A high specific activity alkaline protease mutant

Abstract

The present application relates to the technical field of genetic engineering and protein engineering, and particularly relates to a high specific activity alkaline protease mutant. Compared with the wild type, the present application provides a mutant containing at least one of the following mutation sites: A173T, T182N, M228I, N289Q, A307V and N322P, and the specific activity of the mutant is significantly improved, which is beneficial to reduce the production cost of the enzyme and promote the wide application of the enzyme in the industrial field.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering modification technology, specifically to a high specific activity alkaline protease mutant. Background Technology

[0002] Proteases are a general term for a class of enzymes that can hydrolyze protein peptide chains. They can hydrolyze proteins into soluble short peptides and free amino acids over a relatively wide pH and temperature range. Based on their optimal pH, proteases can be divided into three types: acidic proteases, with an optimal pH of 2.0–5.0, mainly derived from fungi; neutral proteases, with an optimal pH of 7.0, mainly derived from plants; and alkaline proteases, with an optimal pH of 8.0 and above, mainly derived from microorganisms.

[0003] Microbial proteases are mostly extracellular enzymes, which have advantages such as short growth cycles, high yields, and easy isolation. Alkaline proteases were first discovered in Bacillus licheniformis, and they are mainly studied and applied in Bacillus species, with Bacillus subtilis and Bacillus licheniformis being the most common, and a small number of other species, such as Streptomyces, are also studied.

[0004] Alkaline protease is one of the most important industrial enzyme preparations, with wide applications in various industries. It is a crucial additive in detergents, significantly enhancing their cleaning and detergency. In the food industry, it can hydrolyze protein peptide chains to generate polypeptides and amino acids, altering the taste and nutritional value of food. In the medical industry, it serves as a tool enzyme for protein removal during nucleic acid purification. Furthermore, alkaline protease is widely used in brewing, leather, silk, and photography industries, playing a vital catalytic role.

[0005] The alkaline protease market has experienced steady growth over the past few years, primarily driven by the food and detergent industries. With global population growth and economic development, the food processing industry has become a significant driver of the alkaline protease market. Simultaneously, technological innovation and product diversification have also brought new opportunities to the market. In the future, the alkaline protease market is expected to continue its growth momentum and play a more important role in more fields. However, the current low yield, poor stability, and high production costs of alkaline proteases fail to meet market demand, further hindering their widespread application. Therefore, developing an alkaline protease with high specific activity is particularly important. Summary of the Invention

[0006] To address the problems of existing technologies, this invention provides a high specific activity alkaline protease mutant. The specific activity of this mutant is significantly higher than that of the wild type, and it can be widely used in industrial fields.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention relates to an alkaline protease mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising an amino acid substitution at at least one position selected from the group consisting of: 173, 182, 228, 289, 307, 322 compared with SEQ ID NO:1.

[0008] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0009] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0010] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: A173T, T182N, M228I, N289Q, A307V, N322P.

[0011] In some embodiments of the present invention, the mutant comprises substitutions or combinations of substitutions selected from the following combinations of substitutions: A173T; T182N; M228I; N289Q; A307V; N322P; A173T / T182N; A173T / M228I; A173T / N289Q; A173T / A307V; A173T / N322P; T182N / M228I; T182N / N289Q; T182N / A307V; T182N / N322P; M228I / N289Q M228I / A307V; M228I / N322P; N289Q / A307V; N289Q / N322P; A307V / N322P; A173T / T182N / M228I A173T / T182N / N289Q; A173T / T182N / A307V; A173T / T182N / N322P; A173T / M228I / N289Q; A173T / M228I / A307V A173T / M228I / N289Q A173T / N289Q / N322P; T182N / M228I / N289Q; T182N / M228I / A307V; T182N / M228I / N322P; M228I / N289Q / A307V; M228I / N289Q / N322P; N289Q / A307V / N322P; A173T / T182N / M228I / N289Q; A173T / T182N / M228I / A307V; A173T / T182N / M228I / N322P; A173T / T182N / M228I / N289Q / A307V; A173T / T182N / M228I / N289Q / N322P; A173T / T182N / M228I / N289Q / A307V / N322P.

[0012] The present invention also relates to DNA molecules encoding the above-mentioned alkaline protease mutants.

[0013] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0014] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0015] When the plasmids were transferred into host cells, the specific activity of the recombinant protease mutant was significantly increased.

[0016] In some embodiments of the present invention, the host cell is Bacillus licheniformis (Bacillus licheniformis). Bacillus licheniformis ).

