A glycosyltransferase mutant and its application in synthesis of rebaudioside m

Abstract

The present application relates to a glycosyltransferase mutant and its application in synthesis of rebaudioside M, and belongs to the technical field of enzyme engineering. The glycosyltransferase mutant is obtained by mutating the amino acid sequence of acetylglucosamine-6-phosphate phosphatase shown in SEQ ID NO. 1, and the mutation is that the 379th glycine is mutated into methionine, or the 379th glycine is mutated into methionine, the 200th leucine is mutated into alanine, and the 155th histidine is mutated into alanine. The glycosyltransferase mutant provided by the present application can realize high yield of rebaudioside M, and the yield of the product rebaudioside M can reach 69.5% in a 10 mL catalytic system. Moreover, the construction and fermentation method of the glycosyltransferase mutant are simple, and the cell crushing and catalysis steps are simple, so the glycosyltransferase mutant has a good industrial production application prospect.

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and in particular to a glycosyltransferase mutant and its application in the synthesis of rebaudioside M. Background Technology

[0002] Rebaudioside M is a natural steviol glycoside extracted from the leaves of stevia rebaudiana. It is a minor component of the steviol glycoside family, but its sweetness characteristics have garnered significant attention. Rebaudioside M is approximately 200-300 times sweeter than sucrose, with a pure sweetness and less bitterness and metallic aftertaste compared to its counterparts (such as rebaudioside A), resulting in a taste closer to sucrose. It is not metabolized in the body and produces no calories, classifying it as a zero-calorie, high-intensity sweetener.

[0003] In terms of safety, various high-purity steviol glycosides, including rebaudioside M, have been approved for use as food additives by numerous authoritative organizations worldwide (such as the Codex Alimentarius Commission, the US FDA, and the European EFSA). It is widely used in beverages, dairy products, confectionery, and other foods and drinks, providing a natural sugar substitute for consumers who need to control their sugar and calorie intake.

[0004] UGT76G1 is a glycosyltransferase that plays a crucial role in the biosynthesis of steviol glycosides in stevia (stevia rebaudiana). Its primary function is to catalyze the conversion of rebaudioside D to rebaudioside M. This enzyme specifically catalyzes the attachment of a new glucose group to a specific position on the glucose group of the rebaudioside D molecule. This glycosylation modification directly alters the molecular structure, resulting in rebaudioside M. This conversion process significantly enhances the sweetness of the product, making rebaudioside M more pure in taste and less bitter aftertaste. Therefore, UGT76G1 is one of the key enzymes for producing high-quality natural sweeteners.

[0005] Existing methods for producing steviol glycosides mainly involve extraction, purification, and biotransformation. Traditional methods involve extraction from stevia (stevia rebaudiana) leaves, such as using environmentally friendly water extraction. Ethanol pretreatment has been shown to effectively improve the yield and purity of subsequent water extractions. However, the efficiency of environmentally friendly water extraction may be limited, while ethanol pretreatment, although increasing yield, increases solvent usage. The obtained crude extract needs purification, with common techniques including ion exchange chromatography and membrane separation. Different purification processes (such as ethanol crystallization, enzymatic modification, or membrane purification) significantly affect the proportions and sensory characteristics of various steviol glycosides in the final product, and some commercially available extracts may not meet regulatory requirements for the content of specific glycosides. Furthermore, biotechnology is key to producing specific "next-generation" high-sweetness, low-bitterness steviol glycosides (such as rebaudioside D and M), involving in vitro biotransformation using microbial fermentation or glycosyltransferases. The development of these technologies aims to obtain high-purity, specific-composition natural sweeteners more efficiently and environmentally. In the biotransformation production of specific steviol glycosides (such as rebaudioside D and M), the catalytic activity and thermostability of the glycosyltransferase UGT76G1 are poor, resulting in low yields and quantities of the target products, rebaudioside D and M. Furthermore, sensory defects in the final product still require attention; for example, residual bitterness may occur, and improper concentration in applications such as yogurt may accentuate a sour taste. Regarding safety, steviol glycosides may interact with certain drug metabolic pathways, and in vitro studies have shown that certain glycosides may inhibit the growth of certain probiotics; these potential effects require further evaluation. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a glycosyltransferase mutant and its application in the synthesis of rebaudioside M. By modifying the UGT76G1 glycosyltransferase using enzyme engineering methods and employing semi-rational design for site-directed mutagenesis, the catalytic activity and thermostability of the enzyme are improved, thereby increasing the yield and productivity of the target product, rebaudioside M.

