Aspartate racemase mutant, recombinant genetically engineered strain and application thereof

Abstract

The application relates to an aspartate racemase mutant, a recombinant genetically engineered strain and application, wherein the amino acid sequence of the aspartate racemase mutant G245A / I247V is shown in SEQ ID NO. 8; compared with a wild-type aspartate racemase, the conversion rate of a substrate L-aspartate is obviously improved; the enzyme activity of the mutant G245A / I247V reaches 393.4 U / mg, which is 1.89 times of 208.3 U / mg of the wild-type enzyme; the conversion rate of L-aspartate can reach 100%, which is 2.4 times of the wild-type enzyme. The application not only obtains a green and efficient biological catalyst, but also lays a theoretical and technical foundation for green biological manufacturing of chiral amino acids.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to an aspartic acid racemic enzyme mutant, a recombinant genetically engineered strain, and its applications. Background Technology

[0002] D-Aspartic acid (D-Asp) is a non-protein amino acid widely found in the nervous tissue, endocrine glands, and brain tissue of invertebrates in nature. Studies have shown that D-Aspartic acid plays an important physiological role in neuroendocrine regulation, hormone secretion promotion, learning and memory enhancement, and reproductive system development. It also has broad application prospects in medicine, functional foods, and cosmetics.

[0003] Traditional D-aspartic acid preparation processes primarily rely on chemical synthesis, which requires the use of large quantities of toxic chemical reagents and generates high-concentration acidic and alkaline wastewater, resulting in high raw material costs and significant environmental pollution. Currently, the mainstream industrial technology for D-aspartic acid preparation is a bio-enzymatic coupling resolution process dependent on aspartate racemase (AspR). Aspartate racemase is a key enzyme capable of catalyzing the direct interconversion between L-aspartic acid and D-aspartic acid. Essentially, it is a pyridoxal-5'-phosphate (PLP)-dependent racemase. This enzyme can directly use readily available and inexpensive L-aspartic acid as a substrate, generating D-aspartic acid through a racemic reaction. This D-aspartic acid is then catalyzed by a dual-enzyme cascade with L-aspartate β-decarboxylase, continuously accumulating D-aspartic acid. Subsequent simple steps such as ion exchange purification and isoelectric point crystallization yield the high-purity target product.

[0004] Compared to traditional chemical synthesis routes, this bio-enzymatic method offers readily available raw materials, mild reaction conditions, and lower production costs. It can significantly reduce emissions of waste liquids and solid wastes, demonstrating significant green and low-carbon advantages, aligning with the development trend of pollution reduction and carbon reduction, and green industrial upgrading in the chemical industry. However, currently used aspartic acid racemic enzymes are mostly natural enzyme sources. These wild-type enzymes generally suffer from low catalytic efficiency and poor substrate tolerance, making it difficult to meet the industrial application requirements for efficient D-aspartic acid preparation. Therefore, constructing aspartic acid racemic enzymes with both high catalytic activity and high substrate tolerance is particularly important. Summary of the Invention

[0005] The purpose of this invention is to overcome the defects in the prior art and provide an aspartic acid racemic enzyme mutant, a recombinant genetically engineered strain and its application. The enzyme activity and L-aspartic acid conversion rate of the aspartic acid racemic enzyme mutant are greatly improved, and it has the characteristics of high catalytic efficiency and good substrate tolerance.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: Technical Solution 1: A mutant of aspartate racemase is obtained by performing any one of the following AC mutations on wild-type aspartate racemase with the amino acid sequence shown in SEQ ID NO.2; wherein, A: The 245th position is mutated from glycine to alanine; B: The 247th position is mutated from isoleucine to valine; C: The 245th position is changed from glycine to alanine and the 247th position is changed from isoleucine to valine.

[0007] Among them, the mutant G245A / I247V obtained by the C mutation has the activity of catalyzing the racemization of L-aspartic acid to D-aspartic acid. Its enzyme activity is 1.9 times that of the wild-type enzyme. When the reaction is carried out with 2 mol / L L-aspartic acid as substrate, L-aspartic acid can be completely racemized to DL-aspartic acid in 24 hours, and the conversion rate is 2.4 times that of the parent.

[0008] As a further technical solution, an aspartate racemic enzyme mutant, the amino acid sequence of which is shown in any one of SEQ ID NO.4, SEQ ID NO.6, and SEQ ID NO.8.