[0017] This invention provides mutants based on wild-type alkaline protease AprE, containing at least one mutation site among A173T, T182N, M228I, N289Q, A307V, and N322P. Compared with the wild type, the specific activity of the single-point mutants provided by this invention is generally increased by 17.9%-85.5%, with the N289Q single-point mutant exhibiting the highest specific activity at 8082 U / mg. The mutants provided by this invention, containing combinations of at least two mutation sites, show a 33.4%-110.2% increase in specific activity compared to the wild type, significantly higher than the corresponding single-point mutants, achieving unexpected technical effects.

[0018] The alkaline protease mutant provided by this invention has high specific activity, which is beneficial to reducing the production cost of the enzyme and promoting its widespread application in the industrial field. Detailed Implementation

[0019] This invention discloses a high-specific-activity alkaline protease mutant, its preparation method and application, the DNA molecule encoding the alkaline protease mutant, the vector, and the host cell. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0020] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLSIN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention: Strains and vectors: Escherichia coli DH5α was preserved in our company, and the expression host BL46 and expression vector pTS were constructed by ourselves.

[0021] Culture medium: LB medium (E. coli medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; LB+Amp medium: LB medium with 100 μg / mL ampicillin; 1* Salt solution: K₂HPO₄ 14g / L; KH₂PO₄ 6g / L; Ammonium sulfate 2g / L; Trisodium citrate 1g / L; MgSO₄·7H₂O 0.2g / L; GMI solution: 95.6 mL of 1* salt solution, 2.5 mL of 20% glucose, 0.4 mL of 5% hydrolyzed casein, and 1 mL of 10% yeast extract; GMII solution: 96.98 mL of 1* salt solution, 2.5 mL of 20% glucose, 0.08 mL of 5% hydrolyzed casein, 0.04 mL of 10% yeast extract, 0.25 mL of 1M MgCl2, and 0.05 mL of 1M CaCl2; Fermentation medium: corn starch 64 g / L, soybean meal 40 g / L, Na2HPO4 4 g / L, KH2PO4 0.3 g / L, high-temperature amylase 0.7 g / L.

[0022] Experimental reagents: DNA polymerase was purchased from Takara, T4 ligase and restriction endonuclease were purchased from Fermentas, plasmid extraction kit and gel purification and recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomais Biotechnology Co., Ltd.

[0023] The present invention will be further described below with reference to specific embodiments.

[0024] Example 1: Extraction of Bacillus licheniformis genome Bacillus licheniformis was streaked on LB agar plates and incubated overnight at 37°C. The next day, a loopful of a single colony was picked and transferred to 20 mL of LB liquid medium, and then incubated at 37°C and 200 rpm until the logarithmic or exponential growth phase.

[0025] Extract total genomic DNA using a bacterial DNA extraction kit (such as the OMEGA bacterial DNA extraction kit or the DNA extraction kit from Beijing TransGen Biotech Co., Ltd.) according to the instructions.

[0026] After extraction, the yield and purity of genomic DNA were measured using a DNA concentration analyzer.

[0027] Example 2: Plasmid construction of a high specific activity alkaline protease mutant Derived from Bacillus licheniformis ( Bacillus licheniformis The amino acid sequence of the alkaline protease AprE is SEQ ID NO: 1, and its encoding nucleotide sequence is SEQ ID NO: 2. Based on the alkaline protease AprE gene, the following primer sequences were designed and synthesized by BGI Genomics Co., Ltd.

[0028] Design PCR primers 1(F) and 1(R): Primer 1 (F): TAAAGAGGAGGAGAGTGAGTA GTCGAC ATGATGAGGAAAAAGAGTT (underlined characters represent restriction endonucleases) Sal I. Identification site); Primer 1(R): GAACCTGCTTCTTTTTACTA ACGCGT ATGGATCCTTATTGAGCGGC (underlined characters represent restriction endonucleases) Mlu I. Identification site).

[0029] Using the genome extracted from Bacillus licheniformis as a template, PCR amplification was performed using the above primers with the GeneMorph II Random Mutation PCR Kit (Bomais); the PCR products were recovered from the gel. Sal I, Mlu After enzyme digestion, I was ligated into the pTS vector, which had also been digested with the same enzymes, and transformed into E. coli DH5α. The transformed samples were plated on LB+Amp plates and incubated upside down at 37°C. Once transformants appeared, they were picked up with a toothpick for PCR verification. Positive transformants were transferred to LB+Amp liquid medium and incubated overnight. Plasmids were extracted using a plasmid extraction kit.

