of adjuvant, emulsified, and then injected subcutaneously into the back of New Zealand white rabbits for immunization. The second to fourth immunizations were performed on days 14, 21, and 28 after the first immunization. Blood was collected from the ear vein on day 7 after the fourth immunization, and serum was separated to obtain rabbit polyclonal antibody serum.

[0091] 2. Polyclonal antibody purification Pack Protein A+G agarose into a column, equilibrate the column with TBS buffer, filter the rabbit polyclonal antibody serum obtained above through a 0.45 μm filter membrane and add it to the chromatography column. Mix by inversion, then wash with TBS buffer to elute non-specific proteins, and then elute the antibody with glycine. Collect the antibody and concentrate it by ultrafiltration, then replace the buffer with PBS buffer to obtain anti-CP23 rabbit polyclonal antibody. This antibody is used as a probe to subsequently couple with colloidal gold particles to form a gold-labeled antibody complex for detecting the target antigen in the sample.

[0092] Example 3: Preparation of colloidal gold immunochromatographic test strips 1. Preparation of colloidal gold Colloidal gold with a particle size of approximately 20 nm was prepared by reduction using trisodium citrate: 100 mL of ultrapure water was added to a beaker, and the mixture was heated to boiling for 3 min on a magnetic stirrer. 4 mL of 1% chloroauric acid was quickly added, and the mixture was boiled for another 3 min. At this point, the solution changed from colorless to pale yellow. 8 mL of 1% trisodium citrate was added, and the mixture was boiled for another 10 min after it turned a stable wine-red color. After cooling to room temperature, ultrapure water was added to bring the volume to 100 mL, thus preparing spherical colloidal gold with a particle size of approximately 20 nm. The zeta potential of the colloidal gold was -16.6 mV, exhibiting the typical negative potential characteristic of colloidal gold.

[0093] 2. Probe marking (1) Adjust pH: Take 1 mL of the prepared colloidal gold solution into a 1.5 mL centrifuge tube, add an appropriate amount of 0.2 mol / L K2CO3 solution to adjust the pH of the colloidal gold solution to 8.

[0094] (2) Antibody labeling: 100 μL of the CP23 rabbit polyclonal antibody prepared in Example 2 (100 μg / mL) was added dropwise to a centrifuge tube, mixed evenly, and allowed to stand at room temperature for 20 min.

[0095] (3) Blocking: Add 20 μL of 10% PEG20000 as a blocking agent, block at room temperature for 20 min, pre-cool the centrifuge, centrifuge at 4℃ and 14000 rpm for 20 min.

[0096] (4) Probe reconstitution: Discard the supernatant, add 200 μL of colloidal gold-labeled CP23 rabbit polyclonal antibody reconstitution solution, mix well to obtain the probe, and store at 4℃.

[0097] Goat anti-rabbit IgG (purchased from Beyotime, catalog number A0216) was coated on the control line C of the NC membrane, and monoclonal antibody 44H1-1 was coated on the detection line T. The probe was a colloidal gold-labeled rabbit polyclonal antibody CP23. When added to the pretreated test sample, it will bind with the antigen in the sample to form an antigen-antibody complex. The antigen-antibody complex will bind with the monoclonal antibody coated on the detection line to form an "antibody-antigen-antibody" sandwich structure.

[0098] 3. Assembly of test strips Cut sample pads to a width of 15 mm, immerse them in sample pad treatment solution, dry them overnight at 37°C for 12 h, and store them in a sealed container at room temperature. Cut absorbent paper to a width of 25 mm, and store it in a sealed container at room temperature. Assemble the sample pads, NC membrane, and absorbent paper on a PVC base plate, cut them into 3 mm wide test strips, and store them in a sealed container at room temperature to keep them dry. A schematic diagram of the prepared colloidal gold test strip structure is shown below. Figure 9 As shown.

[0099] 4. Sample pretreatment, testing procedures and result interpretation Weigh 0.05 g of fecal sample and add 1 mL of sample diluent. Stir well and centrifuge at 2000 rpm, 4℃ for 1 min. Take the supernatant from the centrifuged fecal sample, dilute it with the sample diluent, and transfer 195 μL to a 96-well plate. Add 5 μL of probe and incubate for 5 min. Insert the test strip and let it stand at room temperature for 10-15 min until the C and T lines on the test strip stabilize. Observe the color development. If both the C and T lines are colored, the result is positive; if the C line is colored but the T line is not colored, the result is negative; if no C line appears, the result is invalid and needs to be retested. The result interpretation criteria are as follows: Figure 10 As shown.

