Polypeptides for synthesis of novel tetrasaccharides and genetically modified cells containing genes for the polypeptides

Abstract

The present application relates to a polypeptide for synthesizing oligosaccharide and a genetically modified cell containing the gene of the polypeptide, and belongs to the technical field of enzyme engineering, genetic engineering and cell engineering in the field of biotechnology. The present application provides a derivative peptide having at least 70% and above identity with the polypeptide as shown in SEQ ID NO: 1, which has the activity of synthesizing LNnT. The polypeptide as shown in SEQ ID NO: 1 is a beta-1,4-galactosyltransferase polypeptide, and the microbial source is Helicobacter pylori. The derivative polypeptide is the polypeptide as shown in SEQ ID NO: 1 having at least one of the following mutations: VCDT11-14FVIS, DT22-23RR, AQI37-39FEF, M96L, A120Y, I145K, M154F, A183S, VF202-203LV, L229Y. The present application also provides a method for catalyzing the synthesis of lacto-N-neotetraose (LNnT) using the polypeptide. The technical scheme of the present application has a positive significance for the industrial production of human milk oligosaccharide, and the method is green, efficient and sustainable, which is conducive to the application of industrial large-scale production.

Description

Technical Field

[0001] This invention relates to polypeptides for synthesizing oligosaccharides and gene-modified cells containing the genes of said polypeptides, belonging to the fields of enzyme engineering, gene engineering and cell engineering in the field of biotechnology. Background Technology

[0002] Researchers have discovered that many of the beneficial effects of breast milk are attributed to human milk oligosaccharides (HMOs). Among them, 2-fucosyllactose (2'-FL), lactose-N-trioseII (LNTII), lactose-N-tetraose (LNT), and lactose-N-neotetraose (LNnT) are the main components of HMOs, acting as bifidus factors. Studies have shown that adding HMOs to infant formula made primarily from cow's or goat's milk and feeding it to infants can achieve effects similar to breastfeeding in terms of nutrition and immunity. Therefore, adding physiologically functional HMOs to infant formula, some synthetic milks, dairy products, baby foods, and functional health products or foods for special populations will significantly improve the physical health and quality of life of the corresponding populations.

[0003] Since directly extracting HMOs from natural breast milk is not an ideal approach, researchers have developed several chemical and biosynthetic methods for HMOs. Biosynthetic methods include enzymatic synthesis and microbial fermentation synthesis, and are characterized by safety, lack of pollution, and wide applicability. Chinese patents 202411589612.9, 201810206004.3, and CN201810206004.3 disclose methods for synthesizing LNnT through microbial fermentation using genetically modified *Escherichia coli* or *Bacillus subtilis*. β-1,3 / 1,4-galactosyltransferase is a key enzyme in LNnT synthesis. To achieve efficient LNnT synthesis, it is necessary to improve this enzyme to meet societal demand for LNnT and accelerate the application of HMOs in dairy products, baked goods, beverages, and other food products. Summary of the Invention

[0004] Objective of the invention: To provide a polypeptide with catalytic activity in the synthesis of lactose-N-neotetraose (LNnT) to improve production efficiency.

[0005] Technical solution:

[0006] The first aspect of this application provides polypeptides A1-A10, which are derivative polypeptides of the polypeptide with the amino acid sequence shown in SEQ ID NO:1, having at least 70% or more identity with the polypeptide shown in SEQ ID NO:1, and possessing activity for synthesizing LNnT. The polypeptide shown in SEQ ID NO:1 is a β-1,4-galactosyltransferase polypeptide, and its microbial origin is Helicobacter pylori.

[0007] The polypeptides A1-A10 are modifications or substitutions occurring at at least one site of the polypeptide with the amino acid sequence as shown in SEQ ID NO:1, namely positions 11-14, 22-23, 37-39, 96, 120, 96, 120, 145, 154, 183, 202-203, and 229.

[0008] Preferably, the derived polypeptide is a polypeptide with an amino acid sequence as shown in SEQ ID NO:1 having at least one of the following mutations: VCDT11-14FVIS, DT22-23RR, AQI37-39FEF, M96L, A120Y, I145K, M154F, A183S, VF202-203LV, L229Y.

[0009] Preferably, the specific mutation mode of the polypeptide with the amino acid sequence shown in SEQ ID NO:1 is selected from one of the following combined mutations.

[0010] 1) The amino acid residues at positions 11-14 in the amino acid sequence shown in SEQ ID NO:1 are replaced with FVIS by VCDT to obtain polypeptide A1.

[0011] 2) The amino acid residues at positions 22-23 of polypeptide A1 are replaced by DT with RR and the amino acid residue at position 120 is replaced by A with Y to obtain polypeptide A2.

[0012] 3) The amino acid residues at positions 22-23 of polypeptide A1 are replaced by DT with RR and the amino acid residue at position 183 is replaced by A with S to obtain polypeptide A3.

[0013] 4) The amino acid residues at positions 37-39 of polypeptide A2 are replaced with FEF by replacing AQI to obtain polypeptide A4.

[0014] 5) The amino acid residue at position 96 of polypeptide A3 is replaced by M with L and the amino acid residue at position 154 is replaced by M with F to obtain polypeptide A5.

[0015] 6) The amino acid residue at position 96 of polypeptide A3 is replaced by M with L and the amino acid residue at position 229 is replaced by L with Y to obtain polypeptide A6.

[0016] 7) Replace I with K at position 145 of polypeptide A3 to obtain polypeptide A7.

[0017] 8) The amino acid residues at positions 202-203 of polypeptide A5 are replaced with LV by replacing VF to obtain polypeptide A8.