[0009] Among them, the amino acid sequence of SEQ ID NO.4 is obtained by mutating glycine to alanine at position 245 of the wild-type aspartic acid racemase shown in SEQ ID NO.2; For example, the amino acid sequence of SEQ ID NO. 6 is obtained by mutating isoleucine to valine at position 247 of the wild-type aspartic acid racemase shown in SEQ ID NO. 2; For example, the amino acid sequence of SEQ ID NO. 8 is obtained by mutating glycine to alanine at position 245 and isoleucine to valine at position 247 of the wild-type aspartic acid racemase shown in SEQ ID NO. 2. As a further technical solution, the amino acid sequence shown in any one of SEQ ID NO. 4, SEQ ID NO. 6, or SEQ ID NO. 8 has at least 95% homology with the amino acid sequence shown in SEQ ID NO. 2.

[0010] Technical Solution Two: A polynucleotide sequence encoding the aspartate racemic enzyme mutant, comprising the nucleotide sequence shown in any one of SEQ ID NO. 3, SEQ ID NO. 5, and SEQ ID NO. 7.

[0011] As a further technical solution, the nucleotide sequence encoding the polynucleotide sequence (mutant G245A) shown in SEQ ID NO.4 is shown in SEQ ID NO.3, or is a nucleotide sequence codon-optimized from the nucleotide sequence shown in SEQ ID NO.3.

[0012] As a further technical solution, the nucleotide sequence encoding the polynucleotide sequence (mutant I247V) shown in SEQ ID NO. 6 is as shown in SEQ ID NO. 5, or is a nucleotide sequence codon-optimized from the nucleotide sequence shown in SEQ ID NO. 5.

[0013] As a further technical solution, the nucleotide sequence encoding the polynucleotide sequence shown in SEQ ID NO. 8 (mutant G245A / I247V) is shown in SEQ ID NO. 7, or is a nucleotide sequence codon-optimized from the nucleotide sequence shown in SEQ ID NO. 7.

[0014] As a further technical solution, regulatory elements for regulating the expression of the nucleic acid molecule in prokaryotic host cells are cis-linked upstream and / or downstream of the nucleic acid molecule.

[0015] As a further technical solution, the regulatory element includes at least one of the following: T7 promoter, lac operon, ribosome binding site, and transcription terminator.

[0016] Technical Solution 3: A recombinant expression vector carrying the nucleic acid molecule.

[0017] As a further technical solution, the recombinant expression vector is a pET series prokaryotic expression vector.

[0018] Technical Solution Four: A recombinant genetically engineered bacterium, obtained by transforming the recombinant expression vector into a host cell.

[0019] As a further technical solution, the host cell includes Escherichia coli.

[0020] Technical Solution 5: A method for preparing the aspartate racemic enzyme mutant includes the following steps: Step 1: After activating the recombinant genetically engineered bacteria, inoculate them into liquid culture medium for induction culture to heterologously express the aspartic acid racemic enzyme mutant. The inducer is isopropyl-β-D-thiogalactoside, and the final concentration of the inducer is 0.1 mM. The induction culture temperature is 20 ℃, and the induction culture time is 20 h.

[0021] Step 2: Collect the bacterial cells from the culture medium obtained by induction culture, and then obtain a crude enzyme solution containing the aspartic acid racemic enzyme mutant by ultrasonic disruption and centrifugation solid-liquid separation. Purify the crude enzyme solution to obtain the purified aspartic acid racemic enzyme mutant protein.

[0022] Technical Solution Six: Application of the aforementioned aspartic acid racemic enzyme mutant in the enzymatic conversion of L-aspartic acid to D-aspartic acid.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. Compared with the original aspartate racemic enzyme, the G245A / I247V mutant of the present invention significantly improves the conversion efficiency of the substrate L-aspartate. Its enzyme activity is 393.4 U / mg, which is 1.9 times that of the wild-type enzyme (208.3 U / mg). The increased enzyme activity means higher catalytic efficiency per unit enzyme protein, resulting in a higher reaction rate with the same amount of enzyme.

[0024] 2. The aspartic acid racemic enzyme mutant G245A / I247V of the present invention uses 2 mol / L L-aspartic acid as a substrate to construct a reaction system. Under the conditions of 37 ℃, pH 8.0 and 600 rpm for 24 h, L-aspartic acid is racemic to D-aspartic acid. After separation and purification, the molar ratio of L-aspartic acid to D-aspartic acid is about 1:1, which is almost completely racemic.

[0025] 3. Compared with the original aspartic acid racemic enzyme, the G245A / I247V mutant of the present invention exhibits superior catalytic activity in both the preset temperature and preset pH ranges compared with the wild type.

