A promoter pAtCHS derived from arabidopsis, a betalain gene expression cassette and application thereof

Abstract

The application belongs to the technical field of plant genetic engineering, and provides a promoter pAtCHS derived from Arabidopsis, a betalain gene expression cassette and application thereof, wherein the nucleotide sequence of the promoter pAtCHS is shown as SEQ ID NO. 1; the application constructs the betalain gene expression cassette by using the Arabidopsis flower organ-specific promoter pAtCHS, successfully drives the heterologous synthesis of betalain in tobacco, realizes the accumulation of more betalain in the flowers and stems of tobacco, and also realizes the accumulation of part of betalain in the roots and petioles, and less or even no accumulation of betalain in the leaves. The application not only creates a new transgenic tobacco germplasm capable of efficiently accumulating betalain, provides a new material for the plant bioreactor production of the high-value pigment (betalain), but also establishes a rapid, intuitive and visual method for detecting the activity of a promoter.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a gene expression cassette derived from Arabidopsis thaliana, including the promoter pAtCHS and betaine, and its applications. Background Technology

[0002] Betacyanin is a class of nitrogen-containing, water-soluble natural pigments, naturally distributed in a few plants of the Caryophyllales order, such as red beet (Begonia spp.). Beta vulgaris ), Amaranth ( Amaranthus spp.), dragon fruit ( Hylocereus (spp.), etc. This pigment, using L-tyrosine as a precursor, undergoes multiple enzymatic reactions to generate reddish-purple chromophores such as betaine. It possesses advantages such as strong antioxidant capacity, good pH stability, and high safety, and has been listed as a GRAS-grade natural food additive, widely used in the food, cosmetics, and functional food industries. However, the natural sources of betaine are limited in variety and content, and it is sensitive to high temperatures, light, and oxidation, leading to long-term limitations in industrial production due to unstable raw material supply, high extraction costs, and significant storage and transportation losses. Therefore, reconstructing the betaine synthesis pathway in non-natural hosts is a key direction for achieving its large-scale supply.

[0003] The core synthesis of betaine is driven by three key enzymes: CYP76AD1 catalyzes the oxidation of L-tyrosine via L-DOPA to generate cyclo-DOPA; BvDODA1 catalyzes the ring-opening of L-DOPA to generate betaine aldehyde; and cDOPA5GT catalyzes the cyclo-DOPA glycosylation to generate cyclo-DOPA-5-O-glucoside, which spontaneously condenses with betaine to form betaine glycoside. Previous studies have shown that constructing a single fusion gene using the coding sequences of these three genes can achieve the co-synthetic synthesis of betaine in heterologous plants. Regarding promoter selection, the Arabidopsis chalcone synthase gene promoter (pAtCHS) is a constitutive promoter, exhibiting strong transcriptional activity in dicotyledonous plants, high cross-species activity, and broad tissue applicability. However, existing betaine heterologous expression systems still suffer from problems such as complex transformation cassette structures, difficulty in directly assessing promoter expression activity, and reliance on molecular detection methods for positive transformant screening, limiting the application of this technology in large-scale breeding and the development of high-value-added crops.

[0004] Most ornamental plants and major crops (such as tobacco, rice, and tomatoes) lack their own betalain synthesis pathway, and their pigment accumulation mainly relies on the flavonoid pathway, limiting the development of novel color varieties or functional products. Current technology does not provide a solution for efficiently expressing betalains in tobacco using a simplified expression cassette, while simultaneously achieving visualized promoter activity labeling and the accumulation of high-value-added products. Therefore, there is an urgent need for a simple, intuitively phenotypic, and applicable heterologous betalain expression strategy suitable for crops such as tobacco to promote the large-scale production of natural pigments and the functionalization and value-added processing of crops. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a promoter pAtCHS derived from Arabidopsis thaliana, a betaine gene expression cassette, and their applications. The Arabidopsis-derived promoter pAtCHS can efficiently initiate the expression of a fusion gene of a key enzyme in betaine biosynthesis in tobacco plants, achieving the expression and accumulation of betaine in various tissues of tobacco roots, stems, leaves, and flowers. This invention has significant application value in the fields of plant breeding and betaine production.

