Polypeptides that synthesize tetrasaccharides and gene-modified cells containing the gene of said polypeptide.

Abstract

This invention relates to polypeptides for synthesizing oligosaccharides and gene-modified cells containing the genes of said polypeptides, belonging to the fields of enzyme engineering, genetic engineering, and cell engineering in the field of biotechnology. This application provides a derivative polypeptide of the polypeptide with the amino acid sequence shown in SEQ ID NO:1, which has at least 70% or more identity with the polypeptide shown in SEQ ID NO:1 and has activity for synthesizing LNTs. The polypeptide shown in SEQ ID NO:1 is a galactosyltransferase polypeptide, its microbial source being *Chromobacterium violaceum*, WP_048405302.1. Preferably, the derived peptide is a polypeptide with the amino acid sequence shown in SEQ ID NO:1 having at least one of the following mutations: M1MDTIM, F107L, IL115-116VV, F146L, YGS172-174FSA, and AA243-244II. This application also provides a method for synthesizing lactose-N-tetrasaccharide (LNT) using said polypeptide as a catalyst. The technical solution of this invention has positive significance for the industrial production of human milk oligosaccharides. This method is green, efficient, and sustainable, and is conducive to large-scale industrial production.

Description

[0001] Cross-references to related applications

[0002] This application claims priority to Chinese Patent Application No. CN202510546686.2, filed on April 27, 2025, entitled "Synthetic tetrasaccharide polypeptide and gene-modified cell containing said polypeptide gene", the entire contents of which are incorporated herein by reference and constitute a part of this application for all purposes. Technical Field

[0003] This invention relates to polypeptides for synthesizing oligosaccharides and their expression in microorganisms, belonging to the fields of enzyme engineering, genetic engineering, and cell engineering in the field of biotechnology. Background Technology

[0004] Researchers have discovered that many of the beneficial effects of breast milk are attributed to human milk oligosaccharides (HMOs). Among them, 2'-fucosylated lactose (2'-FL), lactose-N-triose II (LNTII), lactose-N-tetraose (LNT), and lactose-N-neotetraose (LNnT) are the main components of HMOs, acting as bifidus factors. Studies have shown that adding HMOs to infant formula made primarily from cow's or goat's milk and feeding it to infants can achieve effects similar to breastfeeding in terms of nutrition and immunity. Therefore, adding physiologically functional HMOs to infant formula, some synthetic milks, dairy products, baby foods, and functional health products or foods for special populations will significantly improve the physical fitness and quality of life of the corresponding populations.

[0005] Since directly extracting HMOs from natural breast milk is not an ideal approach, researchers have developed several chemical and biosynthetic methods for HMOs. Biosynthetic methods include enzymatic synthesis and microbial fermentation synthesis, and are characterized by safety, lack of pollution, and wide applicability. Chinese patents 202311675639.5, 202311005666.1, 201680052611.8, 202180010201.8, and 202180010202.2 disclose methods for synthesizing LNTs through fermentation using genetically modified *E. coli* and other microorganisms. β-1,3 / 1,4-galactosyltransferase is a key enzyme in LNT synthesis; to achieve efficient LNT synthesis, it is necessary to improve it to meet public demand for LNTs and accelerate the application of HMOs in dairy products, baked goods, beverages, and other food products. Summary of the Invention

[0006] Objective of the invention: To provide a polypeptide with catalytic activity in the synthesis of lactose-N-tetraose (LNT) to improve production efficiency.

[0007] Technical solution:

[0008] The first aspect of this application is a derivative polypeptide of the polypeptide with the amino acid sequence shown in SEQ ID NO:1, which has at least 70% or more identity with the polypeptide shown in SEQ ID NO:1 and has LNT synthesis activity. The polypeptide shown in SEQ ID NO:1 is a galactosyltransferase polypeptide, and its microbial source is Chromobacterium violaceum (WP_048405302.1).

[0009] Preferably, the derived polypeptide is a polypeptide with the amino acid sequence shown in SEQ ID NO:1 having at least one of the following mutations:

[0010] 1) Replace the first amino acid residue in the amino acid sequence shown in SEQ ID NO:1 with MDTIM to obtain polypeptide B1.

[0011] 2) The amino acid residue at position 111 of polypeptide B1 is replaced with L by replacing F, resulting in polypeptide B2.

[0012] 3) The amino acid residues at positions 119-120 of polypeptide B1 are replaced with VV by IL to obtain polypeptide B3.

[0013] 4) The amino acid residues at positions 247-248 of polypeptide B1 are replaced with amino acid II to obtain polypeptide B4.

[0014] 5) The amino acid residue at position 150 of polypeptide B3 is replaced with L by replacing F to obtain polypeptide B5.

[0015] 6) The amino acid residues at positions 119-120 of polypeptide B4 are replaced with VV by IL to obtain polypeptide B6.

[0016] 7) The amino acid residue at position 150 of polypeptide B2 is replaced with L by replacing F and the amino acid residues at positions 176-178 are replaced with FSA by replacing YGS to obtain polypeptide B7.

[0017] 8) The amino acid residues at positions 119-120 of polypeptide B3 are replaced with IL to VV and the amino acid residues at positions 247-248 are replaced with AA to II, to obtain polypeptide B8.

[0018] 9) The amino acid residues at positions 243-244 in the amino acid sequence shown in SEQ ID NO:1 are replaced with II by replacing AA to obtain polypeptide B9.