[0018] 9) The amino acid residue at position 96 of the amino acid sequence shown in SEQ ID NO:1 is replaced by M with L and the amino acid residue at position 183 is replaced by A with S to obtain polypeptide A9.

[0019] 10) The amino acid residues at positions 37-39 of the amino acid sequence shown in SEQ ID NO:1 are replaced with FEF and VF respectively, and the amino acid residues at positions 202-203 are replaced with LV respectively, to obtain polypeptide A10.

[0020] A second aspect of this application provides a method for expressing the polypeptide, comprising the following steps:

[0021] (a) Culture host cells under conditions suitable for expressing the polypeptide;

[0022] Preferably, it further includes: (b) the step of recovering the polypeptide.

[0023] Preferably, in step (a), a recombinant plasmid encoding the aforementioned polypeptide is first constructed and then introduced into a host cell; the host cell includes a wild-type strain isolated from nature, a mutant strain induced by physical and chemical mutagenesis, or an engineered bacterium modified by genetic engineering.

[0024] The host cells include, but are not limited to, natural or genetically modified strains of Escherichia sp., Bacillus sp., Kluyveromyces sp., Pichia sp., Saccharomyces sp., Schizosaccharomyces sp., Rhodosporidium sp., and Yarrowia sp.

[0025] Preferably, the host cell includes, but is not limited to, natural or genetically modified strains such as Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichia pastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides.

[0026] Preferably, the host cell is the genetically engineered Escherichia coli E.coli BL21(DE3).

[0027] Preferably, the host cell is selected from Escherichia coli.

[0028] Host cells are cultured in a nutrient medium suitable for producing the polypeptide using methods known in the art. For example, cells can be cultured by shake flask culture or by small-scale or large-scale fermentation (including continuous fermentation, batch fermentation, feed-feed fermentation, or solid-state fermentation) in a laboratory or industrial fermenter in a suitable medium and under conditions that allow for the expression and / or isolation of the polypeptide. The culture occurs using procedures known in the art in a suitable nutrient medium containing carbon and nitrogen sources and inorganic salts. Suitable media can be purchased commercially or prepared according to publicly available compositions.

[0029] The peptides can be purified and recovered using methods known in the art. For example, peptides can be purified using a variety of procedures known in the art, including but not limited to chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography), electrophoresis (e.g., preparative isoelectric point focusing), differential solubility methods (e.g., ammonium sulfate precipitation), SDS-PAGE, salting out, and combinations thereof for separation or purification. Variants can be recovered from nutrient media using various conventional procedures, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

[0030] In a third aspect of this application, a polynucleotide is provided that encodes any one of the derivative polypeptides A1-A10 as described in the first aspect above.

[0031] The polynucleotides encoding the derived polypeptides A1-A10 can be prepared using recombinant DNA techniques known in the art. These methods include, but are not limited to, cloning, recombination, in vitro synthesis, and in vitro amplification.

[0032] A fourth aspect of this application provides a nucleic acid construct comprising the polynucleotides described in the third aspect above.

[0033] The nucleic acid construct preferably further includes one or more regulatory sequences operatively linked to the polynucleotide, the regulatory sequences being able to guide the production of the polypeptide in a suitable expression host.

[0034] A fifth aspect of this application provides an enzyme comprising one or more of the polypeptides described in the first aspect.

[0035] The sixth aspect of this application provides the use of the derived polypeptides A1-A10 in the synthesis of LNnT.

[0036] The seventh aspect of this application provides a method for preparing LNnT, using one or more of the polypeptides described in the first aspect or the enzymes described in the fifth aspect as catalysts, and using any one or any combination of galactose-1-phosphate and / or lactose and / or galactose as substrates, along with acetylglucosamine and / or carbohydrates bearing acetylglucosamine groups, to synthesize LNnT.

[0037] Preferably, the preparation method uses LNTII and galactose-1-phosphate as substrates.

[0038] Preferably, in the preparation method described above, the polypeptides A1-A10 are selected from crude enzyme solution or purified enzyme solution.

[0039] An eighth aspect of this application provides a gene-modified cell containing a gene for the polypeptide described in the first aspect. The gene-modified cell includes, but has at least 70% or more of the same amino acid sequence as polypeptides A1-A10, and has LNnT synthesis activity.

[0040] The genetically modified cells include, but are not limited to, *Escherichia* sp., *Bacillus* sp., *Kluyveromyces* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp., etc.

[0041] Preferably, the genetically modified cells include, but are not limited to, Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichia pastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides.

[0042] Preferably, the genetically modified cells are selected from Escherichia coli.

[0043] Preferably, the genetically modified cells are selected from Escherichia coli.

[0044] The ninth aspect of this application provides the use of the gene-modified cells described in the eighth aspect in the synthesis of LNnT.

[0045] The application enables the de novo synthesis of LNnT using lactose as a raw material.

[0046] Beneficial effects

[0047] This invention provides a series of polypeptides that have enhanced ability to catalyze the synthesis of LNnT.

[0048] This invention provides the aforementioned polypeptides A1-A10; it also provides a method for synthesizing lactose-N-neotetrasaccharide (LNnT) using the aforementioned polypeptides as a catalyst. The technical solution of this invention has positive significance for the industrial production of human milk oligosaccharides. This method is green, efficient, and sustainable, and is conducive to large-scale industrial production applications. Detailed Implementation

[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; all materials and reagents are commercially available unless otherwise specified.

[0050] The present invention will be further described in detail below through embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. Modifications or substitutions to the details and form of the technical solution without departing from the structural concept and scope of use of the present invention shall fall within the protection scope of the present invention.

[0051] In the following examples, the products obtained from the polypeptide catalytic reaction were analyzed or identified using HPLC, mass spectrometry, and ion chromatography.