[0100] Example 4: Optimization of Colloidal Gold Immunochromatographic Test Strips 1. Selection of the optimal pH value for gold-labeled antibodies (1) Add 0, 1, 3, 5, 7, 9, and 11 μL of 0.2mol / L K2CO3 solution to 7 centrifuge tubes containing 1 mL of colloidal gold solution in sequence to adjust the pH of the colloidal gold solution.

[0101] (2) Use 0.5% BSA as a diluent to dilute the anti-CP23 polyclonal antibody to 200 μg / mL. Add 100 μL to each centrifuge tube and mix well.

[0102] (3) Add 100 µL of 10% sodium chloride solution to each tube, mix well, let stand at room temperature for 10 min, observe whether the colloidal gold solution changes color, and determine whether the colloidal gold aggregates. The pH value corresponding to the centrifuge tube with no obvious color change is the optimal value, and record the amount of K2CO3 solution used at this time.

[0103] The results are as follows Figure 11 As shown, when 5 μL of K2CO3 solution is added, the colloidal gold can maintain a stable red color and does not aggregate (colloidal gold aggregates to a purple / blackish-purple color). The pH value at this time is 8. Therefore, the optimal pH value for gold-labeled antibodies is 8.

[0104] 2. Selection of the optimal amount of antibody labeling (1) Add 5 μL of 0.2 mol / L K2CO3 solution to 4 centrifuge tubes containing 1 mL of colloidal gold solution and adjust the colloidal gold solution to the optimal pH.

[0105] (2) Use 0.5% BSA as a diluent, add 100 μL of 0, 50, 100, 150 and 200 μg / mL polyclonal antibodies to each tube respectively, and mix well.

[0106] (3) Add 100 µL of 10% sodium chloride solution to each tube, mix well, and let stand at room temperature for 10 min. Observe whether the colloidal gold solution changes color. Record the amount of antibody corresponding to the centrifuge tube with no obvious color change. On this basis, increase the amount of antibody by 10% to 20% as the optimal labeling amount.

[0107] After adjusting the pH of the colloidal gold to 8, 100 μL of different concentrations of anti-CP23 polyclonal antibody were added. The color of the colloidal gold was then observed visually. Figure 12 As shown in the figure, the results indicate that colloidal gold can maintain a stable red color when the antibody addition amount is 10 μg. Therefore, the optimal labeling amount of gold-labeled antibody is 10 μg, and the antibody amount is increased by 20% on this basis as the working concentration.

[0108] 3. Optimal concentration of test strip C line and T line (1) Determination of the optimal concentration of antibody in the C line: The NC membrane was scratched using a membrane scratcher. Under the condition of scratching the T line with 1 mg / mL monoclonal antibody, the C line was scratched with 0.25, 0.5 and 1 mg / mL goat anti-rabbit IgG respectively. The membrane was dried overnight at 37℃ for 12 h. The concentration of antibody in the C line was determined based on the color development of the C line.

[0109] Add 1 mg / mL monoclonal antibody to the T line, and serially dilute goat anti-rabbit IgG from 1 mg / mL to 0.25 mg / mL and add it to the C line. Test negative and positive standard fecal samples (OGP: 1 × 10⁻⁶) for detection. 8 The color development of line C was compared at different concentrations. The results showed that when the concentration of line C was 0.5 mg / mL, the color development of line C was obvious. Figure 13 As shown, to save costs, the optimal concentration for line C was determined to be 0.5 mg / mL.

[0110] (2) Determination of the optimal concentration of T-line antibody: The NC membrane was scratched using a membrane scratcher. Under the condition of scratching the C line with 1 mg / mL goat anti-rabbit IgG, the T line was scratched with 0.25, 0.5 and 1 mg / mL monoclonal antibody, respectively. The membrane was dried overnight at 37℃ for 12 h. The concentration of T-line antibody was determined based on the color development of the T line.