[0019] A second aspect of this application provides a method for expressing the polypeptide, comprising the following steps:

[0020] (a) Culture host cells under conditions suitable for expressing the polypeptide;

[0021] Preferably, it further includes: (b) the step of recovering the polypeptide.

[0022] Preferably, in step (a), a recombinant plasmid encoding the aforementioned polypeptide is first constructed and then introduced into a host cell; the host cell includes a wild-type strain isolated from nature, a mutant strain induced by physical and chemical mutagenesis, or an engineered bacterium modified by genetic engineering.

[0023] Preferably, the host cells include, but are not limited to, Escherichia sp., Bacillus sp., Kluyveromyces sp., Pichia sp., Saccharomyces sp., Schizosaccharomyces sp., Rhodosporidium sp., and Yarrowia sp.

[0024] More preferably, the host cell includes, but is not limited to, natural or genetically modified strains such as Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichiapastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides.

[0025] Preferably, the host cell is selected from Escherichia coli or its genetically modified strain.

[0026] More preferably, the host cell is Escherichia coli BL21(DE3) or a genetically modified strain thereof.

[0027] Host cells are cultured in a nutrient medium suitable for producing the polypeptide using methods known in the art. For example, cells can be cultured by shake flask culture or by small-scale or large-scale fermentation (including continuous fermentation, batch fermentation, feed-feed fermentation, or solid-state fermentation) in a laboratory or industrial fermenter in a suitable medium and under conditions that allow for the expression and / or isolation of the polypeptide. The culture occurs using procedures known in the art in a suitable nutrient medium containing carbon and nitrogen sources and inorganic salts. Suitable media can be purchased commercially or prepared according to publicly available compositions.

[0028] The peptides can be purified and recovered using methods known in the art. For example, peptides can be purified using a variety of procedures known in the art, including but not limited to chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography), electrophoresis (e.g., preparative isoelectric point focusing), differential solubility methods (e.g., ammonium sulfate precipitation), SDS-PAGE, salting out, and combinations thereof for separation or purification. Variants can be recovered from nutrient media using various conventional procedures, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

[0029] In a third aspect of this application, a polynucleotide is provided that encodes any one of the derivative polypeptides B1-B9 as described in the first aspect above.

[0030] The polynucleotides encoding the derived polypeptides B1-B9 can be prepared using recombinant DNA techniques known in the art. These methods include, but are not limited to, cloning, recombination, in vitro synthesis, and in vitro amplification.

[0031] A fourth aspect of this application provides a nucleic acid construct comprising the polynucleotides described in the third aspect above.

[0032] The nucleic acid construct preferably further includes one or more regulatory sequences operatively linked to the polynucleotide, the regulatory sequences being able to guide the production of the polypeptide in a suitable expression host.

[0033] A fifth aspect of this application provides an enzyme comprising one or more of the polypeptides described in the first aspect.

[0034] The sixth aspect of this application provides the application of the derived polypeptides B1-B9 in the synthesis of LNTs.

[0035] The seventh aspect of this application provides a method for preparing LNTs, wherein the method uses one or more of the polypeptides described in the first aspect or the enzymes described in the fifth aspect as catalysts, and uses any one or any combination of galactose-1-phosphate and / or lactose and / or galactose as substrates with acetylglucosamine and / or carbohydrates bearing acetylglucosamine groups to synthesize LNTs.

[0036] Preferably, in the preparation method, the polypeptides B1-B9 are selected from crude enzyme solution or purified enzyme solution.

[0037] More preferably, in the method for preparing LNT, the reaction substrate is galactose-1-phosphate and lactose-N-triose (Lacto-N-triose II, LNTII).

[0038] The eighth aspect of this application provides a genetically modified cell containing a heterologous nucleic acid sequence of a polypeptide having at least 70% or more of the same amino acid sequence as polypeptides B1-B9 as described in the first aspect, and having a polypeptide with LNT synthesis activity.

[0039] Preferably, the gene-modified cells contain heterologous nucleic acid sequences of the polypeptides B1-B9 described in the first aspect.

[0040] The genetically modified cells include, but are not limited to, *Escherichia* sp., *Bacillus* sp., *Kluyveromyces* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp., etc.

[0041] Preferably, the genetically modified cells include, but are not limited to, Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichiapastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides.

[0042] Preferably, the genetically modified cells are selected from Escherichia coli.

[0043] The ninth aspect of this application provides the use of the gene-modified cells described in the eighth aspect in the synthesis of LNTs.

[0044] The application enables the de novo synthesis of LNTs using lactose as a raw material.

[0045] Preferably, in the application, the culture medium contains lactose, sucrose, glycerol, glucose, fructose, or any combination thereof.

[0046] Beneficial effects

[0047] This invention provides a series of polypeptides and gene-modified cells containing the genes of the said polypeptides, which have enhanced catalytic synthesis of LNTs. This invention provides a method for expressing the said polypeptides, and also a method for using the said polypeptides to catalyze the synthesis of lactose-N-tetrasaccharide (LNT). The technical solution of this invention has positive significance for the industrial production of human milk oligosaccharides; this method is green, efficient, and sustainable, and is conducive to large-scale industrial production applications. Detailed Implementation

[0048] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; all materials and reagents are commercially available unless otherwise specified.

[0049] The present invention will be further described in detail below through embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. Modifications or substitutions to the details and form of the technical solution without departing from the structural concept and scope of use of the present invention shall fall within the protection scope of the present invention.

[0050] In the following examples, the products obtained from the polypeptide catalytic reaction were analyzed or identified using HPLC, mass spectrometry, and ion chromatography.