[0052] HPLC detection conditions: Column type: Cosmosil Sugar-D amino column (nacalaitesque, INC.), detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 1.0 mL / min, column temperature: 30 ℃, mobile phase: acetonitrile:water = 70:30.

[0053] LC-MS analysis conditions: Column type: Cosmosil Sugar-D amino column (nacalaitesque, INC.), detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 1.0 mL / min, column temperature: 30 ℃, mobile phase: acetonitrile:water = 70:30; H-ESI mode, molecular weight scan range 400–900.

[0054] The ion chromatography analysis conditions were as follows: column: MetroSep Carb2 (4.0 mm × 250 mm), eluent: 140 mM NaOH / 20 mM NaAc, isocratic elution, flow rate: 0.500 mL / min, amperometric detector, column temperature: 40 ℃, injection volume: 20 μL, run time: 50 min.

[0055] The standards for lactose-N-trisaccharide (LNTII), lactose-N-tetrasaccharide (LNT), and lactose-N-neotetrasaccharide (LNnT) were produced by ELICITYL, France.

[0056] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations of the present invention.

[0057] In the following examples, the starting strain for the Kluyveromyces lactis gene-modified cells was K. lactic DSM70799, the starting strain for the Kluyveromyces marxianus gene-modified cells was K. marxianus DMKU3-1042, the starting strain for the Pichia pastoris gene-modified cells was Pichia pastoris GS115, and the starting strain for the Yersinia lipolytica gene-modified cells was Yersinia lipolytica ATCC 20460.

[0058] Example 1. Expression of polypeptide (A0) and polypeptides A1-A10 shown in SEQ ID NO:1 in Escherichia coli.

[0059] A gene synthesis company was commissioned to obtain the genes corresponding to peptides A1-A10 through codon optimization and DNA synthesis. Following the methods outlined in *Molecular Cloning: A Laboratory Manual*, a series of recombinant plasmids, pET32a-AX (pET32a-A1 to pET32aA10), were constructed. The recombinant plasmid was transformed into Escherichia coli BL21(DE3) as follows: Prepared competent Escherichia coli BL21(DE3) cells were thawed on ice for 30 min. 100 μL of competent cells were mixed with 10 μL of pET32aAX recombinant plasmid (concentration 50 ng / μL), and the mixture was heat-shocked in a 42℃ water bath for 45 s. Immediately afterwards, the mixture was cooled on ice for 2 min. 1 mL of fresh LB medium (LB medium: peptone 1.0%, yeast extract 0.5%, NaCl 1.0%, plate with 1.5% agar powder) was added, and the mixture was incubated at 37℃ and 100 rpm for 1 h. Then, 100 μL of the bacterial culture was spread onto an LB plate containing ampicillin (100 μg / mL), and incubated at 37℃ for 12 h. Single colonies were then picked for colony PCR to screen for positive transformants. Furthermore, after culturing the correct transformants, their plasmids were extracted, and PCR amplification, double enzyme digestion, and gene sequencing were used to verify whether the pET32a-AX recombinant plasmid was successfully introduced into E. coli.

[0060] Then, the correct transformants were inoculated into LB liquid medium and cultured on a shaker at 37°C and 200 rpm for 12 h to obtain the seed culture. The seed culture was then inoculated into fresh LB medium at a 1% (v / v) inoculation rate and cultured at 37°C with shaking until the OD 600 reached 0.8. Induction with isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.1 mmol / L was performed at 16°C for 12 h at 200 rpm. After induction, the fermentation broth was centrifuged at 5000 rpm for 30 min at 4°C to collect the cells. The cells were resuspended in 20 mM pH 7.4 PBS buffer and sonicated at a frequency of plus on 5 s / off 5 s for 30 min to lyse the cells. The lysed liquid was centrifuged at 13000 × g at 4°C for 30 min to remove cell debris, and the supernatant was collected.

[0061] Soluble peptides or mutants were purified using nickel column affinity chromatography, as follows: Deionized water was added to the top of the nickel column, followed by natural elution and then elution with 5 volumes of binding buffer. Crude enzyme solution filtered through a 0.45 μm membrane was then loaded onto the column, and the sample was allowed to bind thoroughly to the nickel column at a flow rate of 1.5 mL / min. After the sample dried, impurities were removed by a continuous gradient elution with 5 column volumes of washing buffer. Finally, the target protein was eluted with 5 volumes of elution buffer, and the eluent was collected. SDS-PAGE analysis was then performed to analyze the expression of the target protein. Genetically modified cells showed distinct specific expression bands after induction, with the molecular weight of the bands being consistent with the expected molecular weight of 103 kDa. The obtained proteins were the peptide shown in SEQ ID NO:1 and peptides A1-A10, as detailed in Table 1.

[0062] Table 1. Correspondence between plasmids and polypeptides or polypeptides

[0063] Recombinant plasmid Polypeptide nomenclature PET32a-WT A0 PET32a-A1 A1 PET32a-A2 A2 PET32a-A3 A3 PET32a-A4 A4 PET32a-A5 A5 PET32a-A6 A6 PET32a-A7 A7 PET32a-A8 A8 PET32a-A9 A9 PET32a-A10 A10

[0064] Example 2. Synthesis of LNnT catalyzed by polypeptide (A0) and polypeptides A1-A10 shown in SEQ ID NO:1.

[0065] Specifically, 20 mM galactose-1-phosphate (Gal-1-P), 20 mM lactose-N-trisaccharide (LNTII), 1 mmol / L MgCl2, 2.2 mg / mL peptide (any one of A0, A1-A10), and 100 mM Tri-HCl buffer (pH 7) were mixed and reacted at 37°C for 24 hours. The reaction was then terminated, and the peptide was purified using gel column chromatography. The catalytic reaction solution of the peptide or its mutant was analyzed and identified by HPLC, ion chromatography, and LC-MS.