[0030] Example 3: Transformation screening of high specific activity alkaline protease mutants The correctly sequenced recombinant plasmids were transformed into competent Bacillus licheniformis cells. The specific transformation process was as follows: A single BL4 colony growing on an LB agar plate was picked with a pipette tip and placed in 2 mL of GMⅠ, and cultured for 12 h; the overnight culture was added to 98 mL of GMⅠ and cultured at 37℃ and 200 rpm for approximately 4 h; 10 mL of the culture was added to 90 mL of GMⅡ and cultured at 37℃ and 200 rpm for approximately 1.5 h; the cells were then incubated in an ice-water bath for 30 min, centrifuged at 4000 rpm and 4℃ for 30 min, and the supernatant was discarded; 10 mL of GMⅢ was added and mixed well to obtain competent cells. Then, 5 μL of recombinant plasmid was added to 500 μL of competent cells, and the cells were directly cultured on a shaker at 37℃ and 200 rpm for 1.5 h, centrifuged at low speed for 3 min, some supernatant was discarded, and the cells were evenly spread onto agar plates containing 10 μg / mL chloramphenicol in skim milk powder and incubated at 37℃ for 12 h. The single colony on the plate the next day is the recombinant strain.

[0031] The recombinant engineered bacteria were inoculated into 5 mL of LB liquid medium (1% peptone, 1% NaCl, 0.5% yeast extract), and 10 μg / mL of chloramphenicol was added. The culture was carried out at 37°C with shaking at 200 rpm for 12 h. The bacterial solution was then transferred to fermentation enzyme production medium in 24-well deep-well plates at a 2% inoculation rate and cultured at 37°C with shaking at 200 rpm for 48 h to prepare alkaline protease solution.

[0032] The alkaline protease activity of the above enzyme solutions was measured and compared with that of wild-type alkaline protease AprE. Ultimately, six recombinant strains with significantly increased alkaline protease activity were screened.

[0033] Sequencing analysis revealed that the alkaline protease mutants expressed by the six recombinant strains were all single-point mutants, each containing six mutation sites: A173T, T182N, M228I, N289Q, A307V, and N322P.

[0034] Example 4: Shake-flask fermentation verification The recombinant strain was inoculated into 5 mL of LB liquid medium (containing kanamycin, 10 μg / mL) and cultured overnight at 37°C and 220 rpm. Then, it was transferred to 50 mL of fermentation medium at a 2% inoculation rate and cultured for another 48 h at 37°C and 220 rpm. The supernatant was collected as the crude enzyme solution, and the alkaline protease activity and protein content of the obtained enzyme solution were determined. The specific activity was calculated. Specific results are shown in Table 1.

[0035] Table 1. Comparison of specific activities of single-point mutants of alkaline protease alkaline protease Enzyme activity (U / mL) Protein content (mg / mL) Specific activity (U / mg) Wild-type APRE 7885 1.81 4356 A173T single-point mutant 11120 1.86 5270 T182N single-point mutant 13094 2.11 6210 M228I single-point mutant 18925 2.50 7570 N289Q single-point mutant 20771 2.57 8082 A307V single-point mutant 17625 2.61 6753 N322P single-point mutant 16214 3.16 5136 As shown in Table 1, compared with the wild type, the mutants provided by this invention containing single mutation sites of A173T, T182N, M228I, N289Q, A307V, and N322P generally showed an increase in specific activity of 17.9%-85.5%; among them, the N289Q single-site mutant had the highest specific activity, reaching 8082 U / mg, achieving unexpected technical effects.

[0036] Furthermore, this invention also provides mutants comprising at least two mutation sites selected from A173T, T182N, M228I, N289Q, A307V, and N322P, such as: A173T / T182N, A173T / M228I, A173T / N289Q, A173T / A307V, A173T / N322P, T182N / M228I, T182N / N289Q, T182N / A307V, T182N / N322P, M228I / N289Q, M228I / A307V, M228I / N322P, N289Q / A307V, N289Q / N322P, A307V / N322P two-point mutants; A173T / T182N / M228I, A173T / T182N / N28 9Q, A173T / T182N / A307V, A173T / T182N / N322P, A173T / M228I / N289Q, A173T / M228I / A307V, A 173T / M228I / N289Q, A173T / N289Q / N322P, T182N / M228I / N289Q, T182N / M228I / A307V, T182N / M228I / N322P, M228I / N289Q / A307V, M228I / N289Q / N322P, N289Q / A307V / N322P three-point mutants; A173T / T182N / M228I / N289Q, A173T / T182N / M228I / A307V, A173T / T182N / M228I / N322P four-point mutants; A173 The five-point mutants T / T182N / M228I / N289Q / A307V and A173T / T182N / M228I / N289Q / N322P, and the six-point mutant A173T / T182N / M228I / N289Q / A307V / N322P, showed a further increase in specific activity compared to the corresponding single-point mutants, and an increase of 33.4%-110.2% compared to the wild type, achieving unexpected technical results.