[0006] The present invention provides a promoter pAtCHS derived from Arabidopsis thaliana, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention provides a betalain gene expression cassette, comprising the promoter pAtCHS, a fusion gene encoding a key enzyme in betalain biosynthesis, and a terminator Tpsrbcs connected in sequence.

[0008] Preferably, the fusion gene encoding the key enzyme in betaine biosynthesis comprises sequentially linked CYP76AD1S , BvDODA1S and cDOPA5GTS Genes, two adjacent genes are tandemly linked by a T2A peptide coding sequence; the CYP76AD1S , BvDODA1S and cDOPA5GTS The nucleotide sequences of the genes are shown in SEQ ID NO.2~4, respectively.

[0009] Preferably, the nucleotide sequence of the terminator Tpsrbcs is as shown in SEQ ID NO.5.

[0010] This invention provides a recombinant vector for expressing a key enzyme in betaine biosynthesis, comprising the aforementioned gene expression cassette and plant expression vector.

[0011] Preferably, the plant expression vector is pCAMBIA1301.

[0012] This invention provides a recombinant bacterial strain expressing a key enzyme in betaine biosynthesis, obtained by transforming the recombinant vector into Agrobacterium. In this invention, the recombinant vector is preferably transformed into Agrobacterium via electroporation. This invention does not impose any particular limitation on the specific operation of the electroporation method; any operation known in the art can be used.

[0013] The primary objective of this invention is to disclose the application of the aforementioned promoter pAtCHS in driving the expression of a fusion gene encoding a key enzyme in betaine biosynthesis in tobacco. Specifically, a novel promoter pAtCHS derived from Arabidopsis thaliana has been identified, capable of driving the specific expression of a fusion gene encoding a key enzyme in betaine biosynthesis in tobacco. In tobacco, this promoter not only expresses in floral organs but also exhibits expression characteristics different from its native plant counterpart (specific expression in petals). It demonstrates the highest activity in floral organs and a broad-spectrum "leakage expression" in vegetative tissues (such as stems and petioles). The resulting transgenic tobacco plants exhibit vibrant flower colors, and the stems, petioles, and other tissues display a red phenotype, with a high concentration of betaine.

[0014] Therefore, the present invention also provides a method for synthesizing betaine in tobacco, by transfecting tobacco plants with the recombinant strain described above to obtain transgenic tobacco that synthesizes betaine. In other words, the present invention provides a new tobacco breeding method and provides a new genetic resource for creating transgenic tobacco that efficiently accumulates betaine.

[0015] Preferably, the tobacco is Benzoic tobacco.

[0016] Preferably, the organs in which the genetically modified tobacco synthesizes betaine include the flower, leaf veins, root, and stem.

[0017] More specifically, a method for synthesizing betaine in tobacco includes the following steps: 1) Construct a betalain gene expression cassette by linking the promoter pAtCHS, the fusion gene encoding a key enzyme in betalain biosynthesis, and the terminator Tpsrbcs; 2) The gene expression cassette is ligated into a plant expression vector to obtain a recombinant vector; 3) The recombinant vector is transferred into the host bacteria to obtain the recombinant strain; 4) The recombinant strain was infected and transformed into tobacco. After co-culture, callus induction, adventitious shoot differentiation, rooting and resistance screening, transgenic tobacco with stable overexpression of the fusion gene encoding the key enzyme in betalain biosynthesis was obtained.

[0018] In addition, the present invention also provides a method for detecting promoter activity, comprising the following steps: 1) constructing a betalain gene expression cassette by linking the promoter to be detected, a fusion gene encoding a key enzyme in betalain biosynthesis, and a terminator Tpsrbcs; 2) linking the gene expression cassette into a plant expression vector to obtain a recombinant vector; 3) transforming the recombinant vector into a host bacterium to obtain a recombinant strain; 4) infecting and transforming plants with the recombinant strain, and determining the promoter activity and tissue specificity by directly observing pigment accumulation; observing the plant color, if the plant turns red or purplish-red, the promoter to be detected is active; if the plant does not change color, the promoter to be detected is inactive; if a certain tissue of the plant turns red or purplish-red, the promoter to be detected has tissue specificity.