[0007] This invention optimizes the codon sequence of the glycosyltransferase UGT76G1 to make the protein expression more in line with the protein expression preferences of E. coli. In order to meet the needs of exogenous protein expression, E. coli BL21 is selected as the chassis strain, and the lactose operon can be induced by IPTG to secrete proteases intracellularly.

[0008] This invention screened for alanine scanning mutations and obtained a three-point mutant G379M-L200A-H155A with significantly enhanced catalytic activity, achieving the highest yield of rebaudioside M produced by UGT76G1 glycosyltransferase to date.

[0009] This invention is achieved through the following technical solution:

[0010] The first objective of this invention is to provide a glycosyltransferase mutant obtained by mutating the amino acid sequence of acetylglucosamine-6-phosphate phosphatase as shown in SEQ ID NO. 1, wherein the mutation is as follows:

[0011] Mutate glycine at position 379 to methionine; or,

[0012] The glycine at position 379 was mutated to methionine, the leucine at position 200 was mutated to alanine, and the histidine at position 155 was mutated to alanine.

[0013] A second objective of this invention is to provide a nucleic acid encoding the glycosyltransferase mutant.

[0014] A third objective of this invention is to provide a recombinant plasmid carrying the nucleic acid.

[0015] A fourth objective of this invention is to provide a host cell expressing the glycosyltransferase mutant.

[0016] A fifth objective of this invention is to provide the use of the glycosyltransferase mutant, the nucleic acid, the recombinant plasmid, or the host cell in the preparation of rebaudioside M or products containing rebaudioside M.

[0017] The sixth objective of this invention is to provide a recombinant Escherichia coli that synthesizes rebaudioside M, wherein the recombinant Escherichia coli expresses the glycosyltransferase mutant.

[0018] The seventh objective of this invention is to provide a method for synthesizing rebaudidine M, using rebaudidine D as a substrate and employing the glycosyltransferase mutant or the whole cell of the host cell as a catalyst to catalyze the synthesis of rebaudidine M.

[0019] In one embodiment of the present invention, the concentration of the substrate is 19.5 g / L to 20.5 g / L.

[0020] In one embodiment of the present invention, the catalytic conditions are: reaction at 36°C to 38°C for 23.5 h to 24.5 h.

[0021] In one embodiment of the present invention, the catalytic system further includes 55 g / L to 65 g / L sucrose, 4.5 g / L to 5.5 g / L UDP, and 0.08 mol / L to 0.12 mol / L MgCl2.

[0022] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0023] This invention provides a glycosyltransferase mutant and its application in the synthesis of rebaudioside M. The glycosyltransferase mutant UGT76G1-G379M-L200A-H155A provided by this invention can achieve high yield of rebaudioside M, and the yield of rebaudioside M can reach 69.5% in a 10 mL catalytic system.

[0024] The glycosyltransferase mutant UGT76G1-G379M-L200A-H155A provided by this invention has a simple construction and fermentation method with easy cell disruption and catalytic steps, and has good prospects for industrial production applications. Attached Figure Description

[0025] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0026] Figure 1 This is the SDS-PAGE of the crude enzyme solution of UGT76G1 of this invention;

[0027] Figure 2 This is a diagram showing the key amino acid residues within a 5A range surrounding the substrate UDPG, which is the docking point of the UGT76G1 enzyme and UDPG molecule of this invention.

[0028] Figure 3 This is the relative enzyme activity of the crude enzyme solution of the UGT76G1 enzyme alanine scanning mutant of the present invention. Detailed Implementation

[0029] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available.

[0031] Materials and methods involved in this invention:

[0032] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, adjusted to pH 7.0–7.4 with 5 mol / L NaOH solution.

[0033] TB medium: tryptone 12 g / L, yeast extract 24 g / L, glycerol 5 mL / L, potassium dihydrogen phosphate approximately 2.2–2.31 g / L, dipotassium hydrogen phosphate approximately 9.4–12.54 g / L.

[0034] Enzyme activity unit definition and enzyme activity assay method: Enzyme activity definition: The amount of enzyme required to catalyze 1 μmol of substrate in 1 minute.

