A basic xylanase mutant with improved specific activity

Abstract

The present application relates to the field of genetic engineering and protein modification technology, and particularly relates to a high specific activity basic xylanase mutant. The xylanase mutant comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 1, and comprises substitution of amino acids at at least one position selected from the group consisting of 7, 12, 21, 23, 24, 25, 26, 29, 30, 31, 34, 37, 38, 39, 40, 41, 42, 43, 44, 51, 54, 91, 92, 100, 102, 103, 109, 118, 119, 122, 123, 132, 134, 141, 142, 144, 145, 150, 151, 152, 156, 167, 168, 169, 172, 173, 175, 183, 184, 186 compared with SEQ ID NO: 1. Compared with the wild type, the specific activity of the mutant is significantly improved, which is conducive to reducing the production cost of the enzyme and promoting its wide application in the industrial field, especially in the papermaking field.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering technology, specifically to a high specific activity basic xylanase mutant and its applications. Background Technology

[0002] Xylan is a polypentose sugar and an important component of plant hemicellulose. It accounts for one-third of the total carbohydrates in plants and is the second most abundant renewable resource in nature after cellulose. It exists in the cell walls of plants and in almost all parts of the plant.

[0003] Xylanases are a class of enzymes that degrade xylan into oligosaccharides or xylose. The complete enzymatic breakdown of a xylan molecule requires several enzymatic reactions. Two types of enzymes act on the backbone: β-1,4-xylanase (1,4-β-D-xylanohydrolase: EC3.1.2.8) and β-xylosidase (1,4-β-D-xylanxylohydrolase: EC3.2.1.37). Generally, the former acts on the xylosidic bonds from within the backbone, breaking down xylan into oligosaccharides, while the latter acts on the ends of xylooligosaccharides, releasing xylose.

[0004] Many microorganisms produce xylanases. The biochemical properties of xylanases have been primarily obtained from studies of bacterial and fungal xylanases. Bacterial xylanases can be broadly classified into two categories: high-molecular-weight acid-resistant xylanases and low-molecular-weight alkali-resistant xylanases. However, this distinction is not observed in fungi; although low-molecular-weight xylanases generally exhibit alkali resistance.

[0005] Xylan in feed is difficult for monogastric animals to digest. When combined with a large amount of water, it increases the volume and viscosity of the digesta in the animal's digestive tract, reducing the activity of nutrients and endogenous enzymes. This hinders the digestion and absorption of nutrients, especially fats and proteins, and reduces feed utilization. Research shows that adding xylanase to feed can significantly reduce the molecular size of arabinoxylan, breaking it down into smaller, less polymeric xylooligosaccharides. This improves feed performance and eliminates or reduces the anti-nutritional effects caused by increased viscosity.

[0006] Xylanase can be used as a biobleaching agent in the paper industry. Its importance in the paper and pulp industry lies in its ability to replace toxic chemicals while recovering useful byproducts through enzymatic pretreatment. Its bleaching effect comes from breaking the bonds between lignin and sugars, relaxing the pulp structure. Scanning electron microscopy studies show that pulp pretreated with xylanase exhibits increased porosity in the pulp fibers, which facilitates its affinity for the bleaching compounds.

[0007] Research has already been conducted on the application of xylanase in the production of wine and Japanese barley shochu. Japanese researchers applied the acid-resistant xylanase Xy1C to the brewing of Japanese barley shochu and found that the enzyme helped improve fermentation efficiency and increase alcohol yield.

[0008] The applications of xylanase in papermaking, food, energy, feed, and environmental fields have been recognized. However, its low expression level in natural materials, difficulty in large-scale production, challenges in product purification, and the fact that some properties of xylan do not fully meet application requirements have led to a surge in research. With the development of genetic engineering technology, using bioreactors to increase its expression level and modify the xylanase gene at the molecular level to address some deficiencies in xylanase activity (such as specific enzyme activity, stress resistance, pH value, and thermal stability) has become a current research hotspot. Summary of the Invention

[0009] The purpose of this invention is to provide a high specific activity alkaline xylanase mutant. The mutant exhibits significantly increased specific activity, which helps reduce the production cost of the enzyme and promotes its widespread application.

[0010] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising, compared with SEQ ID NO:1, an amino acid substitution at at least one position selected from the group consisting of: 7, 12, 21, 23, 24, 25, 26, 29, 30, 31, 34, 37, 38, 39, 40, 41, 42, 43, 44, 51, 54, 91, 92, 100, 102, 103, 109, 118, 119, 122, 123, 132, 134, 141, 142, 144, 145, 150, 151, 152, 156, 167, 168, 169, 172, 173, 175, 183, 184, 186.