[0111] Goat anti-rabbit IgG was diluted to 1 mg / mL and added to the C line. Simultaneously, monoclonal antibody was serially diluted from 1 mg / mL to 0.25 mg / mL and added to the T line. Negative and positive standard fecal samples (OGP: 1 × 10⁻⁶) were then tested. 8 ), observing the color development of the T line at different concentrations, the results showed that the color development was most obvious when the concentration at which the T line was drawn was 1 mg / mL, such as Figure 14 As shown, the optimal concentration for line T is therefore 1 mg / mL.

[0112] 4. Determination of antibody diluent Antibodies were diluted (4-128 times) using five different antibody diluents: 0.01M PBS, 0.01M Tris-HCl, 0.5% BSA, 0.01M PB, and 0.01M BB, respectively, before probe labeling. The specific method was as described in Example 3. The optimal antibody diluent was determined based on the color development of the C and T lines on the test strip.

[0113] Choosing a suitable antibody diluent can effectively improve antibody stability, protect antibody activity, and increase detection sensitivity. Observe the color development of the test strip, such as... Figure 15 As shown, when using 0.01M PBS (pH 7.4), 0.01M PB (pH 7.4), and 0.01M BB (pH 7.4) as antibody diluents, the color development of the C and T lines was unsatisfactory, with pale and grayish-purple colors, indicating aggregation of colloidal gold particles. However, when using 0.01M Tris-HCl (pH 7.4) and 0.5% BSA (pH 7.4) as antibody diluents, the color development of the C and T lines was better, with the latter showing more pronounced color development. This may be because BSA effectively protects antibody activity and spatial conformation, reducing non-specific adsorption and aggregation during chromatography and improving antigen-antibody binding efficiency. Therefore, 0.5% BSA was selected as the optimal antibody diluent.

[0114] 5. Determination of the sealing agent Based on the above optimization conditions, 10% BSA, 10% PEG2000, 10% skim milk powder and 10% glycine were used as blocking agents, respectively, and the blocking was performed after the probe was marked. The optimal type of blocking agent was determined based on the color development of the C line and T line of the test strip.

[0115] The main function of the sealing agent is to reduce non-specific adsorption, gold particle aggregation, and background interference during sample detection, thereby improving the accuracy of the detection. Observe the color development of the test strip, such as... Figure 16 As shown, when 10% skim milk powder and 10% glycine were used as blocking agents, the T line of the test strip showed weak color development; when 10% BSA and 10% PEG2000 were used as blocking agents, the T line showed better color development. BSA specifically blocked non-specific sites on the probe surface through hydrophobic interactions and hydrogen bonds, while PEG2000 formed a physical barrier through steric hindrance, which could efficiently block non-specific sites on the probe surface. To save costs, 10% PEG2000 was finally determined as the best blocking agent.

[0116] 6. Determination of the sample pad Based on the optimization of the above conditions, five different types of glass cellulose membranes, namely B8964, GF2, RB65, SB06 and SB08, were used as sample pads. The optimal type of sample pad was determined based on the color development and retention of the C and T lines on the test strip.

[0117] The main function of the sample pad is to capture and fix specific biomolecules in the sample, and to buffer and filter impurities in the sample, reducing the interference of these factors on the test results. Observe the color development of the test strip, such as... Figure 17 As shown, the color development of the C and T lines using sample pads B8964, GF2, and SB06 was not ideal; the color development of the C and T lines using sample pad SB08 was slightly better than that of RB65, thus SB08 was determined to be the best sample pad.

[0118] 7. Determination of the dilution factor for fecal samples Based on the above optimized conditions, the pretreated standard positive fecal samples (the oocyst excretion rate (OPG) per gram of feces in the positive fecal sample was 1×10⁻⁶) were used. 8 The fecal sample was diluted 2 times and then tested. The specific testing was the same as in Example 3. The dilution ratio range of the fecal sample was determined based on the color development and retention of the T line on the test strip.