[0051] HPLC detection conditions: Column type: Cosmosil Sugar-D amino column (nacalaitesque, INC.), detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 1.0 mL / min, column temperature: 30 ℃, mobile phase: acetonitrile:water = 70:30.

[0052] LC-MS analysis conditions: Column type: Cosmosil Sugar-D amino column (nacalaitesque, INC.), detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 1.0 mL / min, column temperature: 30 ℃, mobile phase: acetonitrile:water = 70:30; H-ESI mode, molecular weight scan range 400–900.

[0053] The ion chromatography analysis conditions were as follows: column: MetroSep Carb2 (4.0 mm × 250 mm), eluent: 140 mM NaOH / 20 mM NaAc, isocratic elution, flow rate: 0.500 mL / min, amperometric detector, column temperature: 40 ℃, injection volume: 20 μL, run time: 50 min.

[0054] The standards for lactose-N-trisaccharide (LNTII), lactose-N-tetrasaccharide (LNT), and lactose-N-neotetrasaccharide (LNnT) were produced by ELICITYL, France.

[0055] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations of the present invention.

[0056] In the following examples, the starting strain for the Kluyveromyces lactis gene-modified cells was K. lacticDSM70799, the starting strain for the Kluyveromyces marxianus gene-modified cells was K. marxianusDMKU3-1042, the starting strain for the Pichia pastoris gene-modified cells was Pichia pastoris GS115, and the starting strain for the Yersinia lipolytica gene-modified cells was Yersinia lipolytica ATCC 20460.

[0057] Example 1. Expression of polypeptide (B0) and polypeptides B1-B9 shown in SEQ ID NO:1 in Escherichia coli.

[0058] A gene synthesis company was commissioned to obtain the genes corresponding to peptides B1-B9 through codon optimization and DNA synthesis. Following the methods outlined in *Molecular Cloning: A Laboratory Manual*, a series of pET32a-BX recombinant plasmids (pET32a-B0, pET32a-B1 to pET32aB9) were constructed. The recombinant plasmid was transformed into Escherichia coli BL21(DE3) as follows: Prepared competent Escherichia coli BL21(DE3) cells were thawed on ice for 30 min. 100 μL of competent cells were mixed with 10 μL of pET32aBX recombinant plasmid (concentration 50 ng / μL), and heat-shocked in a 42℃ water bath for 45 s. Immediately afterwards, the cells were cooled on ice for 2 min. 1 mL of fresh LB medium (LB medium: 1.0% peptone, 0.5% yeast extract, 1.0% NaCl, 1.5% agar powder added to the plate) was added, and the cells were incubated at 37℃ and 100 rpm for 1 h. Then, 100 μL of the bacterial culture was spread onto an LB plate containing ampicillin (100 μg / mL), and incubated at 37℃ for 12 h. Single colonies were then picked for colony PCR to screen for positive transformants. Furthermore, after culturing the correct transformants, their plasmids were extracted, and PCR amplification, double enzyme digestion, and gene sequencing were used to verify whether the pET32a-BX recombinant plasmid was successfully introduced into E. coli.

[0059] Then, the correct transformants were inoculated into LB liquid medium and cultured on a shaker at 37°C and 200 rpm for 12 h to obtain the seed culture. The seed culture was then inoculated into fresh LB medium at a 1% (v / v) inoculation rate and cultured at 37°C with shaking until the OD 600 reached 0.8. Induction with isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.1 mmol / L was performed at 16°C for 12 h at 200 rpm. After induction, the fermentation broth was centrifuged at 5000 rpm for 30 min at 4°C to collect the cells. The cells were resuspended in 20 mM pH 7.4 PBS buffer and sonicated at a frequency of plus on 5 s / off 5 s for 30 min to lyse the cells. The lysed liquid was centrifuged at 13000 × g at 4°C for 30 min to remove cell debris, and the supernatant was collected.

[0060] Soluble peptides or mutants were purified using nickel column affinity chromatography, as follows: Deionized water was added to the top of the nickel column, followed by natural elution and then elution with 5 volumes of binding buffer. Crude enzyme solution filtered through a 0.45 μm membrane was then loaded onto the column, and the sample was allowed to bind thoroughly to the nickel column at a flow rate of 1.5 mL / min. After the sample dried, impurities were removed by a continuous gradient elution with 5 column volumes of washing buffer. Finally, the target protein was eluted with 5 volumes of eluent, and the eluent was collected. SDS-PAGE analysis was then performed to analyze the expression of the target protein. The genetically engineered bacteria showed distinct specific expression bands after induction, with the molecular weight of the bands being consistent with the expected molecular weight of 103 kDa. The obtained proteins were the peptide shown in SEQ ID NO:1 and peptides B1-B9, as detailed in Table 1.

[0061] Table 1. Correspondence between plasmid and peptide or derived peptide nomenclature

[0062] Recombinant plasmid Peptide nomenclature PET32a-WT B0 PET32a-B1 B1 PET32a-B2 B2 PET32a-B3 B3 PET32a-B4 B4 PET32a-B5 B5 PET32a-B6 B6 PET32a-B7 B7 PET32a-B8 B8 PET32a-B9 B9

[0063] Example 2. Synthesis of LNT catalyzed by polypeptide (B0) and polypeptides B1-B9 shown in SEQ ID NO:1.