[0026] 4. The preferred catalytic temperature for the aspartic acid racemic enzyme mutant is 37 °C, and the preferred pH is 8.0. The reaction conditions are mild. Compared with the harsh reaction conditions required by traditional chemical synthesis methods, such as high temperature, high pressure, and the use of heavy metal catalysts, it has the advantages of high catalytic efficiency, low reaction cost, and green safety. Attached Figure Description

[0027] Figure 1 This is an SDS-PAGE electrophoresis image of the aspartic acid racemic enzyme and its mutants of the present invention; exist Figure 1In the table, Marker: Protein molecular weight standard; Lane 1: Wild-type cell lysate supernatant; Lane 2: Wild-type purified protein; Lane 3: G245A mutant cell lysate supernatant; Lane 4: G245A mutant purified protein; Lane 5: I247V mutant cell lysate supernatant; Lane 6: I247V mutant purified protein; Lane 7: G245A / I247V mutant cell lysate supernatant; Lane 8: G245A / I247V mutant purified protein. Figure 2 This is a figure showing the results of the study on the optimal temperature of the aspartic acid racemic enzyme and its mutants of the present invention. Figure 3 This is a figure showing the results of the study on the optimal pH of the aspartic acid racemic enzyme and its mutants of the present invention. Figure 4 This is a figure showing the results of the study on the thermal stability of the aspartic acid racemic enzyme and its mutants according to the present invention; Figure 5 This is a graph showing the results of the study on the thermal stability and enzyme activity of the aspartic acid racemic enzyme and its mutants according to the present invention; Figure 6 This is a figure showing the results of the study on the pH stability of the aspartic acid racemic enzyme and its mutants according to the present invention; Figure 7 This is a graph showing the results of the study on the pH stability of the aspartic acid racemic enzyme and its mutants compared to the enzyme activity of the present invention. Figure 8 This is a diagram showing the results of the study on the whole-cell catalysis of L-aspartic acid by the aspartic acid racemic enzyme and its mutants according to the present invention. Detailed Implementation

[0028] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0029] The terms “comprising,” “including,” “having,” “containing,” or any other variations thereof, as used herein, are intended to cover non-exclusive inclusion. For example, a composition, step, method, article, or apparatus that includes the listed elements is not necessarily limited to those elements, but may include other elements not expressly listed or elements inherent to such composition, step, method, article, or apparatus.

[0030] In this invention, the expression regulatory element refers to a functional nucleic acid sequence capable of driving the transcription and translation of the target coding nucleic acid molecule in the host cell, including but not limited to promoters, operons, ribosome binding sites, and transcription terminators.

[0031] In this invention, the cis-linking refers to the sequential linking of the expression regulatory element and the target coding nucleic acid molecule in a manner that enables the expression regulatory function, i.e., the operably linked linking as commonly referred to in the art.

[0032] In this invention, the recombinant expression vector refers to all recombinant nucleic acid molecules that can carry foreign genes into host cells and achieve their expression, including various types such as recombinant plasmids, recombinant bacteriophages, recombinant viral vectors, and recombinant artificial chromosomes.

[0033] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0034] 1. Conversion rate calculation formula: Conversion rate % = (Change in substrate concentration ΔC / Initial substrate concentration C0) × 100%.

[0035] 2. Enzyme activity definition: The amount of enzyme required to generate 1 μmol L-aspartic acid per minute under reaction conditions of 37 ℃ is defined as one enzyme activity unit.

[0036] 3. Assay method for aspartate racemic enzyme activity: Add 2 μg / mL enzyme solution to a 1 mL centrifuge tube, add 100 mM phosphate buffer solution (pH 8.0) containing 0.1 mM PLP to a final concentration of 2 mol / L L-aspartic acid, and react at 37 ℃ and pH 8.0 for 2 h before detecting enzyme activity.

[0037] 4. Quantitative detection of L-aspartic acid: HPLC method was used, specifically: HPLC detection was performed at a wavelength of 200 nm (CROWNPAK CR(+), 4 × 150 mm × 5 µm), the mobile phase was perchloric acid aqueous solution (pH 2.0), isocratic elution was performed for 10 min, the injection volume was 5 μL, the flow rate was 0.4 mL / min, and the column temperature was 0 ℃.

[0038] 5. The aspartate racemic enzyme of the present invention belongs to type II PLP-dependent enzyme.

[0039] 6. Unless otherwise specified, all raw materials used in this invention are commercially available.