[0035] Enzyme activity assay method: Measure the amount of product produced per unit time.

[0036] The product was detected using high-performance liquid chromatography (HPLC). HPLC employed a C18 column and a 20 μL injection volume. The detection program is shown in Table 1 below.

[0037] Table 1

[0038]

[0039] Example 1: Construction of a recombinant Escherichia coli strain that secretes UGT76G1 glycosyltransferase intracellularly

[0040] (a) Based on the protein sequence of UGT76G1 glycosyltransferase published on UniProt (UniProt ID: Q6VAB4), codons were optimized according to the codon preference of E. coli and the whole gene was synthesized (amino acid sequence is shown in SEQ ID NO.1, nucleotide sequence is shown in SEQ ID NO.2) to construct the PET-22b-UGT76G1 plasmid.

[0041] (b) The plasmid framework obtained in (a) was amplified by PCR. The amplified product was transferred into DH5α competent cells and cultured. The cells were then plated on LB plates supplemented with ampicillin and incubated at 37°C upside down overnight. Single colonies were picked for colony PCR. Positive colonies were transferred to 2 mL LB (with ampicillin) and incubated at 37°C for 12 hours. The plasmid was then extracted and sequenced.

[0042] (c) Transform the plasmid that was correctly sequenced in (b) into competent E. coli BL21 cells, and after culturing, plate it on LB agar plates supplemented with ampicillin. Incubate at 37°C until single colonies are found. Pick single colonies for sequencing. Transfer positive single colonies and blank control colonies to 2 mL LB agar (supplemented with ampicillin) and incubate overnight.

[0043] (d) Inoculate 0.5 mL of the seed culture from (c) into a 250 mL Erlenmeyer flask containing 50 mL of TB medium. Incubate at 37°C and 220 rpm for 1.5 hours. Then add IPTG stock solution with a final concentration of 0.5 mM and incubate at 18°C ​​and 220 rpm for 18 hours. Centrifuge the fermentation broth (4500 rpm, 5 minutes), discard the supernatant, resuspend the cells in 10 mL of sterile water, centrifuge again under the same conditions, discard the supernatant, add 30 mL of PBS solution to resuspend the cells, and then break the cells using a high-pressure homogenizer.

[0044] (e) After centrifuging the crude enzyme solution (4500 rpm, 5 minutes), the supernatant was collected, and the expression of the target protease was detected by SDS-PAGE. The results are as follows: Figure 1 As shown in the figure, the target protein in the bacterial cell lysis supernatant has a clear band and can be expressed normally.

[0045] Example 2: Construction of a single-point mutant with enhanced enzyme activity based on molecular docking and alanine scanning mutation.

[0046] (a) Based on literature and online research, the three-dimensional structures of the UGT76G1 enzyme and its substrates rebaudioside D and UDPG were determined. Molecular docking of the three was performed using Maestro software, identifying a total of 8 amino acid residues within the 4A range of the substrate UDPG, such as... Figure 2 As shown. Using 8 pairs of primers, PCR amplification was performed to obtain the expression plasmid of the corresponding protease site-directed mutant.

[0047] Primer sequence (5'→3'):

[0048] 76G1-P84A-R (SEQ ID NO. 3)

[0049] GCCGTGGGTCGGCAGGTTGCTAATACGCTC

[0050] 76G1-P84A-F (SEQ ID NO. 4)

[0051] GCAACCTGCCGACCCACGGCGCTCTGGCGGGTA

[0052] 76G1-H155A-R (SEQ ID NO.5)

[0053] CGCGTGGAAGTTAAACAGGCTGCTGGTCATCAGAACCAG

[0054] 76G1-H155A-F (SEQ ID NO.6)

[0055] GCCTGTTTAACTTCCACGCGGCTGTGAGCCTGCCG

[0056] 76G1-N196R-R (SEQ ID NO.7)

[0057] GCTATACGCGCTTTTGATATCTTTAACCTTCAGCATCGGGAAACCGCTC

[0058] 76G1-N196R-F (SEQ ID NO.8)

[0059] GATATCAAAAGCGCGTATAGCGCTTGGCAGATCCTGAAGG

[0060] 76G1-K316A-R(SEQ ID NO.9)

[0061] CACGAAGCCCGGACGAACCACCCACAGAAAG

[0062] 76G1-K316A-F(SEQ ID NO.10)