[0064] Specifically, 20 mM galactose-1-phosphate (Gal-1-P), 20 mM lactose-N-trisaccharide (LNTII), 1 mmol / L MgCl2, 2.2 mg / mL peptide (any one of B0, B1-B9), and 100 mM Tri-HCl buffer (pH 7) were mixed and reacted at 37°C for 24 hours. The reaction was then terminated, and the peptide was purified using gel column chromatography. The catalytic reaction solution of the peptide or its mutant was analyzed and identified by HPLC, ion chromatography, and LC-MS.

[0065] The HPLC analysis conditions were as shown above, and the analysis results showed that:

[0066] (1) The peak elution time rt of LNTII standard was 8.79 min, and the peak elution time rt of LNT and LNnT standards was 11.34 min.

[0067] (2) Strong absorption peaks appeared in the reaction solutions of peptides B1-B9 around 11.34 min, which is consistent with the elution time of LNT and LNnT standards.

[0068] The LC-MS analysis conditions are shown below, and the analysis results are as follows:

[0069] The products of peptides B1-B9 with HPLC peaks around rt=11.34 were analyzed using LC-MS. The molecular weight of LNT+ / H was 708.2567; the molecular weight of LNT+ / Na was 730.2393. Mass spectrometry results were retrieved as follows: Compound CID:440993, Chemical Formula:C 26 H 45 NO 21 Extract Mass: 707.63, the same as the molecular weight of LNT and LNnT.

[0070] The ion chromatography results are shown above.

[0071] (1) The peak elution time of lactose-N-trisaccharide (LNTII) standard was 16.9 min; the peak elution time of lactose-N-neotetrasaccharide (LNnT) standard was 25.7 min; and the peak elution time of lactose-N-tetrasaccharide (LNT) standard was 29.8 min.

[0072] (2) After purification, the reaction solution of peptides B1-B9 showed a strong absorption peak around 29.8 min, which was consistent with the peak time of lactose-N-tetrasaccharide (LNT) standard, indicating that the reaction synthesized lactose-N-tetrasaccharide (LNT); the reaction solution did not show an absorption peak around 25.7 min, indicating that the reaction did not synthesize lactose-N-neotetrasaccharide (LNnT).

[0073] in conclusion

[0074] The combined results of HPLC, ion chromatography and LC-MS analysis show that peptide B1-B9 catalyzes the synthesis of lactose-N-tetrasaccharide (LNT) from the substrates galactose-1-phosphate (Gal-1-P) and lactose-N-triose (Lacto-N-triose II), but does not synthesize lactose-N-neotetrasaccharide (LNnT).

[0075] The results of LNT concentration detection in the reaction solution are recorded in Table 2.

[0076] Table 2. Study on the catalytic synthesis of LNT by the polypeptide shown in SEQ ID NO:1 and polypeptides B1-B9

[0077] polypeptide Synthetic LNT concentration, mg / mL SEQ ID NO:1(B0) 3.28 B1 4.60 B2 4.66 B3 5.49 B4 5.35 B5 7.07 B6 6.96 B7 6.13 B8 8.78 B9 7.87

[0078] Table 2 data shows that peptides B1-B9 have high catalytic activity for the synthesis of LNT.

[0079] Example 3. Construction of Kluyveromyces lactis gene-modified cells containing any one of the genes from polypeptides B0-B9.

[0080] (1) Construct a lactate-Kluyvedet modified cell expression cassette.

[0081] 1) Construction of the KL-ΔLAC4 knockout box.

[0082] Referring to the applicant's prior patent: 202211453172.5, invention title: recombinant yeast and its application, constructing a KL-ΔLAC4 knockout box.

[0083] 2) Construction of expression boxes from KL-ΔLAC4::B0, KL-ΔLAC4::B1 to KL-ΔLAC4::B9.

[0084] Using the *Kluyveromyces lactis* genome as a template, upstream and downstream homologous arm sequences *lac4-up* and *lac4-do*, promoter sequence *tef1*, and terminator sequence *adh1* were amplified. The target gene sequences were amplified using the synthesized sequences B0 to B9 as templates. The G418+loxp sequence was amplified using the expression cassette KL-ΔLAC4 as a template. Through sequential fusion PCR, any one of *lac4-up*, *tef1*, B0-B9, *adh1*, G418+loxp, and *lac4-do* were fused. Finally, using primers *lac4-upF* and *lac4-doR* (Table 3) as primers, and the fusion PCR system as a template, the expression cassettes KL-ΔLAC4::B0, KL-ΔLAC4::B1 to KL-ΔLAC4::B9 were amplified by PCR.

[0085] Table 3

[0086] Primers sequence lac4-upF TTCGGACTGCGATTATTCGTGA lac4-doR TCTGCCGTATCTTTTAACGTCACA

[0087] 3) Construction of the KL-ΔXK::LgtA expression box.

[0088] Using the Kluyveromyces lactis genome as a template, the upstream and downstream homologous arm sequences xk-up and xk-do of the xylooligoskinase XKb coding region, the promoter sequence pgk1, and the terminator sequence tdh3 were amplified. Using the synthesized lgtA sequence as a template, the target gene sequence was amplified. Using an existing plasmid in the laboratory as a template, the G418+loxp sequence was amplified. Through a sequential fusion PCR method, xyl1 up, pgk1, lgtA, tdh3, G418+loxp, and xyl1-do were fused. Finally, using primers xK-upF and xK-doR as primers (Table 4), and using the fusion PCR system as a template, the lgtA expression cassette KL-ΔXK:LgtA was amplified by PCR.

[0089] Table 4

[0090] Primers sequence xK-upF GCACTAATAATTACCGAACTATAGAC xK-doR GATGATGGCTTCGTTCTTTGATG

[0091] (2) Transformation of recombinant expression cassettes and verification of recombinant strains.