[0119] Fecal samples have a complex composition, containing large amounts of protein, fat, fiber, and intestinal mucus, which can easily affect the capillary action of the NC membrane, causing the gold-labeled probe to be intercepted during chromatography and affecting the normal color development of the test strip. Pretreated standard positive fecal samples (OGP 1×10⁻⁶) were then used. 8 The fecal sample was diluted 2 times before testing to determine the dilution factor. Figure 18 As shown, when the dilution factor of the fecal sample is 1:4 to 1:128, the T line is clearly visible. When the dilution factor is lower than 1:4 or higher than 1:128, the color development effect is significantly reduced, and the retention phenomenon is obvious when the dilution factor is lower than 1:4. Therefore, the dilution factor of the pretreated fecal sample is determined to be 1:4 to 1:128.

[0120] Example 5: Colloidal Gold Immunochromatographic Detection Method The colloidal gold immunochromatographic detection method provided in this embodiment uses colloidal gold test strips to detect fecal samples. The colloidal gold test strips include sample diluent, antibody diluent, blocking agent, sample pad, absorbent paper, NC membrane and PVC base plate.

[0121] Sample dilution solution: Weigh 0.5 g BSA powder, add 50 mL PBS and 250 μL Tween-20, mix well, and store at 4℃.

[0122] The antibody diluent was 0.5% BSA; the blocking agent was 10% PEG2000; and the sample pad was SB08.

[0123] Weigh 0.05 g of fecal sample and add 1 mL of sample diluent. Stir well and centrifuge at 2000 rpm and 4℃ for 1 min. Take the supernatant from the centrifuged fecal sample, dilute it with the sample diluent, and transfer 195 μL to a 96-well plate. Add 5 μL of probe and incubate for 5 min to obtain the sample solution to be tested.

[0124] Insert the test strip into the sample solution to be tested, and let it stand at room temperature for 10 to 15 minutes until the C line and T line on the test strip are stable. Observe the color development. If both the C line and T line are colored, the result is positive. If the C line is colored but the T line is not colored, the result is negative. If no C line appears, the result is invalid and the test needs to be repeated.

[0125] Optimization was performed to determine the optimal pH value of the gold-labeled antibody for the test strip, with a labeling concentration of 10 μg / mL and coating concentrations of 0.5 mg / mL for the C-line and 1 mg / mL for the T-line antibodies, resulting in the best colorimetric effect. Regarding the selection of assembly materials, a sample pad that would not cause sample retention was chosen. To reduce non-specific adsorption, the materials were pretreated with a buffer solution containing surfactants to improve the specificity and stability of the test strip. This method is low-cost, simple to operate, and suitable for rapid on-site screening of clinical samples.

[0126] Example 6: Performance Testing of Colloidal Gold Immunochromatographic Test Strips 1. Sensitivity test The optimized colloidal gold immunochromatographic assay method from Example 5 was used to detect 1×10⁻⁶ gold per gram of feces by qPCR. 3 ~1×10 8 Positive fecal samples from oocysts (from the same Cryptosporidium microsporidium strain) were tested, and the specific testing was the same as in Example 3.

[0127] The results are as follows Figure 19 As shown, when OPG is 1×10 4 ~1×10 8 At that time, the T-line gradually became more distinct and reached its peak color, indicating that the detection limit of this method corresponds to OPG = 1 × 10⁻⁶. 4 It has high sensitivity.

[0128] 2. Specificity test The optimized colloidal gold immunochromatographic assay method of Example 5 was used to detect positive fecal samples of coccidia, Brasilia brasiliensis, Angiostrongylus cantonensis, Cryptosporidium humanis, and Cryptosporidium microsporidium after pretreatment, respectively. The specific detection was the same as in Example 3.

[0129] The results are as follows Figure 20 The T-line shows color development only in fecal samples positive for Cryptosporidium microsporidium, indicating a positive test result. The test results for other parasites are negative, indicating that this method has no cross-reactivity with other parasites besides Cryptosporidium microsporidium and has good specificity.

[0130] 3. Repeatability test Three test strips prepared from three different batches were randomly selected to test three Cryptosporidium-negative stool samples and three Cryptosporidium-positive stool samples to evaluate the repeatability of the test strips. The results are as follows: Figure 21 As shown, the concordance rate for both positive and negative samples was 100%, indicating good repeatability.

[0131] 4. Stability test The test strips were stored at low temperature (4°C), room temperature (25°C), and high temperature (37°C), respectively. The same Cryptosporidium microsporidium negative and positive fecal samples were tested every month, with two replicates for each sample, to evaluate the stability of the test strips.