[0066] The HPLC analysis conditions were as shown above, and the analysis results showed that:

[0067] (1) The peak elution time rt of LNTII standard was 8.79 min, and the peak elution time rt of LNT and LNnT standards was 11.34 min.

[0068] (2) The reaction solutions of peptides A1-A10 all showed strong absorption peaks around 11.34 min, which is consistent with the elution time of LNT and LNnT standards.

[0069] The LC-MS analysis conditions are shown below, and the analysis results are as follows:

[0070] The products of the reaction solution of peptides A1-A10 with HPLC peaks around rt = 11.34 min were analyzed using LC-MS. The molecular weight of LNT+H was 708.2567; the molecular weight of LNT+Na was 730.2393. Mass spectrometry results were retrieved as follows: Compound CID: 440993, Chemical Formula: C 26 H 45 NO 21 Extract Mass: 707.63, the same as the molecular weight of LNT and LNnT.

[0071] The ion chromatography results are shown above.

[0072] (1) The peak elution time of lactose-N-trisaccharide (LNTII) standard was 16.9 min; the peak elution time of lactose-N-neotetrasaccharide (LNnT) standard was 25.7 min; and the peak elution time of lactose-N-tetrasaccharide (LNT) standard was 29.8 min.

[0073] (2) After purification, the reaction solution of peptides A1-A10 showed a strong absorption peak around 25.7 min, which was consistent with the peak time of lactose-N-neotetrasaccharide (LNnT) standard, indicating that the reaction synthesized lactose-N-neotetrasaccharide (LNnT); the reaction solution did not show an absorption peak around 29.8 min, indicating that the reaction did not synthesize lactose-N-tetrasaccharide (LNT).

[0074] in conclusion

[0075] The combined results of HPLC, ion chromatography, and LC-MS analysis showed that peptide A1-A10 catalyzed the synthesis of lactose-N-neotetrasaccharide (LNnT) from the substrates galactose-1-phosphate (Gal-1-P) and lactose-N-trisaccharide (LNTⅡ), but did not synthesize lactose-N-tetrasaccharide (LNT). The concentration of LNnT in the reaction solution is recorded in Table 2.

[0076] Table 2. Study on the catalytic synthesis of LNnT from the polypeptide shown in SEQ ID NO:1 and polypeptides A1-A10.

[0077] Polypeptide Synthesized LNnT concentration, mg / mL SEQ ID NO:1(A0) 1.79 A1 3.6 A2 4.66 A3 5.46 A4 5.28 A5 6.07 A6 7.91 A7 8.53 A8 10.73 A9 9.87 A10 11.18

[0078] Table 2 data shows that peptides A1-A10 have high catalytic activity for the synthesis of LNnT.

[0079] Example 3. Construction of Kluyveromyces lactis gene-modified cells containing any one of the genes in polypeptides A0-A10.

[0080] (1) Construct a lactate-Kluyvedet modified cell expression cassette.

[0081] 1) Construction of the KL-ΔLAC4 knockout box.

[0082] Referring to the applicant's prior patent: 202211453172.5, invention title: recombinant yeast and its application, constructing a KL-ΔLAC4 knockout box.

[0083] 2) Construction of expression boxes from KL-ΔLAC4::A0, KL-ΔLAC4::A1 to KL-ΔLAC4::A10.

[0084] Using the Kluyveromyces lactis genome as a template, the upstream and downstream homologous arm sequences lac4-up and lac4-do, the promoter sequence tef1, and the terminator sequence adh1 were amplified. The target gene sequences were amplified using the synthesized sequences A0 to A10 as templates. The G418+loxp sequence was amplified using the expression cassette KL-ΔLAC4 as a template. The lac4-up, tef1, any one of A0-A10, adh1, G418+loxp, and lac4-do were fused using a two-fragment sequential fusion PCR method. Finally, using primers lac4-upF and lac4-doR as primers (Table 3), the expression cassettes KL-ΔLAC4::A0, KL-ΔLAC4::A1 to KL-ΔLAC4::A10 were amplified by PCR using the fusion PCR system as a template.

[0085] Table 3

[0086] Primer Sequence lac4-upF TTCGGACTGCGATTATTCGTGA lac4-doR TCTGCCGTATCTTTTAACGTCACA

[0087] 3) Construction of the KL-ΔXK::LgtA expression box.

[0088] Using the Kluyveromyces lactis genome as a template, the upstream and downstream homologous arm sequences xk-up and xk-do of the xylooligoskinase XKb coding region, the promoter sequence pgk1, and the terminator sequence tdh3 were amplified. Using the synthesized lgtA sequence as a template, the target gene sequence was amplified. Using an existing plasmid in the laboratory as a template, the G418+loxp sequence was amplified. Through a sequential fusion PCR method, xyl1 up, pgk1, lgtA, tdh3, G418+loxp, and xyl1-do were fused. Finally, using primers xK-upF and xK-doR as primers (Table 4), and using the fusion PCR system as a template, the lgtA expression cassette KL-ΔXK:LgtA was amplified by PCR.

[0089] Table 4

[0090] Primer Sequence xK-upF GCACTAATAATTACCGAACTATAGAC xK-doR GATGATGGCTTCGTTCTTTGATG

[0091] (2) Transformation of recombinant expression cassettes and verification of recombinant strains.