[0092] The expression cassettes constructed in (1) above were transformed into the starting strain Kluyveromyces lactis K. lacticDSM70799 cells. The specific method is as follows:

[0093] 1) First, prepare competent yeast cells: Streak a small amount of frozen yeast strain onto a plate of solid culture medium and incubate upside down at 30°C for 2 days. Pick a single yeast colony and place it in 50 mL of liquid culture medium, incubate at 30°C and 220 rpm until OD reaches 100%. 600 The pH should be between 0.8 and 1.5. Collect the bacterial cells, wash with 25 mL of sterile water, centrifuge at 1500 × g for 10 min at room temperature, and discard the supernatant. Add 1 mL of 100 mM lithium chloride buffer, resuspend the precipitate, centrifuge at 12000 rpm for 30 s, and discard the supernatant. Add 400 μL of 100 mM lithium chloride buffer again, resuspend the precipitate, and obtain competent yeast cells. Aliquot into 50 μL tubes for transformation.

[0094] Meanwhile, boil 1 mL of salmon sperm DNA for 5 minutes, then quickly place it on an ice bath to prepare single-stranded DNA.

[0095] 2) Transformation: Centrifuge the prepared competent yeast cells and remove residual lithium chloride solution using Tips. For each transformation, add the following in order: 50% PEG3350 (240 μL); 1M LiCl (36 μL); 2 mg / mL single-stranded Salmonsperm DNA (25 μL); 5–10 μg / 50 μL plasmid DNA aqueous solution (50 μL), vortex vigorously until the precipitated cells are completely and evenly distributed; incubate at 30°C for 30 min; heat shock at 42°C for 20–25 min; centrifuge at 8000 rpm for 10 min, and collect the yeast cells; then, resuspend the yeast in 500 μL of liquid medium and incubate at 30°C on a shaker; after 1–4 h, take 25–100 μL of the bacterial suspension and spread it on selective medium plates, and incubate upside down at 30°C.

[0096] 3) Verification: The correspondence between recombinant strains and their genotypes is shown in Table 5. To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, the strain was considered a false positive. A total of 10 strains, KL-B0, KL-B1 to KL-B9, were obtained.

[0097] Table 5. Genetically modified cells of Kluyveromyces lactis and their genotypes

[0098] Microbial cells genotype K.lacticDSM70799 wt KL-B0 ΔLAC4::B0;ΔXK::LgtA KL-B1 ΔLAC4::B1;ΔXK::LgtA KL-B2 ΔLAC4::B2;ΔXK::LgtA KL-B3 ΔLAC4::B3;ΔXK::LgtA KL-B4 ΔLAC4::B4;ΔXK::LgtA KL-B5 ΔLAC4::B5;ΔXK::LgtA KL-B6 ΔLAC4::B6;ΔXK::LgtA KL-B7 ΔLAC4::B7;ΔXK::LgtA KL-B8 ΔLAC4::B8;ΔXK::LgtA KL-B9 ΔLAC4::B9;ΔXK::LgtA

[0099] Encryption markers (amino acid sequences as shown in SEQ ID NO:2 and nucleotide sequences as shown in SEQ ID NO:3) were introduced into the recombinant strains described in Table 5 to obtain strains KL-B0-J, KL-B1-J to KL-B9-J, respectively.

[0100] Validation of marker genes: To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strain.

[0101] The genome was amplified by PCR using the corresponding knockout or expression cassette primers. If a unique band matching the size of the knockout or expression cassette was obtained after PCR amplification, the strain was considered correct; otherwise, it was considered a false positive. For tag verification, PCR amplification was performed using primers, followed by sequencing for further verification; otherwise, the strain was considered a false positive.

[0102] Example 4. Construction of gene-modified Max Kluyveromyces cells containing any one of the genes from polypeptides B0 to B9.

[0103] (1) Construct the Max Kluwer modified cell expression cassette.

[0104] 1) Construction of the KM-ΔLAC4 knockout box.

[0105] Referring to the applicant's prior patent: 202211453172.5, invention title: Recombinant yeast and its application in constructing a KM-ΔLAC4 knockout box.

[0106] 2) Construction of expression boxes from KM-ΔLAC4::B0, KM-ΔLAC4::B1 to KM-ΔLAC4::B9.

[0107] Using the *Kluyveromyces martensii* genome as a template, upstream and downstream homologous arm sequences *lac4-up* and *lac4-do*, promoter sequence *tef1*, and terminator sequence *adh1* were amplified. The target gene sequences were amplified using the synthesized B0, B1 to B9 sequences as templates. The G418+loxp sequence was amplified using the expression cassette KM-ΔLAC4 as a template. Through sequential fusion PCR, any one of *lac4-up*, *tef1*, B0-B9, *adh1*, G418+loxp, and *lac4-do* were fused. Finally, using primers *lac4-upF* and *lac4-doR* (Table 6) as primers, and the fusion PCR system as a template, the expression cassettes KM-ΔLAC4::B0, KM-ΔLAC4::B1 to KM-ΔLAC4::B9 were amplified by PCR.

[0108] Table 6

[0109] Primers sequence lac4-upF TGAGGAATCAAGGTAGGAATTTAGTCA lac4-doR AGAACCATTAGAACCTTTTTCAACAC

[0110] 3) Construction of the KM-ΔXK::LgtA expression box.