[0040] Example 1: Cloning and functional verification of wild-type aspartate racemase from bivalve mollusks (Scapharca broughtonii) (parental template of mutant) 1.1 Experimental Materials PCR product purification kits and agarose gel extraction kits were purchased from Sangon Biotech (Shanghai) Co., Ltd.; high-fidelity DNA polymerase, dNTPs, DNA Marker, pET-28a(+) prokaryotic expression vector, Escherichia coli DH5α, and Escherichia coli BL21(DE3) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; primer synthesis and DNA sequencing were performed by Sangon Biotech (Shanghai) Co., Ltd.

[0041] 1.2 Cloning of wild-type aspartate racemase The target gene was obtained through whole-genome synthesis: bivalve mollusks were selected from the NCBI public database. Scapharca broughtonii The target gene sequence was obtained from GenBank: AB231327.1, and the target protein sequence was obtained from GenBank: BAE78960.1. Then, the entire gene was synthesized. The synthesized target gene fragment was double-digested with the pET-28a vector at a molar ratio of 3:1. Nde I, EcoR I) Processing: Enzyme digestion temperature was 37 ℃. The target gene fragment and vector fragment were recovered and purified (operation strictly followed the FAVORGEN DNA agarose gel extraction kit instructions). The recovered target gene fragment and vector fragment were ligated overnight at 16 ℃ to obtain the ligation product.

[0042] The ligation product was transformed into *E. coli* DH5α competent cells and evenly spread on the surface of kanamycin-resistant solid LB agar plates. The plates were incubated upside down at 37 °C for 16 h. Single colonies were picked from the plates for positive clone identification. Correctly identified positive clones were inoculated into LB liquid medium (medium components: 10 g / L sodium chloride, 10 g / L tryptone, 5 g / L yeast extract) and incubated at 37 °C with shaking at 180 rpm for 8 h.

[0043] After culturing, the recombinant plasmid was extracted and sequenced for verification. The sequencing results showed that the inserted gene sequence was completely consistent with the target sequence, and the recombinant plasmid pET-28a-SbAspR containing the aspartate racemic enzyme gene was successfully constructed. The verified recombinant plasmid was aliquoted and stored at -20 °C for later use.

[0044] 1.3 Sequence Analysis and Functional Validation Sequence analysis: The sample was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results showed that the amplified target gene was 1017 bp in length, and the nucleotide sequence is shown in SEQ ID NO.1. It was named SbAspR (wild-type aspartate racemase gene). SbAspR This gene encodes 339 amino acids, namely wild-type aspartate racemic enzyme SbAspR (abbreviated as wild-type enzyme WT), and its amino acid sequence is shown in SEQ ID NO.2.

[0045] Stereoselectivity and basic enzyme activity verification: The recombinant plasmid pET-28a-SbAspR was transformed into Escherichia coli BL21(DE3) to obtain the wild-type engineered strain BL21(DE3)-pET-28a-SbAspR. After IPTG induction for expression and purification, the strain was subjected to a catalytic reaction using L-aspartic acid as a substrate.

[0046] Example 2: Construction of the DH5α engineered strain containing the aspartic acid racemic enzyme mutant 2.1 Experimental Materials Site-directed saturation mutagenesis kit and high-fidelity DNA polymerase were purchased from Sangon Biotech (Shanghai) Co., Ltd.; CROWNPAK CR(+) column was purchased from Daicel Chiral Pharmaceuticals (Shanghai) Co., Ltd.; other reagents and consumables were the same as in Example 1.

[0047] 2.2 Determination of mutation sites Based on the SWISS-MODEL homology modeling results of the wild-type aspartate racemic enzyme SbAspR, molecular docking analysis of the amino acid residues in the substrate binding pocket was performed, identifying two key sites that directly affect the steric hindrance of the substrate binding pocket, substrate affinity, and catalytic efficiency: G245 and I247. This study employed a semi-rational design strategy to perform site-directed double mutations at these two key sites, constructing SbAspR double-site mutants to investigate the effects of these two-site co-mutations on the enzyme's catalytic performance and stability.

[0048] 2.3 Iterative construction and screening of mutants in rounds In this embodiment, the glycine G at position 245 of wild-type aspartic acid racemic enzyme SbAspR was mutated to alanine A, phenylalanine F, methionine M, isoleucine I, leucine L, valine V, serine S, threonine T, or tyrosine Y for screening of mutations at position 245; among them, the mutation to alanine A had the best effect. The isoleucine I at position 247 was mutated into valine V, methionine M, leucine L, valine V, and alanine A to screen for the amino acid at position 247; among them, the mutation into valine V yielded the best results.