[0132] The results are as follows Figure 22 As shown, after 30 days of storage at high temperature, the C line still showed good color development, but the T line showed poor color development and failed to develop after 60 days. However, even after 60 days of storage at low temperature and room temperature, both the C and T lines showed good color development. In summary, the test strip prepared by this invention can be stored for more than two months at low temperature and room temperature, and for one month at high temperature, demonstrating good stability.

[0133] Example 7: Clinical stool sample detection using colloidal gold immunochromatographic test strips The colloidal gold immunochromatographic test strips prepared in Example 5 were used to test 60 bovine fecal samples collected in Yunnan Province, and gold standard nested PCR was also used for detection.

[0134] The results are shown in Table 2. The colloidal gold immunochromatographic test strip detected 47 negative samples and 13 positive samples. Compared with the gold standard nested PCR detection results, the sensitivity of the colloidal gold immunochromatographic detection method for Cryptosporidium CP23 established in this study was 90.9% (10 / 11), the specificity was 93.9% (46 / 49), and the overall concordance rate was 93.3% (56 / 60). The results of some fecal samples detected by the colloidal gold test strip are shown below. Figure 23 As shown.

[0135] Table 2 Comparison of results from colloidal gold immunochromatography and nested PCR in fecal samples

[0136] This invention uses purified anti-CP23 rabbit polyclonal antibody conjugated with colloidal gold to improve the sensitivity and specificity of the test strip. The method achieves a sensitivity of 90.9% and a specificity of 93.9%, which is close to the results of the Crypto+Giardia rapid test kit produced by Biotech (Sabooni et al., 2025). Furthermore, the test strip provided by this invention provides results within 10-15 minutes, reducing false positives. For uncertain samples, multiple tests are required for verification, and further confirmation can be achieved by combining PCR test results.

[0137] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A CP23 monoclonal antibody hybridoma cell line ( Mus musculus hybridoma )44H1-1, characterized in that, The hybridoma cell line 44H1-1 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 19, 2026, with accession number GDMCC No. 68357.

2. A CP23 monoclonal antibody, characterized in that, It was prepared from the hybridoma cell line 44H1-1 as described in claim 1.

3. The method for preparing the CP23 monoclonal antibody according to claim 2, characterized in that, The hybridoma cell line 44H1-1 described in claim 1 was injected intraperitoneally into experimental mice. The ascites fluid of the mice was collected, centrifuged, and the supernatant was purified to obtain monoclonal antibodies.

4. The use of the hybridoma cell line of claim 1 or the CP23 monoclonal antibody of claim 2 in detecting Cryptosporidium microsporidium for non-disease treatment diagnosis purposes or in the preparation of products for rapid detection of Cryptosporidium microsporidium.

5. The application according to claim 4, characterized in that, The product is a test kit or a colloidal gold test strip.

6. A colloidal gold test strip for rapid detection of Cryptosporidium microsporidium, characterized in that, The detection antibody in the test strip is the CP23 monoclonal antibody as described in claim 2.

7. The colloidal gold test strip according to claim 6, characterized in that, The test strip contains a colloidal gold-labeled probe, a detection line, a control line, a sample pad, absorbent paper, an NC film, and a PVC base plate.

8. The colloidal gold test strip according to claim 7, characterized in that, The probe is a colloidal gold-labeled CP23 rabbit polyclonal antibody with a pH of 7-9 and a labeling concentration of 0-200 μg / mL.

9. The colloidal gold test strip according to claim 7, characterized in that, The antibody coating concentration on both the detection line and the control line is 0.25~1 mg / mL.

10. A method for rapid detection of Cryptosporidium microsporidium in fecal samples using the colloidal gold test strip according to any one of claims 6 to 9, characterized in that, After diluting the fecal sample to be tested, add the probe and incubate for 5-10 minutes. Then, insert the test strip into the sample solution and let it stand at room temperature for 10-15 minutes. Once the C and T lines on the test strip have stabilized, observe the color development. If both the C and T lines are visible, the result is positive. If the C line is visible but the T line is not, the result is negative. If no C line appears, the result is invalid and the test must be repeated.

Images