[0019] Compared with the prior art, the present invention has the following beneficial effects: The pAtCHS promoter provided by this invention can drive the specific expression of a target gene (a fusion gene of a key enzyme in betaine biosynthesis) in specific organs of tobacco. It exhibits the highest activity in floral organs and also has a broad spectrum of "leakage expression" in vegetative tissues (such as stems and petioles). By linking the pAtCHS promoter with the fusion gene and transferring it into tobacco, the pAtCHS promoter drives the expression of the fusion gene in tobacco-specific tissues, thereby increasing the expression level of the fusion gene in these tissues. The pAtCHS promoter provided by this invention offers a new method for plant molecular breeding.

[0020] Furthermore, this invention constructs a gene expression cassette by linking the pAtCHS promoter, the fusion gene of the key enzyme in betalain biosynthesis, and the terminator Tpsrbcs derived from peas, and then inserts it into a plant expression vector and transforms it into tobacco. This invention not only creates a new transgenic tobacco germplasm that can efficiently accumulate betalains, but also provides new materials for the plant bioreactor production of this high-value pigment (betalains). Attached Figure Description

[0021] Figure 1 The fusion expression gene in Example 1 of this invention ( CYP76AD1S , BvDODA1S and cDOPA5GTS (Structural diagram of the recombinant vector)

[0022] Figure 2 This is a flowchart of the genetic transformation process of transgenic tobacco (BH696) in Example 2 of the present invention; where A is the co-culture stage of transgenic tobacco and Agrobacterium; B is the callus induction stage of transgenic tobacco; C is the differentiation stage of transgenic tobacco (BH696); and D is the regeneration stage of transgenic tobacco (BH696).

[0023] Figure 3The images show the phenotypic diagrams of the transgenic tobacco (BH696) of this invention; where A is the whole plant phenotypic diagram of wild-type (WT) tobacco; B is the stem phenotypic diagram of wild-type tobacco; C is the flower phenotypic diagram of wild-type tobacco; D is the whole plant phenotypic diagram of transgenic tobacco (BH696); E is the stem phenotypic diagram of transgenic tobacco (BH696); and F is the flower phenotypic diagram of transgenic tobacco (BH696).

[0024] Figure 4 This is a graph showing the detection results of betalain content in various tissues of genetically modified tobacco (BH696) and wild-type tobacco in this invention. Detailed Implementation

[0025] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0026] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0028] Unless otherwise stated, the present invention will be implemented using conventional botanical techniques, tissue culture, molecular biology, chemistry, biochemistry, and DNA recombination techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in the published literature. Furthermore, the methods used in the present invention for constructing phylogenetic trees and obtaining transiently expressed plants, except for those used in the embodiments described below, can all be implemented using methods already disclosed in the existing literature.

[0029] This invention provides a promoter pAtCHS derived from Arabidopsis thaliana, the nucleotide sequence of which is shown in SEQ ID NO.1, and is as follows: .

[0030] The pAtCHS promoter is the natural regulatory sequence of the chalcone synthase A gene (chsA), which has been shown in Arabidopsis to drive high-intensity, specific gene expression in petals. This promoter maintains high transcriptional activity even in heterologous environments, and its expression pattern exhibits species-dependent characteristics. While showing strict floral organ specificity, basal expression in vegetative tissues can be observed in some species. This invention utilizes this characteristic to efficiently localize betalain synthesis to tobacco, aiming to obtain a new transgenic tobacco germplasm capable of efficiently accumulating betalain.

[0031] The present invention provides a betalain gene expression cassette, comprising the promoter pAtCHS, a fusion gene encoding a key enzyme in betalain biosynthesis, and a terminator Tpsrbcs connected in sequence.

[0032] In this invention, the fusion gene encoding the key enzyme in betaine biosynthesis comprises sequentially linked... CYP76AD1S , BvDODA1S and cDOPA5GTS Genes, two adjacent genes are tandemly linked by a T2A peptide coding sequence; the CYP76AD1S , BvDODA1S and cDOPA5GTS Gene selection, optimized based on plant preferred codons, RNA structural stability, and protein translation efficiency, is then tandemly encoded using the T2A peptide coding sequence; CYP76AD1S , BvDODA1S and cDOPA5GTS The nucleotide sequences of the genes are shown in SEQ ID NO.2~4, as follows: CYP76AD1S (SEQ ID NO.2):