[0049] 2.3.1 Half-saturation mutation at the G245 site and screening for the optimal mutant The recombinant plasmid pET-28a-SbAspR-G245A, the aspartate racemic enzyme mutant gene used in this invention, is obtained by using the recombinant plasmid pET-28a-SbAspR as a template and primer pair ① as primers.

[0050] ①Forward: 5'-attaccacattgttgtaaaataattgcatcagctatagtatctaagaactg -3'; ① Reverse: 5'-cagttcttagatactatagctgatgcaattattttacaacaatgtggtaat -3'.

[0051] Using the wild-type recombinant plasmid pET-28a-SbAspR constructed in Example 1 as a template, full plasmid PCR amplification was performed: The PCR amplification system is as follows (25 μL): 12.5 μL of 2×Phanta® Max Buffer, 0.5 μL of dNTP Mix, 2 μL of primers, 1 μL of template, 0.5 μL of Phanta® Max Super-Fidelity DNA Polymerase, 1 μL of DMSO, and ddH2O to a final volume of 25 μL.

[0052] PCR amplification conditions: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, 56 ℃ annealing for 20 s, 72 ℃ extension for 5 min 30 s, 15 cycles; 72 ℃ final extension for 10 min.

[0053] The PCR product was digested with Dpn I enzyme to extract the template plasmid and then transformed into *E. coli* DH5α competent cells. All bacterial culture was spread onto LB agar plates containing kanamycin (50 μg / mL). After complete absorption, the plates were incubated at 37°C upside down for 16 h. Single colonies were picked and inoculated into 3 mL of LB liquid medium containing kanamycin (test tubes), and incubated at 37°C and 180 rpm for 8 h. Full-length sequencing was performed, and the encoded nucleotide sequence is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4. All mutation sites were confirmed to be accurate, with no other random mutations, yielding mutant G245A. The recombinant expression vector pET-28a-SbAspR-G245A was transformed into Escherichia coli DH5α competent cells to obtain the engineered strain DH5α-pET-28a-SbAspR-G245A with the mutant G245A.

[0054] 2.3.2 Half-saturation mutation at the I247 site and screening for the optimal mutant The recombinant plasmid pET-28a-SbAspR-I247V, an aspartate racemic enzyme mutant gene used in this invention, was obtained by using the recombinant plasmid pET-28a-SbAspR as a template and primer pair ② as primers.

[0055] ② Positive direction: 5'-cgttttattaccacattgttgtaaaacaattccatcagctatagtatctaaga-3'; ② Reverse: 5'-tcttagatactatagctgatggaattgttttacaacaatgtggtaataaaacg-3'.

[0056] Using the wild-type recombinant plasmid pET-28a-SbAspR constructed in Example 1 as a template, full plasmid PCR amplification was performed: The PCR amplification system, amplification program, Dpn I digestion, transformation, plate culture, and liquid culture conditions were the same as in 2.3.1. Full-length sequencing results of the single-clone plasmid showed that the mutant I247V encoded the nucleotide sequence SEQ ID NO.5 and the amino acid sequence SEQ ID NO.6, with no deviation in the mutation site and no random mutations.

[0057] The recombinant expression vector pET-28a-SbAspR-I247V was transformed into Escherichia coli DH5α competent cells to obtain the engineered strain DH5α-pET-28a-SbAspR-I247V.

[0058] 2.3.3 Construction of G245A / I247V two-point combination mutant Using the highest quality plasmid pET-28a-SbAspR-G245A obtained in the first round as a template, primer pair ③ below was used as primers to semi-rationally design mutation primers for the I247 site, and the recombinant plasmid pET-28a-SbAspR-G245A / I247V was obtained. ③ Positive: 5'-cgttttattaccacattgttgtaaaacaattgcatcagctatagtatctaaga-3'; ③ Reverse: 5'-tcttagatactatagctgatgcaattgttttacaacaatgtggtaataaaacg-3'.

[0059] The PCR amplification system, amplification program, template digestion, transformation, and culture conditions were the same as in 2.3.1. Positive single clones were selected, and the full-length plasmid was extracted and sequenced for verification. Sequencing results showed that the G245 and I247 double-point mutations were precisely introduced, with no redundant mutations. The nucleotide sequence encoded by this double mutant is SEQ ID NO.7, and the amino acid sequence is SEQ ID NO.8, i.e., the optimal mutant G245A / I247V.