[0092] The expression cassettes constructed in (1) above were transformed into the starting strain Kluyveromyces lactis K. lacticDSM70799 cells. The specific method is as follows:

[0093] 1) First, prepare competent yeast cells: Streak a small amount of frozen yeast strain onto a plate of solid culture medium and incubate upside down at 30°C for 2 days. Pick a single yeast colony and place it in 50 mL of liquid culture medium, incubate at 30°C and 220 rpm until OD reaches 100%. 600 The pH should be between 0.8 and 1.5. Collect the bacterial cells, wash with 25 mL of sterile water, centrifuge at 1500 × g for 10 min at room temperature, and discard the supernatant. Add 1 mL of 100 mM lithium chloride buffer, resuspend the precipitate, centrifuge at 12000 rpm for 30 s, and discard the supernatant. Add 400 μL of 100 mM lithium chloride buffer again, resuspend the precipitate, and obtain competent yeast cells. Aliquot into 50 μL tubes for transformation.

[0094] Meanwhile, boil 1 mL of salmon sperm DNA for 5 minutes, then quickly place it on an ice bath to prepare single-stranded DNA.

[0095] 2) Transformation: Centrifuge the prepared competent yeast cells and remove residual lithium chloride solution using Tips. For each transformation, add the following in order: 50% PEG3350 (240 μL); 1M LiCl (36 μL); 2 mg / mL single-stranded Salmon sperm DNA (25 μL); 5–10 μg / 50 μL plasmid DNA aqueous solution (50 μL), vortex vigorously until the precipitated cells are completely and evenly distributed; incubate at 30°C for 30 min; heat shock at 42°C for 20–25 min; centrifuge at 8000 rpm for 10 min, and collect the yeast cells; then, resuspend the yeast in 500 μL of liquid medium and incubate at 30°C on a shaker; after 1–4 h, take 25–100 μL of the bacterial suspension and spread it on selective medium plates, and incubate upside down at 30°C.

[0096] 3) Verification: The correspondence between recombinant strains and their genotypes is shown in Table 5. To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, the strain was considered a false positive. A total of 11 strains, KL-A0, KL-A1 to KL-A10, were obtained.

[0097] Table 5. Genetically modified cells of Kluyveromyces lactis and their genotypes

[0098] Microbial cell Genotype K. lactis DSM70799 wt KL-A0 ΔLAC4::A0; ΔXK::LgtA KL-A1 ΔLAC4::A1; ΔXK::LgtA KL-A2 ΔLAC4::A2; ΔXK::LgtA KL-A3 ΔLAC4::A3; ΔXK::LgtA KL-A4 ΔLAC4::A4; ΔXK::LgtA KL-A5 ΔLAC4::A5; ΔXK::LgtA KL-A6 ΔLAC4::A6; ΔXK::LgtA KL-A7 ΔLAC4::A7; ΔXK::LgtA KL-A8 ΔLAC4::A8; ΔXK::LgtA KL-A9 ΔLAC4::A9; ΔXK::LgtA KL-A10 ΔLAC4::A10; ΔXK::LgtA

[0099] Encryption markers (amino acid sequences as shown in SEQ ID NO:2 and nucleotide sequences as shown in SEQ ID NO:3) were introduced into the recombinant strains described in Table 5 to obtain strains KL-A0-J, KL-A1-J to KL-A10-J, respectively.

[0100] Validation of marker genes: To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strain.

[0101] The genome was amplified by PCR using the corresponding knockout or expression cassette primers. If a unique band matching the size of the knockout or expression cassette was obtained after PCR amplification, the strain was considered correct; otherwise, it was considered a false positive. For tag verification, PCR amplification was performed using primers, followed by sequencing for further verification; otherwise, the strain was considered a false positive.

[0102] Example 4. Construction of gene-modified Max Kluyveromyces cells containing any one of the genes from polypeptides A0 to A10.

[0103] (1) Construct the Max Kluwer modified cell expression cassette.

[0104] 1) Construction of the KM-ΔLAC4 knockout box.

[0105] Referring to the applicant's prior patent: 202211453172.5, invention title: Recombinant yeast and its application in constructing a KM-ΔLAC4 knockout box.

[0106] 2) Construction of expression boxes from KM-ΔLAC4::A0 and KM-ΔLAC4::A1 to KM-ΔLAC4::A10.

[0107] Using the *Kluyveromyces martensii* genome as a template, the upstream and downstream homologous arm sequences *lac4-up* and *lac4-do*, the promoter sequence *tef1*, and the terminator sequence *adh1* were amplified. The target gene sequence was amplified using the synthesized A0 and A1 to A10 sequences as templates, respectively. The G418+loxp sequence was amplified using the expression cassette KM-ΔLAC4 as a template. Through sequential fusion PCR, any one of *lac4-up*, *tef1*, A0-A10, *adh1*, G418+loxp, and *lac4-do* was fused. Finally, using primers *lac4-upF* and *lac4-doR* (Table 6) as primers, and the fusion PCR system as a template, the expression cassettes KM-ΔLAC4::A0 and KM-ΔLAC4::A1 to KM-ΔLAC4::A10 were amplified by PCR.

[0108] Table 6

[0109] Primer Sequence lac4-upF TGAGGAATCAAGGTAGGAATTTAGTCA lac4-doR AGAACCATTAGAACCTTTTTCAACAC

[0110] 3) Construction of the KM-ΔXK::LgtA expression box.

[0111] Using the genome of *Kluyveromyces martensii* as a template, the upstream and downstream homologous arm sequences xk-up and xk-do of the xylooligoskinase XKb coding region, the promoter sequence pgk1, and the terminator sequence tdh3 were amplified. Using the synthesized lgtA sequence as a template, the target gene sequence was amplified. Using an existing plasmid in the laboratory as a template, the G418+loxp sequence was amplified. Through a sequential fusion PCR method, xyl1 up, pgk1, lgtA, tdh3, G418+loxp, and xyl1-do were fused. Finally, using primers xK-upF and xK-doR as primers (Table 7), and using the fusion PCR system as a template, the lgtA expression cassette KM-ΔXK:LgtA was amplified by PCR.