[0063] TGGTTCGTCCGGGCTTCGTGGCTGGTAGCACCT

[0064] 76G1-G379A-R(SEQ ID NO.11)

[0065] ACCGAAGTCGCTAAAGATCATCGGAACACCTTCGCACAC

[0066] 76G1-G379A-F(SEQ ID NO.12)

[0067] TGATCTTAGCGACTTCGGTGCTGATCAGCCGCTGA

[0068] 76G1-S147A-F (SEQ ID NO. 13)

[0069] TGCGTCGTCTGGTTCTGATGACCGCTAGCCTGTTTAAC

[0070] 76G1-S147A-R (SEQ ID NO. 14)

[0071] GGTCATCAGAACCAGACGACGCAGGTTCAGGCT

[0072] 76G1-H25A-R(SEQ ID NO.15)

[0073] GCCCTGGAACGGAACCGGAAACAGAATGATACGACGAC

[0074] 76G1-H25A-F(SEQ ID NO.16)

[0075] TTCCGGTTCCGTTCCAGGGCGCTATCAACCCGA

[0076] 76G1-T146A-R (SEQ ID NO.17)

[0077] CATCAGAACCAGACGACGCAGGTTCAGGCTGTCC

[0078] 76G1-T146A-F (SEQ ID NO.18)

[0079] CTGCGTCGTCTGGTTCTGATGGCTAGCAGCCTGTTT

[0080] (b) The plasmid framework obtained in (a) was amplified by PCR. The amplified product was transferred into DH5α competent cells and cultured. The cells were then plated on LB plates supplemented with ampicillin and incubated at 37°C upside down overnight. Single colonies were picked for colony PCR. Positive colonies were transferred to 2 mL LB (with ampicillin) and incubated at 37°C for 12 hours. The plasmid was then extracted and sequenced.

[0081] (c) Transform the plasmid that was correctly sequenced in (b) into E. coli BL21 competent cells, then culture it and spread it on LB agar plates supplemented with ampicillin. Incubate at 37°C until single colonies are found. Pick single colonies for sequencing. For positive single colonies, transfer them to 2 mL LB agar (supplemented with ampicillin) and incubate overnight.

[0082] (d) Inoculate 0.5 mL of the seed culture from (c) into a 250 mL Erlenmeyer flask containing 50 mL of TB medium. Incubate at 37°C and 220 rpm for 1.5 hours. Then add IPTG stock solution with a final concentration of 0.5 mM and incubate at 18°C ​​and 220 rpm for 18 hours. Centrifuge the fermentation broth (4500 rpm, 5 minutes), discard the supernatant, resuspend the cells in 10 mL of sterile water, centrifuge again under the same conditions, discard the supernatant, add 30 mL of PBS solution to resuspend the cells, and then break the cells using a high-pressure homogenizer.

[0083] (e) After centrifuging the crude enzyme solution (4500 rpm, 5 min), collect the supernatant and concentrate the crude enzyme solution to 10 mL using an ultrafiltration tube. Add 0.2 mM lebodiin D, 1 mM UDPG and 200 μL of crude enzyme solution to a 500 μL system and react at 37 °C for 2 h.

[0084] (f) After the reaction is complete, add 4 times the reaction volume of acetonitrile to stop the reaction. Detect the product concentration using high-performance liquid chromatography (HPLC) and compare enzyme activity. Figure 3 As shown in the figure, the enzyme activity of the H155A mutant is significantly increased.

[0085] Example 3: Combinatorial mutation further enhances glycosyltransferase activity

[0086] (a) Using the plasmid vector pet-22b(+) as a template, the template was amplified by PCR and then assembled with the UGT76G1 gene. Primers were designed to perform PCR to mutate amino acids at positions 200 and 379.

[0087] G379M-F (SEQ ID NO. 19):

[0088] tgatctttagcgacttcggtggcgatcagccgctgaac

[0089] G379M-R (SEQ ID NO. 20):

[0090] accgaagtcgctaaagatcatcggaacaccttcgcaca

[0091] L200A-F (SEQ ID NO. 21):

[0092] cgtatagcaactggcagatcctgaaggaaattctgggcaagatga

[0093] L200A-R (SEQ ID NO. 22):

[0094] gatctgccagttgctatacgcgcttttgatatctttaaccttcagcatc

[0095] Using the plasmid of mutant UGT76G1-G379M-L200A as a template, the three-point mutant UGT76G1-G379M-L200A-H155A was obtained by PCR amplification with primers 76G1-H155A-R and 76G1-H155A-F.