[0060] The recombinant expression vector pET-28a-SbAspR-G245A / I247V was transformed into Escherichia coli DH5α competent cells to obtain the engineered strain DH5α-pET-28a-SbAspR-G245A / I247V.

[0061] Example 3: Construction of BL21(DE3) genetically engineered host strain 3.1 Experimental Materials The Plasmid Extraction Mini Kit was purchased from Shanghai Shuomeng Biotechnology Co., Ltd.; the other reagents were the same as in Example 1.

[0062] 3.2 Construction of genetically engineered host strains The mutant engineered strains constructed in Example 2 (engineered strains DH5α-pET-28a-SbAspR-G245A, DH5α-pET-28a-SbAspR-I247V, and DH5α-pET-28a-SbAspR-G245A / I247V) were inoculated into LB liquid medium (test tubes) containing 50 μg / mL kanamycin and cultured at 37 ℃ and 180 rpm for 8 h with shaking. The plasmid was extracted using a plasmid extraction kit to obtain 1 μL of the recombinant expression vector pET-28a-SbAspR-G245A / I247V, which was added to 100 μL of Escherichia coli BL21(DE3) competent cells. The cells were incubated on ice for 30 min, heat-shocked at 42 ℃ for 90 s, immediately incubated on ice for 5 min, and then 900 μL of antibiotic-free LB liquid medium was added. The cells were then recovered by shaking at 37 ℃ and 180 rpm for 1 h. Take 100 μL of the revived bacterial culture and spread it on an LB agar plate containing 50 μg / mL kanamycin. Incubate at 37 °C upside down for 16 h. Pick single colonies for colony PCR verification. Positive clones are the successfully constructed genetically engineered host strains, named as follows: engineered strain BL21(DE3)-pET-28a-SbAspR-G245A, engineered strain BL21(DE3)-pET-28a-SbAspR-I247V, and engineered strain BL21(DE3)-pET-28a-SbAspR-G245A / I247V.

[0063] Example 4: Heterologous expression and purification of aspartate racemic enzyme mutant 4.1 Experimental Materials IPTG, Ni-NTA affinity chromatography column, and BCA protein quantification kit were all purchased from Shanghai Sangon Biotech Co., Ltd.; the other reagents were the same as in Example 1.

[0064] 4.2 Induction of expression and purification Induction of expression: The engineered strains constructed in Example 3 (engineered strains BL21(DE3)-pET-28a-SbAspR-G245A, BL21(DE3)-pET-28a-SbAspR- / I247V, and BL21(DE3)-pET-28a-SbAspR-G245A / I247V) were inoculated into LB liquid medium (test tubes) containing 50 μg / mL kanamycin and cultured at 37 ℃ with shaking at 180 rpm for 8 h. Then, 1% of the inoculum was transferred to fresh LB liquid medium (containing 50 μg / mL kanamycin) and cultured at 37 ℃ with shaking at 180 rpm until OD245A / I247V was reached. 600 =0.6, add IPTG to a final concentration of 0.1 mM, adjust the temperature to 20 ℃, and induce expression for 20 h. At the same time, the wild-type aspartic acid racemic enzyme engineered strain BL21(DE3)-pET-28a-SbAspR was set as a control (the wild-type aspartic acid racemic enzyme engineered strain BL21-pET-28a-SbAspR was obtained by transforming the wild-type recombinant plasmid pET-28a-SbAspR into Escherichia coli BL21 (DE3) competent cells).

[0065] Cell collection and disruption: After induction, the cells were collected by centrifugation at 7000 rpm for 5 min at 4 ℃. The cells were resuspended in pre-cooled phosphate buffer (containing 0.1 mM PLP, 20 mM, pH 8.0) and washed twice. The cells were then resuspended again and disrupted by sonication in an ice bath (200 W power, 3 s sonication, 5 s interval, for a total of 99 cycles). The disruption solution was centrifuged at 7830 rpm for 10 min at 4 ℃, and the supernatant was collected as the crude enzyme solution of the mutant.

[0066] Protein purification: After the crude enzyme solution was filtered through a 0.22 μm filter membrane, it was loaded onto a pre-equilibrated Ni-NTA affinity chromatography column. First, impurities were eluted with PBS buffer containing 50 mM imidazole, and then the target protein was eluted with PBS buffer containing 200 mM imidazole. The elution peaks were collected, and the protein purity was detected by SDS-PAGE electrophoresis.