[0111] Using the genome of *Kluyveromyces martensii* as a template, the upstream and downstream homologous arm sequences xk-up and xk-do of the xylooligoskinase XKb coding region, the promoter sequence pgk1, and the terminator sequence tdh3 were amplified. Using the synthesized lgtA sequence as a template, the target gene sequence was amplified. Using an existing plasmid in the laboratory as a template, the G418+loxp sequence was amplified. Through a sequential fusion PCR method, xyl1 up, pgk1, lgtA, tdh3, G418+loxp, and xyl1-do were fused. Finally, using primers xK-upF and xK-doR as primers (Table 7), and using the fusion PCR system as a template, the lgtA expression cassette KM-ΔXK:LgtA was amplified by PCR.

[0112] Table 7

[0113] Primers sequence xk-upF GCCCATTTAAATCGTATAAGCTT xk-doR AATGCCCATTTCCCATTCATTA

[0114] (2) Transformation of recombinant plasmids and verification of recombinant strains:

[0115] The expression cassette constructed in (1) above was transformed into the starting strain Kluyveromyces marxianus DMKU3-1042 cells. The specific method is as described in Part (2) of Example 3, Transformation of Recombinant Expression Cassette and Verification of Recombinant Strains.

[0116] The correspondence between recombinant strains and their genotypes is shown in Table 8. To verify the correctness of the strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, it was considered a false positive. A total of 10 recombinant strains, from KM-B0, KM-B1 to KM-B9, were obtained.

[0117] Table 8. Genetically modified cells of *Kluyveromyces martensii* and their genotypes

[0118]

[0119]

[0120] Encryption markers (amino acid sequences as shown in SEQ ID NO:2 and nucleotide sequences as shown in SEQ ID NO:3) were introduced into the recombinant strains described in Table 8 to obtain strains KM-B0-J, KM-B1-J to KM-B9-J, respectively.

[0121] Validation of marker genes: Performed according to the method described in Example 3.

[0122] Example 5. Preparation of Pichia pastoris containing any one of the genes from polypeptides B0-B9

[0123] (1) Construct a Pichia pastoris modified cell expression cassette.

[0124] 1) Construction of expression boxes from PS-ΔXR::B0, PS-ΔXR::B1 to PS-ΔXR::B9.

[0125] Using the Pichia pastoris genome as a template, the upstream and downstream homologous arm sequences XR-up and XR-do, the promoter sequence tef1, and the terminator sequence adh1 were amplified. The target gene sequences were amplified using the synthesized B0 to B9 sequences as templates. The G418+loxp sequence was amplified using the expression cassette KL-ΔLAC4 as a template. The XR-up, tef1, any one of B0-B9, adh1, G418+loxp, and XR-do were fused using a two-fragment successive fusion PCR method. Finally, using primers XR-upF and XR-doR as primers (Table 9), the expression cassettes PS-ΔXR::B0, PS-ΔXR::B1 to PS-ΔXR::B9 were amplified by PCR using the fusion PCR system as a template.

[0126] Table 9

[0127] Primers sequence XR-upF ACCAATACGGCGTACCTTCCAGGGCTGCTG XR-doR TGAACGACAAGTAGACACCACCAATCAGTCT

[0128] 2) Construction of the PS-ΔXK::LgtA-Lac12 expression box.

[0129] Using the Pichia pastoris genome as a template, the upstream and downstream homologous arm sequences xk-up and xk-do of the xylooligoskinase XKb coding region, the promoter sequence pgk1, and the terminator sequence tdh3 were amplified. Using the Kluyveromyces lactis genome and the synthesized lgtA sequence as templates, the target gene sequence was amplified. Using an existing plasmid in the laboratory as a template, the G418+loxp sequence was amplified. Through a two-fragment successive fusion PCR method, xyl1 up, pgk1, lgtA-Lac12, tdh3, G418+loxp, and xyl1-do were fused. Finally, using primers xK-upF and xK-doR as primers (Table 10), and using the fusion PCR system as a template, the expression cassette PS-ΔXK:LgtA-Lac12 was amplified by PCR.

[0130] Table 10

[0131] Primers sequence xk-upF ACTCTATTAAAATTGAACAATGGTC xk-doR AAGTCCAGTAAACCAGAGCGTTTGT

[0132] (2) Transformation of recombinant plasmids and verification of recombinant strains:

[0133] The expression cassette constructed in (1) above was transformed into the starting strain Pichia pastoris GS115 cells. The specific method is as described in Part (2) of Example 3, Transformation of Recombinant Expression Cassette and Verification of Recombinant Strains.

[0134] The correspondence between recombinant strains and their genotypes is shown in Table 11. To verify the correctness of the strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, it was considered a false positive. A total of 10 recombinant strains, from PS-B0 to PS-B9, were obtained.

[0135] Table 11. Genetically modified cells of Pichia pastoris and their genotypes

[0136] strain genotype Pichia pastoris GS115 wt PS-B0 ΔXR::B0;ΔXK::LgtA-Lac12 PS-B1 ΔXR::B1;ΔXK::LgtA-Lac12 PS-B2 ΔXR::B2;ΔXK::LgtA-Lac12 PS-B3 ΔXR::B3;ΔXK::LgtA-Lac12 PS-B4 ΔXR::B4;ΔXK::LgtA-Lac12 PS-B5 ΔXR::B5;ΔXK::LgtA-Lac12 PS-B6 ΔXR::B6;ΔXK::LgtA-Lac12 PS-B7 ΔXR::B7;ΔXK::LgtA-Lac12 PS-B8 ΔXR::B8;ΔXK::LgtA-Lac12 PS-B9 ΔXR::B9;ΔXK::LgtA-Lac12

[0137] Encryption markers (amino acid sequences as shown in SEQ ID NO:2 and nucleotide sequences as shown in SEQ ID NO:3) were introduced into the recombinant strains described in Table 11 to obtain strains PS-B0-J, PS-B1-J to PS-B9-J, respectively.