[0033] BvDODA1S (SEQ ID NO.3): AAGATGATGAATGGTGAAGATGCAACTGATCAGATGATCAAAGAATCCTTCTTCATCACTCATGGTAATCCAATCTTGACTGTTGAAGACACCCATCCATTGCGTCCATTCTTCGAGACTTGGCGTGAGAAAATCTTCTCTAAGAAGCCTAAGGCAATCCTGATCATCTCTGGTCATTGGGAGACTGTCAAACCAACTGTCAATGCTGTCCATATCAACGACACTATCCATGACTTCGATGACTACCCTGCTGCTATGTACCTGTTCAAGTACCCTGCACCTGGTGCACCAGAACTGGCACGTAAAGTCGAGGAGATTCTGAAGAAGTCTGGTTTCGAGACTGCTGAGACTGATGAAAAGCGTGGTCTGGATCATGGTGCATGGGTTCCACTGATGCTGATGTATCCTGAGGCTGACATCCCTGTCTGCCAGCTGTCTGTTCAACCACATCTGGATGGTACTTACCACTACAACTTGGGTCGTGCACTGGCACCATTGAAGAATGATGGTGTCTTGATCATCGGTTCTGGTTCTGCAACTCATCCACTGGATGAGACTCCACACTACTTCGACGGTGTTGCACCTTGGGCTGCTGCATTCGACTCTTGGCTTCGTAAAGCACTGATCAACGGTCGTTTCGAAGAAGTCAACATCTACGAGACCAAAGCACCAAACTGGAAACTGGCACATCCATTCCCTGAACACTTCTATCCACTGCATGTTGTTCTTGGTGCTGCTGGTGAGAAGTGGAAGGCTGAGCTGATTCATTCTTCTTGGGATCATGGTACTCTGTGTCATGGTTCCTACAAGTTCACCTCTGCT。

[0034] cDOPA5GTS (SEQ ID NO.4):

[0035] In this invention, the terminator Tpsrbcs is the terminator of the pea rbcS-E9 gene; the nucleotide sequence of the terminator Tpsrbcs is shown in SEQ ID NO.5, and is as follows: Tpsrbcs (SEQ ID NO.5): .

[0036] This invention provides a recombinant vector for expressing a key enzyme in betaine biosynthesis, comprising the aforementioned gene expression cassette and a plant expression vector. In this invention, the plant expression vector is preferably pCAMBIA1301. A schematic diagram of the recombinant vector is shown below. Figure 1 As shown. The gene expression cassette is preferably cloned into a plant expression vector. Hind III and EcoRBetween the I restriction enzyme sites; the fusion gene of the key enzyme in betaine biosynthesis was cloned to BamH Ⅰ and Sac Between the I restriction enzyme sites. This invention does not specifically limit the preparation method of the recombinant vector; conventional preparation methods in the art can be used.

[0037] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0038] Example 1: Construction of multi-gene plant expression vectors 1. Optimized synthesis of three genes Optimization is carried out according to the following principles: (i) Optimize gene codons according to tobacco codon preference to improve gene translation efficiency; (ii) Eliminate recognition sites of commonly used restriction endonucleases inside the gene to facilitate expression cassette construction; (iii) Eliminate inverted repeat sequences, stem-loop structures and transcription termination signals to balance GC / AT inside the gene and improve RNA stability; (iv) Make the gene-encoded protein conform to the N-terminal principle to improve the stability of the translated protein; (v) Optimize the mRNA secondary structure free energy to improve gene expression efficiency.

[0039] Using the Arabidopsis pAtCHS promoter as a template, the DNA sequence shown in SEQ ID NO.1 was synthesized, cloned into a plasmid vector, and sequenced to determine its sequence; using sugar beets ( Beta vulgaris) CYP76AD1 Using the gene as a template, and based on the codon bias of tobacco, the DNA sequence shown in SEQ ID NO.2 was synthesized. CYP76AD1S Cloned into a plasmid vector, its sequence was determined by sequencing; using sugar beets ( BvDODA1 of Beta vulgaris Using the gene as a template, and based on the codon bias of tobacco, the DNA sequence shown in SEQ ID NO.3 was synthesized. BvDODA1S Cloned into a plasmid vector, its sequence was determined by sequencing; using sugar beets ( Beta vulgaris) cDOPA5GT Using the gene as a template, and based on the codon bias of tobacco, the DNA sequence shown in SEQ ID NO.4 was synthesized. cDOPA5GTS The clone was inserted into a plasmid vector, and its sequence was determined by sequencing; using peas... rbcS-E9 Using the gene terminator sequence Tpsrbcs as a template, the DNA sequence shown in SEQ ID NO.5 was synthesized, cloned into a plasmid vector, and sequenced to determine its sequence.