[0112] Table 7

[0113] Primer Sequence xk-upF GCCCATTTAAATCGTATAAGCTT xk-doR AATGCCCATTTCCCATTCATTA

[0114] (2) Transformation of recombinant plasmids and verification of recombinant strains:

[0115] The expression cassette constructed in (1) above was transformed into the starting strain Kluyveromyces marxianus DMKU3-1042 cells. The specific method is as described in Part (2) of Example 3, Transformation of Recombinant Expression Cassette and Verification of Recombinant Strains.

[0116] The correspondence between recombinant strains and their genotypes is shown in Table 8. To verify the correctness of the strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, it was considered a false positive. A total of 11 recombinant strains, from KM-A0 to KM-A10, were obtained.

[0117] Table 8. Genetically modified cells of *Kluyveromyces martensii* and their genotypes

[0118] Strain Genotype K. marxianus DMKU3-1042 wt KM-A0 ΔLAC4::A0; ΔXK::LgtA KM-A1 ΔLAC4::A1; ΔXK::LgtA KM-A2 ΔLAC4::A2; ΔXK::LgtA KM-A3 ΔLAC4::A3; ΔXK::LgtA KM-A4 ΔLAC4::A4; ΔXK::LgtA KM-A5 ΔLAC4::A5; ΔXK::LgtA KM-A6 ΔLAC4::A6; ΔXK::LgtA KM-A7 ΔLAC4::A7; ΔXK::LgtA KM-A8 ΔLAC4::A8; ΔXK::LgtA KM-A9 ΔLAC4::A9; ΔXK::LgtA KM-A10 ΔLAC4::A10; ΔXK::LgtA

[0119] Encryption markers (amino acid sequences as shown in SEQ ID NO:2 and nucleotide sequences as shown in SEQ ID NO:3) were introduced into the recombinant strains described in Table 8 to obtain strains KM-A0-J, KM-A1-J to KM-A10-J, respectively.

[0120] Validation of marker genes: Performed according to the method described in Example 3.

[0121] Example 5. Preparation of Pichia pastoris containing any one of the genes from polypeptides A0-A10

[0122] (1) Construct a Pichia pastoris modified cell expression cassette.

[0123] 1) Construction of expression boxes from PS-ΔXR::A0 and PS-ΔXR::A1 to PS-ΔXR::A10.

[0124] Using the Pichia pastoris genome as a template, the upstream and downstream homologous arm sequences XR-up and XR-do, the promoter sequence tef1, and the terminator sequence adh1 were amplified. The target gene sequences were amplified using the synthesized A0, A1 to A10 sequences as templates, respectively. The G418+loxp sequence was amplified using the expression cassette KL-ΔLAC4 as a template. The XR-up, tef1, any one of A0-A10, adh1, G418+loxp, and XR-do were fused by successive fusion PCR of the two fragments. Finally, using primers XR-upF and XR-doR as primers (Table 9), the expression cassettes PS-ΔXR::A0 and PS-ΔXR::A1 to PS-ΔXR::A10 were amplified by PCR using the fusion PCR system as a template.

[0125] Table 9

[0126] Primer Sequence XR-upF ACCAATACGGCGTACCTTCCAGGGCTGCTG XR-doR TGAACGACAAGTAGACACCACCAATCAGTCT

[0127] 2) Construction of the PS-ΔXK::LgtA-Lac12 expression box.

[0128] Using the Pichia pastoris genome as a template, the upstream and downstream homologous arm sequences xk-up and xk-do of the xylooligoskinase XKb coding region, the promoter sequence pgk1, and the terminator sequence tdh3 were amplified. Using the Kluyveromyces lactis genome and the synthesized lgtA sequence as templates, the target gene sequence was amplified. Using an existing plasmid in the laboratory as a template, the G418+loxp sequence was amplified. Through a two-fragment successive fusion PCR method, xyl1 up, pgk1, lgtA-Lac12, tdh3, G418+loxp, and xyl1-do were fused. Finally, using primers xK-upF and xK-doR as primers (Table 10), and using the fusion PCR system as a template, the expression cassette PS-ΔXK:LgtA-Lac12 was amplified by PCR.

[0129] Table 10

[0130] primer sequence xk-upF ACTCTATTAAAATTGAACAATGGTC xk-doR AAGTCCAGTAAACCAGAGCGTTTGT

[0131] (2) Transformation of recombinant plasmids and verification of recombinant strains:

[0132] The expression cassette constructed in (1) above was transformed into the starting strain Pichia pastoris GS115 cells. The specific method is as described in Part (2) of Example 3, Transformation of Recombinant Expression Cassette and Verification of Recombinant Strains.

[0133] The correspondence between recombinant strains and their genotypes is shown in Table 11. To verify the correctness of the strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, it was considered a false positive. A total of 11 recombinant strains, from PS-A0 to PS-A10, were obtained.

[0134] Table 11. Genetically modified cells of Pichia pastoris and their genotypes

[0135]

[0136]

[0137] Encryption markers (amino acid sequences as shown in SEQ ID NO:2 and nucleotide sequences as shown in SEQ ID NO:3) were introduced into the recombinant strains described in Table 11 to obtain strains PS-A0-J, PS-A1-J to PS-A10-J, respectively.

[0138] Validation of marker genes: Performed according to the method described in Example 3.