[0011] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0012] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0013] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: N7S, D12F, T21S, A23G, P24C / G, G25A, T26D, M29 / S / V, C30V, L31C / F / N / V, G34A, Y37F, S38H / T, T39V / F, Q40T, W41F, R42D / H / S, N43S, T44V / S, K51Q, A54H / N, V91I, E92D, T100S, T102Q, Y103T, T10 9V, E118Q / R, T119S / D, Y122V / F / T / S, N123D / K / Y, T132S, Q134N / D, Q141S / A / E / F / I / L / M / P / W, Q142H / S, R144H / K / Q, T145S / P / V, T150N, V151F / S / T, G152D, D156S, S167T, H168N / S / V, D169N, I172V, L173I, T175V, S183D, S184A, V186I.

[0014] The present invention also relates to DNA molecules encoding the above-mentioned xylanase mutants.

[0015] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0016] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0017] When the above plasmids were transferred into host cells, the specific activity of the recombinant xylanase mutant was significantly improved.

[0018] The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

[0019] The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

[0020] The present invention also provides the application of the above-mentioned xylanase mutant in the field of papermaking.

[0021] Compared with wild-type xylanase MXYL11, the specific activities of the xylanase single-point mutants provided by this invention are significantly improved. Among them, the xylanase mutant containing the T21S single-point mutation has the highest specific activity, reaching 2322.8 U / mg, which is twice that of wild-type xylanase, achieving unexpected technical results.

[0022] The alkaline xylanase mutant provided by this invention has a significantly improved specific activity, which helps to reduce the production cost of the enzyme and promote its widespread application in the industrial field, especially in the papermaking industry. Detailed Implementation

[0023] This invention discloses a xylanase mutant, its preparation method and application, the DNA molecule encoding the xylanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0024] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLSIN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0025] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.

[0026] Culture medium formulation: Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast selection medium (MD medium): 2% peptone, 2% agarose; BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 1% Biotin, 1% Glycerin; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 % Biotin, 0.5% Methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0; Upper culture medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose; Lower culture medium plates: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar.

[0027] The present invention will be further illustrated below with reference to the embodiments.

[0028] Example 1: Construction of expression plasmid

[0029] Derived from Actinobacillus ( Actinobacteria bacterium The xylanase gene (GenBank PZN45477.1) of *Pichia pastoris* was codon-optimized according to codon preference, with the addition of 6 bases GAATTC (EcoR I cleavage site) before the start codon ATG and GCGGCCGC (Not I cleavage site) after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. This xylanase was named MXYL11, with its amino acid sequence SEQ ID NO: 1 and encoding nucleotide sequence SEQ ID NO: 2.

[0030] The xylanase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, plasmid pPIC9K was digested with restriction endonucleases EcoRI and Not I. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation product was transformed into DH5α Escherichia coli (Invitrogen), plated on LB+Amp plates, and incubated upside down at 37°C. After transformants appeared, colony PCR was performed (reaction system: single clones picked from template, rTaq DNA polymerase 0.5 μl, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM): 0.5 μL, 3' AOX primer: 0.5 μL, ddH2O 14.5 μL; reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min) to verify positive clones and perform sequencing analysis. The plasmid was purified from the correctly sequenced E. coli clone using a plasmid mini-preparation kit (Omega). The sequencing results showed that the obtained DNA sequence was SEQ ID NO: 2, and the amino acid sequence it encoded was SEQ ID NO: 1, indicating that the expression plasmid was successfully constructed and named pPIC9K-MXYL11.

[0031] Example 2 Screening of high specific activity mutants

[0032] To further improve the specific activity of xylanase MXYL11, the applicant conducted protein structure analysis. This protein is a family 11 xylanase with a β-jelly roll structure. The applicant screened for a large number of mutations in this enzyme using directed evolution technology.

[0033] 1.1 Design of PCR primers MXYL11-F1 and MXYL11-R1: MXYL11-F1: GGC GAATTCGATACTTGTATCACTCAAAACCAAAC (The underlined area indicates the EcoRI restriction enzyme recognition site). MXYL11-R1: ATA GCGGCCGC TTATCCAATGGTAACAGTTGATGATCC (The underlined part is the NotI restriction enzyme recognition site).

[0034] Using the MXYL11 gene (SEQ ID NO: 1) as a template, PCR amplification was performed using the above primers and the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The transformed product was then transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain Escherichia coli cell lysate containing xylanase.