[0037] In summary, the six mutation sites A173T, T182N, M228I, N289Q, A307V and N322P provided by this invention can significantly improve the specific activity of the alkaline protease APRE, thereby helping to reduce the production cost of the enzyme and promoting its widespread application in the industrial field.

[0038] Alkaline protease activity assay Under specific temperature and pH conditions, proteases hydrolyze casein substrates to produce amino acids containing phenolic groups (such as tyrosine and tryptophan). Under alkaline conditions, Folin reagent reduces these amino acids to produce molybdenum blue and tungsten blue. The absorbance of the solution is measured at a wavelength of 680 nm using a spectrophotometer. Enzyme activity is directly proportional to absorbance, and thus the enzyme activity of the product can be calculated. The definition of protease activity, expressed in units, is as follows: 1 unit of enzyme activity is defined as the amount of 1 μg of tyrosine produced by hydrolyzing casein in 1 minute under specific temperature and pH conditions, expressed as μ / g (μ / ml).

[0039] 1. Reagents and solutions (1) Folin reagent (Folin:water = 1:2); (2) 42.4 g / L sodium carbonate solution; (3) 0.5 mol / L sodium hydroxide solution; (4) borate buffer (pH 10.5); (5) 10.0 g / L casein solution; (6) 100 μg / mL and 1 mg / mL L-tyrosine standard solutions; (7) 6.54% trichloroacetic acid.

[0040] 2. Enzyme activity assay (1) Preparation of standard curve: Prepare L-tyrosine standard solutions with concentrations of 0 μg / mL, 10 μg / mL, 20 μg / mL, 30 μg / mL, 40 μg / mL and 50 μg / mL. Take 1.00 mL of each standard solution, add 5.00 mL of 0.4 mol / L sodium carbonate solution and 1.00 mL of Folin reagent working solution, shake well, and place in a 40℃ water bath for color development for 20 min. Remove and use a spectrophotometer at a wavelength of 680 nm in a 10 mm cuvette, with the tyrosine-free tube 0 as a blank, and measure the absorbance of each. Plot the standard curve with absorbance A as the ordinate and the tyrosine concentration C as the abscissa (this line should pass through the zero point).

[0041] 3. Enzyme activity assay Take 1 ml of pre-diluted enzyme solution, then add 1 ml of 10% casein preheated at 40°C, and react at 40°C for 10 min. Then add 2 ml of trichloroacetic acid (6.54%), mix well, and let stand at room temperature for 10 min to terminate the reaction. Take 1 ml of the terminated reaction solution, then add 5 ml of 42.4 g / L sodium carbonate solution, followed by 1 ml of Folin reagent, and incubate at 40°C for 20 min. Finally, measure the OD. 680 value.

[0042] 4. Calculation Read the enzyme activity of the final diluted sample from the standard curve, in μ / mL. The enzyme activity of the sample is calculated using the following formula: X=A×K×4 / 10×n=2 / 5×A×K×n.

[0043] Where: X — enzyme activity of the sample (μ / g or μ / ml); A—The average absorbance of the sample in parallel tests; K—absorption constant; 4 — Total volume of reaction reagents (ml); 10 — Reaction time 10 min, calculated as 1 min; n – dilution factor.

[0044] (ii) Protein content detection 1. Reagents (1) Coomassie Brilliant Blue G-250 staining solution: Dissolve 100mg of Coomassie Brilliant Blue G-250 in 50mL of 95% ethanol, add 100mL of 85% phosphoric acid, dilute with water to 1L, and it can be used at room temperature for 1 month; (2) Standard protein solution: Bovine serum albumin was used to determine the protein content in advance by micro-Kjeldahl nitrogen determination method, and a protein standard solution of 1 mg / mL was prepared according to its purity. (3) Preparation of standard stock solution: Accurately weigh 0.05 g of crystalline bovine serum albumin into a small beaker, add a small amount of distilled water to dissolve it, and then transfer it to a 50 mL volumetric flask. Rinse the remaining liquid in the beaker several times with a small amount of distilled water, and pour the rinsing solution into the volumetric flask. Finally, dilute to the mark with distilled water to prepare the standard stock solution, in which the concentration of bovine serum albumin is 1000 μg / mL.