[0138] Validation of marker genes: Performed according to the method described in Example 3.

[0139] Example 6. Preparation of gene-modified *Yarrowia lipolytica* cells containing any one of the genes from polypeptides B0-B9

[0140] (1) Constructing the Yeast Expression Frame of Yeast Lipidolysis.

[0141] Construction of expression boxes from YL-ΔLip7::B0-LgtA-Lac12, YL-ΔLip7::B1-LgtA-Lac12 to YL-ΔLip7::B9-LgtA-Lac12.

[0142] Using the *Yersinia lipophila* ATCC 20460 genome as a template, the upstream and downstream homologous arm sequences lip7-up and lip7-do, the promoter sequence FBAp, and the terminator sequence pex16t were amplified. The target gene sequences were amplified using the synthesized B0 to B9 sequences as templates. The URA3 sequence was amplified using the synthesized URA3 gene as a template. Simultaneously, using *Yersinia lipophila* ATCC... Using the 20460 genome as a template, the promoter EXPp and terminator XPRt were amplified. Through sequential fusion PCR, FBA1p, any one of B0-B9, pex16t, EXPp, URA3, and XPRt were fused to obtain the B0 / B9-URA3 expression cassette. Using the *Yersinia lipophila* genome as a template, the promoter sequence TEF1p and terminator sequence pex16t were amplified. Using synthesized lgtA, the target gene sequence lgtA was amplified. Using synthesized Lac12 as a template, Lac12 was amplified. Using the *Yersinia lipophila* genome as a template, the promoter PGKp and terminator pex20t were amplified. Simultaneously, using the *Yersinia lipophila* genome, the following sequence was amplified... The promoter EXPp and terminator XPRT were fused with TEF1p, lgtA, pex16t, PGKp, Lac12, and pex20t to obtain the LgtA-Lac12 linear expression cassette. Finally, any one of B0 / B9-URA3 was fused with lip7-up, LgtA-Lac12, and lip7-do, respectively. Using lip7-uF and lip7-dR as primers (Table 12) and the fusion PCR system as a template, the expression cassettes YL-ΔLip7::B0-LgtA-Lac12, YL-ΔLip7::B1-LgtA-Lac12, and YL-ΔLip7::B9-LgtA-Lac12 were obtained by PCR amplification.

[0143] Table 12

[0144] Primers sequence Lip7-uF CAGTTCGAGTCAAGCTTGAT Lip7-dR TGGAGTTCTGGGACATCATATT

[0145] (2) Transformation of recombinant plasmids and verification of recombinant strains:

[0146] The expression cassette constructed in (1) above was transformed into Yersinia lipophila ATCC 20460 cells. The specific method is as described in Part (2) of Example 3, Transformation of Recombinant Expression Cassette and Verification of Recombinant Strains.

[0147] The correspondence between recombinant strains and their genotypes is shown in Table 13. To verify the correctness of the strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, it was considered a false positive. A total of 10 recombinant strains, from YL-B0, YL-B1 to YL-B9, were obtained.

[0148] Table 13. Genetically modified cells of *Yersinia lipolytica* and their genotypes

[0149]

[0150]

[0151] Example 7. Study on the synthesis of LNT by gene-modified cells through fermentation as described in Examples 3-6.

[0152] Yeast was cultured using glucose as the carbon source. Gene-modified cells obtained in Examples 3-6 were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then picked and inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (out of growth) was reached. 600 =1, add lactose to a final concentration of 10 g / L and glucose of 3% (w / v), and culture at 30℃ with shaking at 200 rpm for a total fermentation time of 72 h. After 72 h of fermentation, take a sample, boil for 10 min, centrifuge to obtain the final fermentation product of yeast, and detect the LNT content in the supernatant by HPLC. The results are recorded in Table 14-17.

[0153] Table 14. Study on LNT Synthesis in Lactate Kluyveromycin Gene-Modified Cells Obtained in Example 3

[0154]

[0155] Table 15. Study on LNT synthesis in Max Kluwer gene-modified cells obtained in Example 4.

[0156]

[0157]

[0158] Table 16. Study on LNT synthesis in Pichia pastoris gene-modified cells obtained in Example 5.

[0159]

[0160] Table 17. Study on LNT synthesis in gene-modified cells of *Yarrowia lipolyticis* obtained in Example 6.

[0161]

[0162] Table 14-17 Data Explanation: The introduction of marker genes does not affect the yield of LNT synthesized by fermentation in the gene-modified cells obtained in Examples 3-6.

[0163] Example 8. Kluyveromyces kluyveromyces KL-B5-J, KL-B7-J, KM-B5-J, KM-B7-J, Pichia pastoris PS-B5-J, PS-B7-J, and Yersinia lipolytica YL-B5-J, YL-B7-J, were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then picked and inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of each colony was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (dose elapsed). 600 =1, 2% of each yeast extract was inoculated into 1L of YPD medium (10g / L yeast extract, 20g / L peptone, 20g / L glucose) in a 3L fermenter. After 6-7 hours of cultivation, glucose (50% mother liquor concentration) was added at a flow rate of 8mL / h. Simultaneously, lactose (40% mother liquor concentration) was added, maintaining a final lactose concentration of 15g / L. The total fermentation time was 72 hours. After 72 hours of fermentation, the fermentation broth was centrifuged, and the supernatant and precipitate were collected separately. The precipitate was homogenized using a high-pressure homogenizer, and the protein was removed by boiling and centrifugation. The supernatants were combined to obtain the final yeast fermentation product. The LNT content in the supernatant was measured, and the results are recorded in Table 18.