[0035] 30 μl of lysis buffer was transferred to two new 96-well plates. 30 μl of substrate was added to one well, and the mixture was incubated at 37°C for 30 min. The reducing sugar content was determined using the DNS method. 150 μl of Coomassie Brilliant Blue solution was added to the other well, and the mixture was allowed to stand for 10 min. The protein content was determined using the Coomassie Brilliant Blue (Bradford) binding method. The enzyme activity and protein content of different mutants were calculated. Finally, the applicant screened from over 20,000 transformants for single-point mutants that significantly increased xylanase specific activity: N7S, D12F, T21S, A23G, P24C, P24G, G25A, T26D, M29L, M29S, M29V, C30V, L31C, L31F, L31N, L31V, G34A, Y37F, S38H, and S. 38T, T39V, T39F, Q40T, W41F, R42D, R42H, R42S, N43S, T44V, T44S,, K51Q, A54H, A54N, V91I, E92D, T100S, T102Q, Y103T, T109V, E118Q, E118R, T119S, T119D, Y12 2V, Y122F, Y122T, Y122S, N123D, N123K, N123Y, T132S, Q134N, Q134D, Q141S, Q1 41A, Q141E, Q141F, Q141I, Q141L, Q141M, Q141P, Q141W, Q142H, Q142S, R144H, R 144K, R144Q, T145S, T145P, T145V, T150N, V151F, V151S, V151T, G152D, D156S, S167T, H168N, H168S, H168V, D169N, I172V, L173I, T175V, S183D, S184A, V186I.

[0036] Based on wild-type xylanase MXYL11, this invention provides mutants containing the above-mentioned single mutation sites.

[0037] Example 3 Expression of xylanase in Pichia pastoris

[0038] 3.1 Construction of expression vector The gene sequences of xylanase MXYL11 and its mutants were optimized according to the codon preference of Pichia pastoris. The sequences were synthesized by Shanghai Jereh Biotechnology Co., Ltd., and EcoRI and NotI restriction sites were added at the 5' and 3' ends of the synthesized sequences, respectively.

[0039] Following the method described in Example 1, the gene sequences of the synthesized xylanase MXYL11 and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μl, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM): 0.5 μL, 3' AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clone was verified, and the correct recombinant expression plasmid was obtained after sequencing.

[0040] 3.2 Construction of Pichia pastoris engineered strains 3.2.1 Preparation of competent yeast cells Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30℃ for 48 h. Activated GS115 single clones were then inoculated into 6 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 12 h. The culture was then transferred to Erlenmeyer flasks containing 30 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 4℃ and 9000 rpm for 2 min, and transferred to sterile EP tubes. The supernatant was gently discarded, and the remaining supernatant was blotted dry with sterile filter paper. The cells were resuspended in 1 mL of pre-cooled sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed once more with 1 mL of sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then resuspended in 1 mL of pre-cooled sorbitol (1... Resuspend the bacterial cells in sorbitol (1 mol / L); centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacterial cells in 100-150 μl of pre-cooled sorbitol (1 mol / L).

[0041] 3.2.2 Conversion and Screening The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.

[0042] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm for 1 day with shaking. They were then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking. 0.5% methanol was added daily to induce expression for 4 days. The cells were removed by centrifugation at 9000 rpm for 10 min to obtain fermentation supernatants containing xylanase MXYL11 and xylanase mutant, respectively.

[0043] 1. Method for determining xylanase activity

[0044] (1) Definition of xylanase enzyme activity unit Under conditions of 50℃ and pH 8.0, the amount of enzyme required to degrade and release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / ml is defined as one unit of enzyme activity, denoted by U.

[0045] (2) Method for determining xylanase activity Take 10.0 ml of xylan solution and equilibrate at 50°C for 20 min.

[0046] Take 10.0 ml of appropriately diluted enzyme solution and equilibrate at 50°C for 5 min.

[0047] Blank sample determination: Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, add 5 ml of DNS reagent, and vibrate electromagnetically for 3 s. Then add 2.0 ml of xylan solution, equilibrate at 50℃ for 30 min, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, add water to a final volume of 25 ml, and vibrate electromagnetically for 3-5 s. Using the standard blank sample as a blank control, measure the absorbance A at 540 nm. B .

[0048] Sample determination: Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, then add 2.0 ml of xylan solution (equilibrated at 50℃), vibrate electromagnetically for 3 s, and precisely incubate at 50℃ for 30 min. Add 5.0 ml of DNS reagent, vibrate electromagnetically for 3 s to terminate the enzymatic reaction. Heat in a boiling water bath for 5 min, cool to room temperature with tap water, and dilute to 25 ml with water, vibrating electromagnetically for 3 s. Using a standard blank sample as a blank control, measure the absorbance A at 540 nm. E .