[0040] 2. The gene expression cassette elements were assembled by Sangon Biotech (Shanghai) Co., Ltd., such as... Figure 1 As shown.

[0041] 3. Construction of multi-gene transformation vectors The CBG multi-gene expression cassette recombinant plasmid obtained above was used... Hind III and EcoR I. The plasmid is digested with restriction enzymes and ligated into the pCAMBIA1301 vector, which has been digested with the same restriction endonuclease, to obtain the pCAMBIA1301-CBG recombinant plasmid.

[0042] Example 2: Tobacco Conversion 1. Acquisition and identification of genetically modified tobacco (BH696) 1.1 Preparation and electrocution of Agrobacterium 1) Select a single Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of LB liquid medium (50 μg / mL rifampicin and 50 μg / mL kanamycin), and incubate at 28℃ and 250 rpm for 20 h.

[0043] 2) Transfer 1 mL of bacterial culture to 30 mL of LB liquid medium (rifampicin 50 μg / mL, kanamycin 50 μg / mL), incubate at 28℃ and 250 rpm for 12 h, and measure OD. 600 ≈1.5.

[0044] 3) Collect bacterial cells by centrifugation at 8000 rpm, 4°C, and 10 min. Resuspend the cells in Agrobacterium-mediated transformation osmosis buffer (5 wt% sucrose, 0.05 wt% Silwet L-77) and dilute to OD200. 600 ≈0.8.

[0045] 4) Resuspend the bacterial cells thoroughly in 0.5 times the volume of sterile water pre-cooled at 4°C, centrifuge at 3500g for 10 minutes, and carefully discard the supernatant. Resuspend the bacterial cells thoroughly in 2 mL of sterile 10% glycerol pre-cooled at 4°C. This bacterial solution can be used immediately or frozen at -80°C for storage.

[0046] 5) Add 40 μL of bacterial culture and 100 ng of recombinant plasmid to 1.5 mL of Eppendorf solution, mix well in a 0.2 cm diameter electroporation cuvette, and incubate on ice for 1 minute. Adjust the electroporation parameters to 25 μF, 2.5 kV / cm, and 400 Ω. Electroporate for 4–5 msec.

[0047] 6) After electroporation, 1.0 mL of expression culture medium was added to the bacterial cells, and the mixture was incubated at 29°C for 1 hour. The culture was then plated onto YEB plates containing antibiotics (rifampicin 50 μg / mL + kanamycin 50 μg / mL). Using the above transformation procedure, the plant expression vector pCAMBIA1301-CBG was electroporated into Agrobacterium tumefaciens EHA105 to obtain Agrobacterium tumefaciens strain EHA105 (pCAMBIA1301-CBG).

[0048] 1.2 Agrobacterium-mediated genetic transformation of tobacco 1) Collection of Agrobacterium tumefaciens Agrobacterium EHA105 carrying the plant expression vector (pCAMBIA1301-CBG) was picked from YEB plates and inoculated into 5 mL of YEB liquid medium containing 50 mg / L kanamycin. The medium was then incubated at 28°C on a shaker at 200 rpm until OD (out of control) was reached. 600 =0.5, then re-inoculate into fresh YEB medium at a ratio of 1:100 and culture with shaking. The antibiotics in the YEB medium and the culture conditions are the same as before. When OD 600 When the concentration of bacteria is 0.5, the bacterial culture is centrifuged at a relative centrifugal force of 6000×g and 4℃ for 10 minutes to collect the Agrobacterium cells. The Agrobacterium cells are then resuspended in liquid MS medium to OD. 600 =0.5, to prepare Agrobacterium suspension for subsequent infection.

[0049] The YEB culture medium formula is as follows: The liquid MS medium formula is: 4.74 g / L MS basal medium + 30 g / L sucrose + 8 g / L agar powder + the balance water, and the pH is adjusted to 5.8.

[0050] 2) Agrobacterium infection of tobacco leaves Reference Figure 2 For samples A through D, take healthy leaves from sterile tobacco seedlings, and use sterile scissors to cut off the edges and midribs of the leaves, cutting them into 0.5 × 0.5 cm leaf discs as explants for infection. Place the cut explants in Agrobacterium infection solution and gently shake for 10 minutes (ensuring that the explants are fully in contact with the bacterial solution).