[0164] Table 18. Study on LNT synthesis by genetically modified yeast strains

[0165] Gene-modified cells LNT production, mg / mL KL-B5-I 19.87 KL-B7-J 21.27 KM-B5-J 20.33 KM-B7-J 22.78 PS-B5-J 29.73 PS-B7-J 23.39 YL-B5-J 38.57 YL-B7-J 40.61

[0166] While the invention has been described in considerable detail by way of illustration and example for purposes of clarity, it will be apparent to those skilled in the art that any equivalent aspects or modifications may be made. Therefore, this specification and the embodiments should not be construed as limiting the scope of the invention.

Claims

1. A polypeptide, characterized in that, The polypeptide with the amino acid sequence shown in SEQ ID NO:1 has at least one of the following mutations: 1) Replace the first amino acid residue in the amino acid sequence shown in SEQ ID NO:1 with MDTIM to obtain polypeptide B1. 2) The amino acid residue at position 111 of polypeptide B1 is replaced with L by replacing F, resulting in polypeptide B2. 3) The amino acid residues at positions 119-120 of polypeptide B1 are replaced with VV by IL to obtain polypeptide B3. 4) The amino acid residues at positions 247-248 of polypeptide B1 are replaced with amino acid II to obtain polypeptide B4. 5) The amino acid residue at position 150 of polypeptide B3 is replaced with L by replacing F to obtain polypeptide B5. 6) The amino acid residues at positions 119-120 of polypeptide B4 are replaced with VV by IL to obtain polypeptide B6. 7) The amino acid residue at position 150 of polypeptide B2 is replaced with L by replacing F and the amino acid residues at positions 176-178 are replaced with FSA by replacing YGS to obtain polypeptide B7. 8) The amino acid residues at positions 119-120 of polypeptide B3 are replaced with IL to VV and the amino acid residues at positions 247-248 are replaced with AA to II, to obtain polypeptide B8. 9) The amino acid residues at positions 243-244 in the amino acid sequence shown in SEQ ID NO:1 are replaced with II by replacing AA to obtain polypeptide B9. Preferably, the polypeptide has at least 70% or more of the same amino acid sequence as the polypeptide shown in SEQ ID NO:

1.

2. The method for expressing the polypeptide according to claim 1, comprising the following steps: (a) Culture host cells under conditions suitable for expressing the polypeptide; Preferably, it further includes: (b) the step of recovering the polypeptide. Preferably, in step (a), a recombinant plasmid encoding the aforementioned polypeptide is first constructed and then introduced into a host cell; the host cell includes a wild-type strain isolated from nature, a mutant strain induced by physical and chemical mutagenesis, or an engineered bacterium modified by genetic engineering.

3. The method for expressing the polypeptide as described in claim 2, characterized in that, The host cells include, but are not limited to, *Escherichia* sp., *Bacillus* sp., *Kluyveromycess* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp., etc. Preferably, the host cell includes, but is not limited to, natural or genetically modified strains of Saccharomyces cerevisiae, Kluyveromyces marxianus, Kluyveromyces lactis, Yarrowia lipolytica, Escherichia coli, Pichia pastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides. Preferably, the host cell is Escherichia coli BL21(DE3).

4. A polynucleotide encoding any one of the polypeptides B1-B9 of claim 1.

5. A nucleic acid construct comprising the polynucleotide of claim 4. The nucleic acid construct preferably further includes one or more regulatory sequences operatively linked to the polynucleotide, the regulatory sequences being able to guide the production of the polypeptide in a suitable expression host.

6. An enzyme preparation comprising any one or more of the polypeptides of claim 1.

7. The use of the polypeptide of claim 1 in the synthesis of LNT.

8. A gene-modified cell, characterized in that, A heterologous nucleic acid sequence containing any of the polypeptides described in claim 1. Preferably, the genetically modified cells include, but are not limited to, *Escherichia* sp., *Bacillus* sp., *Kluyveromyces* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp., etc. Preferably, the genetically modified cells include, but are not limited to, Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichia pastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides. Preferably, the genetically modified cells are selected from Escherichia coli.

9. The use of the gene-modified cells of claim 8 in the synthesis of lactose-N-tetrasaccharides.

10. A method for preparing lactose-N-tetrasaccharide, characterized in that, The reaction system contains any one or more of the derived polypeptides of claim 1, or any one or more of the host cells of claim 3, or any one or more of the enzymes or enzyme compositions of claim 6, or any one or more of the gene-modified cells of claim 8. Preferably, in the preparation method, when the reaction system contains any of the gene-modified cells described in claim 8, the culture medium contains lactose, sucrose, glycerol, glucose, fructose, or any combination thereof. Preferably, in the preparation method, when the reaction system contains one or more of the derived polypeptides of claim 1, or one or more of the host cells of claim 3, or one or more of the enzymes or enzyme compositions of claim 6, the substrate is selected from any one of galactose-1-phosphate and / or lactose and / or galactose, or any combination thereof, to synthesize LNTs with acetylglucosamine and / or carbohydrates with acetylglucosamine groups. Preferably, in the preparation method, the reaction substrate is galactose-1-phosphate and lactose-N-triose ((Lacto-N-trioseII, LNTII)).

Images