[0049] X D = .

[0050] In the formula: X D — Xylanase activity in the sample dilution, U / ml; A E —Absorbance of the enzyme reaction solution; A B —Absorbance of the enzyme blank sample; K — the slope of the standard curve; C O —The intercept of the standard curve; M — The molar mass of xylose, M(C5MXYL110O5) = 150.2 g / mol; t — Enzymatic hydrolysis reaction time, min; 1000 — conversion factor, 1 mmol = 1000 μmol; X D The value should be between 0.04 and 0.10 U / ml. If it is not within this range, the enzyme dilution should be changed and the analysis should be performed again.

[0051] X = X D ·D f (2) X — Xylanase activity in the sample, U / ml; D f —The dilution factor of the sample.

[0052] (3) Measurement results The enzyme activity was detected using the above method. The results showed that the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain expressing xylanase MXYL11 and its mutant was 300-600 U / mL.

[0053] 2. Protein content determination method

[0054] The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it follows Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.

[0055] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and then the protein content was determined using the Coomassie Brilliant Blue (Bradford) binding method. The protein content was determined using the method described above. The results showed that the protein content of the fermentation supernatant of the recombinant Pichia pastoris strains expressing xylanase MXYL11 and its mutants was 0.321-0.408 mg / mL.

[0056] 3. Specific vitality calculation

[0057] "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.

[0058] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0059] The specific calculation results are shown in Table 1.

[0060] Table 1 Comparison of specific activities of wild-type xylanase and its mutants MXYL11 1161.4 N7S 1300.8 D12F 1289.1 T21S 2322.8 A23G 1324.0 P24C 1428.5 P24G 1405.3 G25A 1393.7 T26D 1358.8 M29L 1318.2 M29S 1365.8 M29V 1420.4 C30V 1393.7 L31C 1382.1 L31F 1370.4 L31N 1335.6 L31V 1353.0 G34A 1361.2 Y37F 1409.9 S38H 1544.7 S38T 1475.0 T39V 1513.3 T39F 1243.9 Q40T 1322.8 W41F 1275.2 R42D 1400.6 R42H 1391.3 R42S 1276.4 N43S 1441.3 T44V 1420.4 T44S 1401.8 K51Q 1319.3 A54H 1329.8 A54N 1671.2 V91I 1367.9 E92D 1393.8 T100S 1254.3 T102Q 1277.3 Y103T 1383.3 T109V 1374.3 E118Q 1330.5 E118R 1343.4 T119S 1320.0 T119D 1357.4 Y122V 1277.4 Y122F 1392.0 Y122T 1369.2 Y122S 1392.0 N123D 1394.7 N123K 1780.4 N123Y 1716.2 T132S 1315.3 Q134N 1349.9 Q134D 1338.2 Q141S 1411.8 Q141A 1393.7 Q141E 1393.3 Q141F 1382.0 Q141I 1332.1 Q141L 1344.6 Q141M 1349.7 Q141P 1316.2 Q141W 1394.9 Q142H 1573.7 Q142S 1509.7 R144H 1342.0 R144K 1445.4 R144Q 1367.4 T145S 1353.3 T145P 1803.4 T145V 1363.7 T150N 1443.7 V151F 1418.2 V151S 1388.6 V151T 1353.4 G152D 1363.6 D156S 1349.8 S167T 1277.3 H168N 1290.3 H168S 1292.6 H168V 1296.5 D169N 1304.4 I172V 1327.7 L173I 1338.3 T175V 1355.7 S183D 1370.2 S184A 1313.7 V186I 1330.4 As can be seen from the results in Table 1, the specific activities of the xylanase single-point mutants provided in this invention are significantly improved compared with wild-type xylanase MXYL11. Among them, the xylanase mutant containing the T21S single-point mutation has the highest specific activity, reaching 2322.8 U / mg, which is twice that of wild-type xylanase, achieving unexpected technical results.

[0061] In summary, the alkaline xylanase mutant provided by this invention has a significantly improved specific activity, which helps to reduce the production cost of the enzyme and promote its widespread application in the industrial field, especially in the papermaking industry.

Claims

1. A xylanase mutant, characterized in that, The mutant is obtained by mutating the 142nd amino acid of xylanase with the amino acid sequence SEQ ID NO:1 from Gln to His.

2. A DNA molecule encoding the xylanase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3.

5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

6. The host cell as described in claim 4, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

7. The application of the xylanase mutant of claim 1 in the papermaking field.