[0051] Use sterile filter paper to absorb excess bacterial liquid from the leaf disc surface, then transfer it to a co-culture medium (place a sterile filter paper in the co-culture medium to prevent the rampant growth of Agrobacterium), with the underside of the leaf facing down, and incubate in the dark at 25°C for 3 days (avoid light to prevent the activity of Agrobacterium).

[0052] After co-culturing, the explants were transferred to sterile water containing carbenicillin (250 mg / L) and washed three times with shaking (3-5 min each time) to thoroughly remove residual Agrobacterium. The explants were then transferred to culture dishes containing sterile filter paper, excess water was blotted out, and the explants were transferred to selection medium and incubated at 25°C in a 16-h light / 8-h dark incubator, with subculturing every two weeks. During this period, non-transformed cells gradually turned yellow and died, while transformed cells (containing the resistance gene) formed green buds.

[0053] Once obvious buds appear, the explants are transferred to differentiation medium to induce bud differentiation (25℃, light culture). When the buds grow to 2-3 cm, individual buds are cut off and transferred to rooting medium to induce rooting. After 2-3 weeks, complete regenerated plants are formed. Finally, these seedlings are cultured in soil for subsequent experiments.

[0054] Co-culture medium: MS basal medium + 6-BA 1.0 mg / L + NAA 0.1 mg / L + acetylsyringone (AS) 100 μmol / L + 8 g / L agar powder, pH adjusted to 5.8; Screening medium: MS basal medium + 6-BA 1.0 mg / L + NAA 0.1 mg / L + hygromycin (Hyg) 10 mg / L + carbenicillin (cb) 500 mg / L + 8 g / L agar powder, pH adjusted to 5.8; Differentiation medium: MS basal medium + 6-BA 1.0 mg / L + NAA 0.1 mg / L + hygromycin (Hyg) 15 mg / L + carbenicillin (cb) 500 mg / L + 8 g / L agar powder, pH adjusted to 5.8; Rooting medium: 1 / 2 MS medium + 0.1 mg / L NAA + 8 g / L agar powder, pH adjusted to 5.8.

[0055] Example 3: Identification of genetically modified tobacco Connect the cloned pAtCHS promoter to CBG The expression of betaine protein is driven by the fusion gene, and the expression location of the promoter can be determined by observing the location of betaine production. For example... Figure 3 As shown, the wild-type control's tobacco flower organs are pink / light red, and the stems and leaves are green. Figure 3 (A~C) The flower organs of genetically modified tobacco are purplish-red, significantly deeper and brighter in color, and the stems and leaf veins also show a light red color. Figure 3 (D~F) Initially, the leaves have some red color, but later the tobacco leaves show green color. The above results preliminarily indicate that the pAtCHS promoter is expressed in the flowers, roots, stems, leaves and petioles of tobacco, and betalains are accumulated in the flowers, roots, stems and petioles of transgenic tobacco.

[0056] To further verify the synthesis of betalains in transgenic tobacco, transgenic plants with a different color from the wild-type control were selected. The betalain content in the tissues of both the wild-type control and the transgenic tobacco was then determined using an enzyme-linked immunosorbent assay (ELISA). The specific steps are as follows: (1) Sample pretreatment: Take 50 mg of fresh tissue (roots, stem segments, leaves, petioles and flowers) of wild-type and transgenic tobacco to be tested, freeze in liquid nitrogen and grind into powder; add 1 mL of pre-cooled extraction solution (50% ethanol aqueous solution, containing 0.1% L-ascorbic acid, v / v), and extract at 4℃ in the dark for 30 min; then centrifuge at 4℃, 12000 g for 10 min, and collect the supernatant as the sample solution to be tested; control setting: use the corresponding tissue of non-transgenic wild-type tobacco with the same genetic background as negative control, and use its absorbance value as background subtraction value to ensure detection specificity.