[0045] 2. Plotting the standard curve.

[0046] (1) Take 6 test tubes, number them, add the reagents according to the table below, and mix well.

[0047] Pipe number 1 2 3 4 5 6 Sample (mL) 0 0.1 0.2 0.3 0.4 0.5 Water (mL) 2.0 1.9 1.8 1.7 1.6 1.5 Protein content (mg / mL) 0 0.05 0.1 0.15 0.2 0.25 Accurately pipette 2.5 mL of Coomassie Brilliant Blue solution into 6 clean test tubes. Accurately pipette 0.1 mL of the solution from each of the above tubes into their respective numbered test tubes. Vortex to mix well, let stand at room temperature for 5 min, zero the test tube with test tube number 1, and measure the absorbance at 595 nm. Record the absorbance value.

[0048] Plot the standard curve: Record the absorbance values ​​of tubes 1-6, and plot the standard curve with protein content (μg) on ​​the x-axis and absorbance on the y-axis. Note that because Coomassie Brilliant Blue has a strong staining ability, the cuvettes must be thoroughly cleaned. Quartz cuvettes cannot be used.

[0049] 3. Sample determination Sample preparation: (1) Liquid samples: Dilute the sample to be tested to a protein content of 0.1-0.3 mg / mL, and control the absorbance value after removing the blank (after subtracting the blank) to be between 0.2-0.4; (2) Solid sample: Accurately weigh 1.0000g of sample into a 100mL Erlenmeyer flask, add 20mL of deionized water with a pipette, stir magnetically for 10min, centrifuge at 4000rpm for 10min, take the supernatant for further dilution to determine the protein content, and refer to the liquid sample for dilution method.

[0050] Sample testing: Take a clean test tube, add 2.5 mL of Coomassie Brilliant Blue solution, then add the sample to be tested, vortex and shake well, let stand at room temperature for 5 min, use the standard curve blank as a control, and measure the absorbance at 595 nm using a micro cuvette with a 1 cm optical path. Calculate the protein content according to the standard curve.

[0051] 4. Protein content calculation Protein content = X × dilution factor × standard conversion factor.

[0052] X: Protein content (mg / mL) determined from the standard curve; Standard value conversion: The standard is 47 mg / mL. A coefficient is calculated based on the measured value.

[0053] (III) Specific vitality calculation Specific activity refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.

[0054] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

Claims

1. An alkaline protease mutant, characterized in that, The mutant comprises an amino acid sequence having at least 90% identity with SEQ ID NO:1, and contains an amino acid substitution at at least one position selected from the group consisting of: 173, 182, 228, 289, 307, 322 compared to SEQ ID NO:

1.

2. The mutant as described in claim 1, characterized in that, The amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:

1.

3. The mutant as described in claim 2, characterized in that, The amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:

1.

4. The mutant as described in claim 2, characterized in that, The mutant contains a substitution of at least one amino acid from the following group: A173T, T182N, M228I, N289Q, A307V, N322P.

5. The mutant as described in claim 4, characterized in that, The mutant contains substitutions or combinations of substitutions selected from the following substitutions and combinations of substitutions: A173T; T182N; M228I; N289Q; A307V; N322P; A173T / T182N; A173T / M228I; A173T / N289Q; A173T / A307V; A173T / N322P; T182N / M228I; T182N / N289Q; T182N / A307V; T182N / N322P; M228I / N289Q M228I / A307V; M228I / N322P; N289Q / A307V; N289Q / N322P; A307V / N322P; A173T / T182N / M228I A173T / T182N / N289Q; A173T / T182N / A307V; A173T / T182N / N322P; A173T / M228I / N289Q; A173T / M228I / A307V A173T / M228I / N289Q A173T / N289Q / N322P; T182N / M228I / N289Q; T182N / M228I / A307V; T182N / M228I / N322P; M228I / N289Q / A307V; M228I / N289Q / N322P; N289Q / A307V / N322P; A173T / T182N / M228I / N289Q; A173T / T182N / M228I / A307V; A173T / T182N / M228I / N322P; A173T / T182N / M228I / N289Q / A307V; A173T / T182N / M228I / N289Q / N322P; A173T / T182N / M228I / N289Q / A307V / N322P.

6. A DNA molecule encoding any of the mutants described in claims 1-5.

7. A recombinant expression plasmid comprising the DNA molecule of claim 6.

8. A host cell comprising the recombinant expression plasmid of claim 7.

9. The host cell as described in claim 8, characterized in that, The host cell is Bacillus licheniformis (Bacillus licheniformis) Bacillus licheniformis ）。