[0067] In this embodiment, the following proteins were obtained: the target protein (aspartic acid racemic enzyme mutant G245A) of engineered strain BL21-pET-28a-SbAspR-G245A, abbreviated as mutant M1; the target protein (aspartic acid racemic enzyme mutant I247V) of engineered strain BL21-pET-28a-SbAspR-I247V, abbreviated as mutant M2; and the target protein (aspartic acid racemic enzyme mutant G245A / I247V) of engineered strain BL21-pET-28a-SbAspR-G245A / I247V), abbreviated as mutant M3.

[0068] 4.3 Experimental Results SDS-PAGE electrophoresis results are as follows: Figure 1 The results showed that the target protein from the engineered strain BL21(DE3)-pET-28a-SbAspR-G245A / I247V exhibited a distinct and specific protein band at approximately 40 kDa, consistent with the theoretical molecular weight of the aspartate racemic enzyme mutant G245A / I247V. The purified protein had a purity >95%. This target protein is the aspartate racemic enzyme mutant G245A / I247V (i.e., mutant G245A / I247V); it is comparable to the wild-type aspartate racemic enzyme SbAspR (i.e., wild-type enzyme WT), without the problem of excessive inclusion bodies, meeting the requirements for industrial-scale preparation.

[0069] Example 5: Determination of Optimal Temperature The pure enzyme solutions of mutants M1, M2, and M3 from Example 4 and the wild-type enzyme WT were all diluted to a final concentration of 2 μg / mL, with the wild-type enzyme serving as a control. The reactions were terminated by inactivation after incubation at 30 °C, 37 °C, 45 °C, 50 °C, and 60 °C for 2 h, and the optimal reaction temperature was determined. The results are as follows... Figure 2 As shown, the optimal temperature for mutants M1, M3 and wild-type enzyme WT is 45℃, while the optimal temperature for mutant M2 is 50℃. At 45℃, the wild-type enzyme activity is 370.3 U / mg, and the enzyme activity of mutant M3 is 421.3 U / mg. The enzyme activity of mutant M3 is 2.09 times that of wild-type WT.

[0070] Example 6: Determination of Optimal pH The pure enzyme solutions of mutants M1, M2, and M3 from Example 4 and the wild-type enzyme WT were all diluted to a final concentration of 2 μg / mL, with the wild-type enzyme serving as a control. pH values ​​of 5.0 (acetic acid-sodium acetate buffer), 6.0, 7.0, 8.0 (sodium phosphate buffer), 9.0, and 10.0 (glycine-sodium hydroxide buffer) were added to the reaction system. The reaction was terminated by inactivation after reacting at 37 °C for 2 h, and the optimal reaction pH was determined. The results are as follows: Figure 3As shown, the optimal pH for mutants M1, M2, M3, and the wild-type enzyme WT is pH 9.0. Furthermore, at pH 9.0, the wild-type enzyme activity is 370.3 U / mg, and the mutant M3 enzyme activity is 606.5 U / mg, which is 1.64 times that of the wild-type enzyme WT.

[0071] Example 7: Thermal Stability Determination The pure enzyme solutions of mutants M1, M2, and M3 and the wild-type enzyme from Example 4 were diluted to a final concentration of 2 μg / mL. Using the wild-type enzyme as a control, equal volumes of each mutant and wild-type pure enzyme solution were incubated in water baths at 30 °C, 37 °C, 45 °C, 50 °C, and 60 °C for 24 h. The reaction was then terminated by inactivation at 37 °C for 2 h, and the remaining enzyme activity was measured. The results are as follows: Figure 4 As shown in Figure 5, after gradient temperature incubation, the residual activity of mutant M3 was higher than that of wild-type WT in the range above 37 ℃. With increasing incubation temperature, the residual activity of all strains continued to decrease, indicating that high temperatures significantly weaken the enzyme's catalytic retention capacity. M3 exhibited better heat tolerance and retention performance than WT. Combined with the results in Figure 5, it is evident that under the preset temperature gradient, the specific enzyme activity of M3 was significantly higher than that of WT, M1, and M2, demonstrating a significant advantage in catalytic conversion efficiency within the conventional reaction temperature range.