[0139] Example 6. Preparation of gene-modified *Yarrowia lipolytica* cells containing any one of the genes from polypeptides A0-A10

[0140] (1) Constructing the Yeast Expression Frame of Yeast Lipidolysis.

[0141] 1) Construction of expression boxes from YL-ΔLip7::A0, YL-ΔLip7::A1 to YL-ΔLip7::A10.

[0142] Using the *Yersinia lipophila* ATCC 20460 genome as a template, the upstream and downstream homologous arm sequences lip7-up and lip7-do, the promoter sequence FBAp, and the terminator sequence pex16t were amplified. The target gene sequence was amplified using synthesized A0 to A10 sequences as templates. The URA3 sequence was amplified using the synthesized URA3 gene as a template, and the promoter EXPp and terminator XPRt were amplified using the *Yersinia lipophila* Polf genome. Through sequential fusion PCR, FBA1p, any one of A0-A10, pex16t, EXPp, URA3, and XPRt were fused to obtain the A0 / A9-URA3 expression cassette. Using the *Yersinia lipophila* genome as a template, the promoter sequence TEF1p and the terminator sequence pex16t were amplified. The target gene sequence lgtA was amplified using synthesized lgtA. The target gene sequence lgtA was amplified using synthesized Lac12 as a template. Lac12 was obtained; using the Yersinia lipolyticis genome as a template, the promoter PGKp and terminator pex20t were amplified; simultaneously, using the Yersinia lipolyticis genome, the promoter EXPp and terminator XPRt were amplified; TEF1p, lgtA, pex16t, PGKp, Lac12 and pex20t were fused to obtain the LgtA-Lac12 linear expression cassette. Finally, any one of A0 / A10-URA3 was fused with lip7-up, LgtA-Lac12, and lip7-do, respectively. Using lip7-uF and lip7-dR as primers (Table 12), and using the fusion PCR system as a template, the expression cassettes YL-ΔLip7::A0-LgtA-Lac12, YL-ΔLip7::A1-LgtA-Lac12 and YL-ΔLip7::A10-LgtA-Lac12 were amplified by PCR.

[0143] Table 12

[0144] primer sequence Lip7-uF CAGTTCGAGTCAAGCTTGAT Lip7-dR TGGAGTTCTGGGACATCATATT

[0145] (2) Transformation of recombinant plasmids and verification of recombinant strains:

[0146] The expression cassette constructed in (1) above was transformed into Yersinia lipophila ATCC 20460 cells. The specific method is as described in Part (2) of Example 3, Transformation of Recombinant Expression Cassette and Verification of Recombinant Strains.

[0147] The correspondence between recombinant strains and their genotypes is shown in Table 13. To verify the correctness of the strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, it was considered a false positive. A total of 11 recombinant strains, from PS-A0 to PS-A10, were obtained.

[0148] Table 13. Genetically modified cells of *Yersinia lipolytica* and their genotypes

[0149] strain genotype Yarrowia lipolytica ATCC 20460 wt YL-A0 ΔLip7::A0-LgtA-Lac12 YL-A1 ΔLip7::A1-:LgtA-Lac12 YL-A2 ΔLip7::A2-LgtA-Lac12 YL-A3 ΔLip7::A3-LgtA-Lac12 YL-A4 ΔLip7::A4-LgtA-Lac12 YL-A5 ΔLip7::A5-LgtA-Lac12 YL-A6 ΔLip7::A6-LgtA-Lac12 YL-A7 ΔLip7::A7-LgtA-Lac12 YL-A8 ΔLip7::A8-::LgtA-Lac12 YL-A9 ΔLip7::A9-LgtA-Lac12 YL-A10 ΔLip7::A10-LgtA-Lac12

[0150] The recombinant strains described in Table 13 were introduced with marker genes (amino acid sequences as shown in SEQ ID NO:2, nucleotide sequences as shown in SEQ ID NO:3) to obtain strains YL-A0-J, YL-A1-J to YL-A10-J, respectively.

[0151] Validation of marker genes: Performed according to the method described in Example 3.

[0152] Example 7. Study on the synthesis of LNnT by gene-modified cells through fermentation as described in Examples 3-6.

[0153] Yeast was cultured using glucose as the carbon source. Gene-modified cells obtained in Examples 3-6 were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then picked and inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (out of growth) was reached. 600 =1, add lactose to a final concentration of 10 g / L and glucose of 3% (w / v), and culture at 30℃ with shaking at 200 rpm for a total fermentation time of 72 h. After 72 h of fermentation, take a sample, boil for 10 min, centrifuge to obtain the final fermentation product of yeast, and detect the LNnT content in the supernatant by HPLC. The results are recorded in Table 14-17.

[0154] Table 14. Study on LNnT synthesis in cells modified with the lactate Kluyveromycin gene obtained in Example 3.

[0155]

[0156]

[0157] Table 15. Study on LNnT synthesis in Max Kluwer gene-modified cells obtained in Example 4.

[0158]

[0159] Table 16. Study on LNnT synthesis in Pichia pastoris gene-modified cells obtained in Example 5.

[0160]

[0161] Table 17. Study on LNnT synthesis in gene-modified cells of Yersinia lipophila obtained in Example 6.

[0162]

[0163] Table 14-17 Data Explanation: The introduction of marker genes does not affect the yield of LNnT synthesized by the gene-modified cells obtained in Examples 3-6.