[0096] (b) The plasmid framework obtained in (a) was amplified by PCR. The amplified product was transferred into DH5α competent cells and cultured. The cells were then plated on LB plates supplemented with ampicillin and incubated at 37°C upside down overnight. Single colonies were picked for colony PCR. Positive colonies were transferred to 2 mL LB (with ampicillin) and incubated at 37°C for 12 hours. The plasmid was then extracted and sequenced.

[0097] (c) Transform the plasmid that was correctly sequenced in (b) into competent E. coli BL21 cells, and after culturing, plate it on LB agar plates supplemented with ampicillin. Incubate at 37°C until single colonies are found. Pick single colonies for sequencing. For positive single colonies, transfer them to 4 mL LB agar (supplemented with ampicillin) and incubate overnight.

[0098] (d) Inoculate 4 mL of the seed culture from (c) into an Erlenmeyer flask containing 400 mL of TB medium. After culturing at 37°C and 220 rpm for 1.5 hours, add IPTG stock solution with a final concentration of 0.5 mM. Culturing at 18°C ​​and 220 rpm for 18 hours, centrifuge the fermentation broth (4500 rpm, 5 minutes), discard the supernatant, resuspend the cells in 10 mL of sterile water, centrifuge again under the same conditions, discard the supernatant, add 30 mL of PBS solution to resuspend the cells, and then break the cells using a high-pressure homogenizer.

[0099] (e) After centrifuging the crude enzyme solution (4500 rpm, 5 min), collect the supernatant and concentrate the crude enzyme solution to 10 mL using an ultrafiltration tube. Add 20 g / L rebaudioside D, 60 g / L sucrose, 50 mg UDP, 500 μL of 0.1 mol / L MgCl2 solution, 2 mL of crude enzyme solution and a certain amount of PBS solution to the 10 mL system and react at 37 °C for 24 h.

[0100] (f) After the reaction was completed, acetonitrile (4 times the reaction volume) was added to stop the reaction. The product concentration was detected by high performance liquid chromatography (HPLC). The concentration of rebaudioside M reached 13.9 g / L, and the yield was 69.5%. Using the wild-type enzyme (amino acid sequence shown in SEQ ID NO. 1) as a control, the yield of rebaudioside M was approximately 5.9 g / L, and the yield was 29.5%.

[0101] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A glycosyltransferase mutant, characterized in that, It was obtained by mutating the amino acid sequence of acetylglucosamine-6-phosphate phosphatase as shown in SEQ ID NO. 1, wherein the mutation is: Mutate glycine at position 379 to methionine; or, The glycine at position 379 was mutated to methionine, the leucine at position 200 was mutated to alanine, and the histidine at position 155 was mutated to alanine.

2. The nucleic acid encoding the glycosyltransferase mutant of claim 1.

3. A recombinant plasmid carrying the nucleic acid of claim 2.

4. Host cells expressing the glycosyltransferase mutant of claim 1.

5. The use of the glycosyltransferase mutant of claim 1, the nucleic acid of claim 2, the recombinant plasmid of claim 3, or the host cell of claim 4 in the preparation of rebaudioside M or products containing rebaudioside M.

6. A recombinant Escherichia coli that synthesizes rebaudine M, characterized in that, The recombinant Escherichia coli expressed the glycosyltransferase mutant of claim 1.

7. A method for synthesizing rebaudioside M, characterized in that, Using rebaudioside D as a substrate, and employing the glycosyltransferase mutant of claim 1 or the whole cell of the host cell of claim 4 as a catalyst, rebaudioside M was obtained by catalysis.

8. The method according to claim 7, characterized in that, The concentration of the substrate is 19.5 g / L to 20.5 g / L.

9. The method according to claim 7, characterized in that, The catalytic conditions are: reaction at 36℃~38℃ for 23.5 h~24.5 h.

10. The method according to claim 7, characterized in that, The catalytic system also includes 55 g / L to 65 g / L sucrose, 4.5 g / L to 5.5 g / L UDP, and 0.08 mol / L to 0.12 mol / L MgCl2.

Images