[0072] Example 8: pH stability determination The purified enzyme solutions of both the mutant and wild-type enzymes from Example 4 were diluted to a final concentration of 2 μg / mL, with the wild-type enzyme serving as a control. Equal volumes of the purified enzyme solutions of each mutant and wild-type enzyme were added to equal volumes of pH 5.0 (acetic acid-sodium acetate buffer), 6.0, 7.0, 8.0 (sodium phosphate buffer), 9.0, and 10.0 (glycine-sodium hydroxide buffer) to achieve the same concentration. The solutions were incubated at 4°C for 24 h, then reacted at 37°C for 2 h to terminate the reaction. The remaining enzyme activity was then measured. The results are as follows: Figure 6 As shown in Figure 7, after incubation under a gradient of pH 5.0–10.0, the residual enzyme activity of wild-type WT was generally higher than that of mutant M3. The residual activity of all enzymes decreased continuously as the pH deviated from neutral, with significant activity reduction under acidic and strongly alkaline conditions. Wild-type WT and the single-point mutant M2 showed slightly better pH tolerance stability than M3. Combined with the results in Figure 7, although M3 exhibited slightly lower thermal stability after acid-base incubation, its specific enzyme activity was significantly higher than that of WT, M1, and M2 within the preset pH range, indicating superior catalytic conversion efficiency under optimal reaction conditions.

[0073] Example 9: Whole-cell catalytic L-aspartic acid reaction Bacterial cells collected by centrifugation after induction in Example 4 (without cell disruption or extraction and purification of the target protein) were used for whole-cell catalytic reactions. A 10 L reaction system (containing bacterial cells, pH 8.0 50 mM sodium phosphate buffer, and L-aspartic acid substrate) was used. The pH was 8.0, the reaction temperature was 37 °C, and L-aspartic acid substrate was added in a single addition to a final concentration of 2 mol / L. Samples were taken every 2 hours to measure the consumption of L-aspartic acid. The results are as follows: Figure 8 As shown, the catalytic efficiency of the mutant aspartate racemic enzymes was effectively improved. Among them, the conversion rate of mutant M3 was 100% at 24 h, while the conversion rate of wild-type enzyme WT was only 41.7% at 24 h, which is 2.4 times that of wild-type.

[0074] The embodiments described above are merely preferred embodiments of the present invention, and not an exhaustive list of all possible implementations of the present invention. Any obvious modifications made by those skilled in the art without departing from the principles and spirit of the present invention should be considered to be included within the scope of protection of the claims of the present invention.

Claims

1. An aspartate racemic enzyme mutant, characterized in that, It is obtained by performing any one of the following AC mutations on wild-type aspartate racemic enzymes with the amino acid sequence shown in SEQ ID NO.2; wherein, A: The 245th position is mutated from glycine to alanine; B: The 247th position is mutated from isoleucine to valine; C: The 245th position is changed from glycine to alanine and the 247th position is changed from isoleucine to valine.

2. The aspartate racemic enzyme mutant according to claim 1, characterized in that, The amino acid sequence is shown in any one of SEQ ID NO. 4, SEQ ID NO. 6, or SEQ ID NO.

8.

3. A polynucleotide sequence encoding the aspartic acid racemic enzyme mutant of claim 1.

4. The polynucleotide sequence according to claim 3, characterized in that, The polynucleotide sequence is a codon-optimized polynucleotide sequence.

5. The polynucleotide sequence according to claim 3, characterized in that, Upstream and / or downstream of the polynucleotide sequence are cis-linked regulatory elements for regulating the expression of the nucleic acid molecule in prokaryotic host cells; the regulatory elements include at least one of the T7 promoter, lac operon, ribosome binding site, and transcription terminator.

6. A recombinant expression vector carrying the polynucleotide sequence as described in claim 3, characterized in that, The recombinant expression vector is a pET series prokaryotic expression vector.

7. A recombinant genetically engineered bacterium, characterized in that, The recombinant expression vector of claim 6 is obtained by transforming it into host cells.

8. The recombinant genetically engineered bacteria according to claim 7, characterized in that, The host cells include Escherichia coli.

9. A method for preparing the aspartate racemic enzyme mutant as described in claim 1, characterized in that, Includes the following steps: Step 1: After activating the recombinant genetically engineered bacteria described in claim 8, inoculate it into a liquid culture medium for induction culture to heterologously express the aspartate racemic enzyme mutant. The inducing agent is isopropyl-β-D-thiogalactoside, and the final concentration of the inducing agent is 0.1 mM. The induction culture temperature is 20 ℃, and the induction culture time is 20 h. Step 2: Collect the induced bacterial cells, and obtain a crude enzyme solution containing aspartic acid racemic enzyme after ultrasonic disruption and centrifugation to separate solid and liquid. Then, purify the crude enzyme solution to obtain purified aspartic acid racemic enzyme mutant protein.

10. The use of the aspartic acid racemic enzyme mutant as described in claim 1 in the production of D-aspartic acid.

Images