[0057] (2) Standard curve preparation: Accurately weigh betanin standard and prepare standard solutions with concentrations of 0, 10, 25, 50, 100, 200, 400, 600 and 800 mg / L using the above extract; use the extract as a blank control and measure the absorbance value of each standard solution at a wavelength of 538 nm (A538); perform linear regression with absorbance value as the ordinate and concentration as the abscissa to obtain the standard curve equation: A_net = 0.000151 × C(µg / mL) + 0.0032, R² =0.999949; (3) Sample determination: The absorbance values ​​of the sample solution to be tested and the control sample obtained in step (1) are measured at a wavelength of 538 nm under the same conditions; if the absorbance value of the sample exceeds the linear range of the standard curve, it is first diluted with the extract before measurement. (4) Data processing: Substitute the measured absorbance value of the sample into the standard curve equation to calculate the concentration of betalain in the sample solution and calculate the betalain content in the tissue.

[0058] like Figure 4 As shown, no betalains were detected in the flowers, roots, stems, leaves, and petioles of the wild-type control. However, a large amount of betalains accumulated in the stems and flowers of the transgenic tobacco, and also in the roots. In addition, betalains only accumulated in the tobacco leaves in the early stage and were not expressed in the tobacco leaves in the later stage. The detection results were consistent with the previous phenotype.

[0059] As demonstrated in the above embodiments, this invention successfully drove the heterologous synthesis of betaine in tobacco using the Arabidopsis flower organ-specific promoter pAtCHS, and systematically identified the expression pattern of this promoter in the heterologous host. The results showed that pAtCHS exhibited expression characteristics in tobacco different from its native plant form, exhibiting the highest activity in flower organs and a broad-spectrum "leakage expression" in vegetative tissues (such as stems and petioles). The resulting transgenic tobacco plants had vibrant flower colors, and the stems, petioles, and other tissues all displayed a red phenotype, with a high concentration of betaine, demonstrating potential application value. This invention not only created a new transgenic tobacco germplasm capable of efficiently accumulating betaine, providing new materials for the plant bioreactor production of this high-value pigment, but also established a rapid, intuitive, and visual method for detecting promoter activity.

[0060] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A promoter pAtCHS derived from Arabidopsis thaliana, characterized in that, The nucleotide sequence of the promoter pAtCHS is shown in SEQ ID NO.

1.

2. A betaine gene expression cassette, characterized in that, It includes the promoter pAtCHS of claim 1, the fusion gene encoding a key enzyme in betaine biosynthesis, and the terminator Tpsrbcs, which are connected in sequence.

3. The gene expression cassette according to claim 2, characterized in that, The fusion gene encoding a key enzyme in betaine biosynthesis contains sequentially linked... CYP76AD1S , BvDODA1S and cDOPA5GTS Genes, two adjacent genes are tandemly linked by a T2A peptide coding sequence; the CYP76AD1S , BvDODA1S and cDOPA5GTS The nucleotide sequences of the genes are shown in SEQ ID NO. 2~4, respectively.

4. The gene expression cassette according to claim 2, characterized in that, The nucleotide sequence of the terminator Tpsrbcs is shown in SEQ ID NO.

5.

5. A recombinant vector expressing a key enzyme in betaine biosynthesis, characterized in that, Includes the gene expression cassette and plant expression vector as described in any one of claims 2 to 4.

6. The recombinant vector according to claim 5, characterized in that, The plant expression vector is pCAMBIA1301.

7. A recombinant strain expressing a key enzyme in betaine biosynthesis, characterized in that, It is obtained by transferring the recombinant vector as described in claim 5 or 6 into Agrobacterium.

8. The application of the promoter pAtCHS according to claim 1 in driving the expression of a target gene in tobacco, characterized in that, The target gene is a fusion gene encoding a key enzyme in betaine biosynthesis, and the fusion gene encoding the key enzyme in betaine biosynthesis comprises sequentially linked... CYP76AD1S , BvDODA1S and cDOPA5GTS Genes, two adjacent genes are tandemly linked by a T2A peptide coding sequence; the CYP76AD1S , BvDODA1S and cDOPA5GTS The nucleotide sequences of the genes are shown in SEQ ID NO.2~4, respectively.

9. The use of the gene expression cassette according to any one of claims 2 to 4, the recombinant vector according to claim 5, or the recombinant strain according to claim 7 in the synthesis of betaine in tobacco.

10. A method for synthesizing betaine in tobacco, characterized in that, Transfect tobacco plants with the recombinant strain described in claim 7 to obtain transgenic tobacco that synthesizes betalains.

Images