[0164] Example 8. Kluyveromyces kluyveromyces KL-A8-J, KL-A10-J, KM-A8-J, KM-A10-J, Pichia pastoris PS-A8-J, PS-A10-J, and Yersinia lipolytica YL-A8-J, YL-A10-J were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then picked and inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of each colony was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (dose elapsed). 600 =1, 2% of each yeast extract was inoculated into 1L of YPD medium (10g / L yeast extract, 20g / L peptone, 20g / L glucose) in a 3L fermenter. After 6-7 hours of cultivation, glucose (50% mother liquor concentration) was added at a flow rate of 8mL / h. Simultaneously, lactose (40% mother liquor concentration) was added, maintaining a final lactose concentration of 15g / L. The total fermentation time was 72 hours. After 72 hours of fermentation, the fermentation broth was centrifuged, and the supernatant and precipitate were collected separately. The precipitate was homogenized using a high-pressure homogenizer, and the protein was removed by boiling and centrifugation. The supernatants were combined to obtain the final yeast fermentation product. The LNnT and LNnT content in the supernatant was measured, and the results are recorded in Table 18.

[0165] Table 18. Study on LNnT synthesis by genetically modified yeast strains

[0166]

[0167]

[0168] While the invention has been described in considerable detail by way of illustration and example for purposes of clarity, it will be apparent to those skilled in the art that any equivalent aspects or modifications may be made. Therefore, this specification and the embodiments should not be construed as limiting the scope of the invention.

Claims

1. A polypeptide, characterized in that, The polypeptide with the amino acid sequence shown in SEQ ID NO:1 has at least one of the following mutations: VCDT11-14FVIS, DT22-23RR, AQI37-39FEF, M96L, A120Y, I145K, M154F, A183S, VF202-203LV, L229Y. Preferably, the specific mutation mode of the polypeptide with the amino acid sequence shown in SEQ ID NO:1 is selected from one of the following combined mutations. 1) The amino acid residues at positions 11-14 of the amino acid sequence shown in SEQ ID NO:1 are replaced with FVIS by VCDT to obtain polypeptide A1. 2) Replacing amino acid residues 22-23 of polypeptide A1 with DT and RR, and replacing amino acid residue A with Y at position 120, yields polypeptide A2. 3) The amino acid residues at positions 22-23 of polypeptide A1 are replaced by DT with RR, and the amino acid residue at position 183 is replaced by A with S, to obtain polypeptide A3. 4) The amino acid residues at positions 37-39 of polypeptide A2 are replaced with FEF by replacing AQI to obtain polypeptide A4. 5) Replacing amino acid residue M at position 96 of polypeptide A3 with L and amino acid residue M at position 154 with F yields polypeptide A5. 6) Replacing amino acid residue M at position 96 of polypeptide A3 with L and amino acid residue L at position 229 with Y yields polypeptide A6. 7) Replacing amino acid residue I with K at position 145 of polypeptide A3 yields polypeptide A7. 8) The amino acid residues at positions 202-203 of polypeptide A5 are replaced with LV by replacing VF to obtain polypeptide A8. 9) The amino acid residue at position 96 of the amino acid sequence shown in SEQ ID NO:1 is replaced by M with L and the amino acid residue at position 183 is replaced by A with S, yielding polypeptide A9. 10) The amino acid residues at positions 37-39 of the amino acid sequence shown in SEQ ID NO:1 are replaced with FEF and VF respectively, and the amino acid residues at positions 202-203 are replaced with LV respectively, to obtain polypeptide A10.

2. The method for expressing the polypeptide according to claim 1, comprising the following steps: (a) Culture host cells under conditions suitable for expressing the polypeptide; Preferred options also include: (b) The step of recovering the polypeptide.

3. The method for expressing the polypeptide as described in claim 2, characterized in that, The host cells include, but are not limited to, natural or genetically modified strains of Escherichia sp., Bacillus sp., Kluyveromyces sp., Pichia sp., Saccharomyces sp., Schizosaccharomyces sp., Rhodosporidium sp., and Yarrowia sp. Preferably, the host cells include, but are not limited to, natural or genetically modified strains such as Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichia pastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides. Preferably, the host cell is the genetically engineered Escherichia coli E.coli BL21(DE3). Preferably, the host cell is selected from Escherichia coli.

4. A polynucleotide encoding any one of the polypeptides A1-A10 of claim 1.

5. A nucleic acid construct comprising the polynucleotide of claim 3. The nucleic acid construct preferably further includes one or more regulatory sequences operatively linked to the polynucleotide, the regulatory sequences being able to guide the production of the polypeptide in a suitable expression host.

6. An enzyme preparation comprising one or more of the polypeptides of claim 1.

7. A gene-modified cell, characterized in that, A heterologous nucleic acid sequence containing any one of the polypeptides described in claim 1.

8. The gene-modified cell of claim 7, characterized in that, The genetically modified cells include, but are not limited to, *Escherichia* sp., *Bacillus* sp., *Kluyveromycess* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp., etc. Preferably, the genetically modified cells include, but are not limited to, Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichia pastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides. Preferably, the genetically modified cells are selected from Escherichia coli.

9. The use of the polypeptide of claim 1, the enzyme of claim 6, or the gene-modified cells of any one of claims 1-8 in the synthesis of lactose-N-neotetrasaccharides.

10. A method for preparing lactose-N-neotetrasaccharide, characterized in that, The reaction system contains any one or more of the derived polypeptides of claim 1, or any one or more of the host cells of claim 3, or any one or more of the enzymes of claim 6, or any one or more of the gene-modified cells of any one of claims 7-8. Preferably, in the preparation method, when the reaction system contains any of the gene-modified cells described in any one of claims 7-8, the culture medium contains lactose, sucrose, glycerol, glucose, fructose, or any combination thereof. Preferably, in the preparation method, when the reaction system contains one or more of the derived polypeptides of claim 1, or one or more of the host cells of claim 3, or one or more of the enzymes of claim 6, the substrate is selected from galactose-1-phosphate and lactose-N-triose (Lacto-N-triose II, LNTII).

Images