Modified nucleic acid aptamer targeting ptk7 and use thereof

Abstract

The application discloses a modified nucleic acid aptamer targeting PTK7, and the nucleic acid aptamer Sgc8c is modified by at least one of mode (a), mode (b) and mode (c) to obtain the modified nucleic acid aptamer: (a) replacing one or more cytosine nucleotides at positions 3, 15, 16, 18, 19, 29, 34 from the 5' end of the nucleic acid aptamer Sgc8c with 2'-F modified cytosine nucleotides, 2'-OH modified cytosine nucleotides or cytosine locked nucleic acids; (b) replacing one or more adenine nucleotides at positions 26, 28, 33, 39 from the 5' end of the nucleic acid aptamer Sgc8c with 2'-OMe modified adenine nucleotides; (c) replacing one or more guanine nucleotides at positions 31, 40 from the 5' end of the nucleic acid aptamer Sgc8c with 3'-OMe modified guanine nucleotides. The modified nucleic acid aptamer of the application has good binding affinity to PTK7 and PTK7 positive cells, is high in target specificity, and is low in dependence on Mg 2+ for an active conformation.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to a modified nucleic acid aptamer targeting PTK7 and its applications. Background Technology

[0002] Nucleic acid aptamers are a class of single-stranded DNA or RNA molecules that can form specific three-dimensional structures and bind specifically to targets. They have important applications in fields such as tumor detection, molecular imaging, and targeted drug delivery.

[0003] Sgc8 is a DNA aptamer obtained through Cell-SELEX screening, capable of specifically recognizing protein tyrosine kinase 7 (PTK7) and PTK7-positive tumor cells. Sgc8 is currently widely used in research projects such as tumor-targeted imaging and photodynamic therapy. The truncated 41 nt Sgc8c sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3′.

[0004] While existing Sgc8 aptamers can specifically recognize PTK7, their binding affinity still has room for improvement. Furthermore, the active conformation of Sgc8 is important for Mg... 2+ It exhibits strong dependence, especially in low Mg content. 2+ Or without Mg 2+ Under certain conditions, conformational instability can easily occur, leading to a decrease in target binding ability.

[0005] Existing technologies have carried out various chemical modifications on Sgc8 to improve its stability or affinity, mainly including: terminal modification, sugar ring modification, phosphodiester bond modification, base modification, mirror image modification, cyclization modification, dimerization, and polymerization modification.

[0006] Chinese patent CN114574496B discloses the use of nucleoside analogs such as 5-fluorouracil and gemcitabine to modify Sgc8 at multiple sites to improve the stability and drug-likeness of the nucleic acid aptamer Sgc8.

[0007] Chinese patent CN117866968B discloses a method for mirror-image modification of multiple sites in the Sgc8c aptamer sequence to optimize the thermodynamic stability, biological stability, and target binding affinity of the Sgc8c aptamer.

[0008] However, the target-binding ability of nucleic acid aptamers is highly dependent on their three-dimensional conformation. Inappropriate chemical modifications may alter their local structure, thereby reducing or even destroying their target recognition ability. Current technology has not yet identified the key sites in Sgc8 that can enhance target binding ability through sugar ring conformation regulation. Because the effects of sugar ring modification are significantly position-dependent, indiscriminate or multi-site modification may disrupt the active conformation of the aptamer, and it is difficult to determine the relationship between specific modification sites and performance improvement. Summary of the Invention

[0009] This invention provides a modified nucleic acid aptamer targeting PTK7. This modified aptamer has a simple structure, a clearly defined modification site, good binding affinity for PTK7 and PTK7-positive cells, strong target specificity, and its active conformation is effective against Mg2+. 2+ It has a low dependence.

[0010] The technical solution of the present invention is as follows: A modified nucleic acid aptamer targeting PTK7, wherein the modified nucleic acid aptamer is a modified nucleic acid aptamer Sgc8c, and the nucleotide sequence of nucleic acid aptamer Sgc8c is SEQ ID NO:1; The modified nucleic acid aptamer is obtained by modifying the nucleic acid aptamer Sgc8c by at least one of methods (a), (b), and (c): (a) Replace one or more of the cytosine nucleotides at positions 3, 15, 16, 18, 19, 29, and 34 at the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-F modified cytosine nucleotide, a 2′-OH modified cytosine nucleotide, or a cytosine-locked nucleic acid. (b) Replace one or more adenine nucleotides at positions 26, 28, 33, and 39 of the 5′ end of the nucleic acid aptamer Sgc8c with 2′-OMe modified adenine nucleotides; (c) Replace one or more guanine nucleotides at positions 31 and 40 of the 5′ end of the nucleic acid aptamer Sgc8c with 2′-OMe modified guanine nucleotides.

[0011] Preferably, the modified nucleic acid aptamer includes: (1) A modified nucleic acid aptamer is obtained by replacing the cytosine nucleotide at the 3rd position of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-F modified cytosine nucleotide, a 2′-OH modified cytosine nucleotide, or a cytosine-locked nucleic acid; (2) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 15 and 16 at the 5′ end of the nucleic acid aptamer Sgc8c with cytosine nucleotides modified by 2′-F. (3) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 18 and 19 at the 5′ end of the nucleic acid aptamer Sgc8c with cytosine nucleotides modified by 2′-F. (4) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 18, 19, and 34 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides; (5) The modified nucleic acid aptamer obtained by replacing the cytosine nucleotide at position 29 of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-F modified cytosine nucleotide; (6) The modified nucleic acid aptamer obtained by replacing the cytosine nucleotides at positions 3 and 29 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides; (7) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, and 16 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides; (8) The modified nucleic acid aptamer obtained by replacing the cytosine nucleotides at positions 3, 18, and 19 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides; (9) A modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, 16 and 29 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides. (10) A modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, 16, 18, 19, 29 and 34 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides. (11) The modified nucleic acid aptamer is obtained by replacing the adenine nucleotide at position 39 of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-OMe modified adenine nucleotide and replacing the guanine nucleotide at position 40 with a 2′-OMe modified guanine nucleotide. (12) The modified nucleic acid aptamer is obtained by replacing the adenine nucleotides at positions 26 and 28 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-OMe modified adenine nucleotides; (13) The modified nucleic acid aptamer is obtained by replacing the guanine nucleotide at position 31 of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-OMe modified guanine nucleotide and the adenine nucleotide at position 33 with a 2′-OMe modified adenine nucleotide. (14) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotide at position 3 of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-F modified cytosine nucleotide, and replacing the adenine nucleotides at positions 26 and 28 with adenine nucleotides modified with 2′-OMe. (15) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, and 16 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides and replacing the adenine nucleotides at positions 26 and 28 with 2′-OMe modified adenine nucleotides. (16) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, and 16 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides, replacing the guanine nucleotide at position 31 with 2′-OMe modified guanine nucleotides, and replacing the adenine nucleotide at position 33 with 2′-OMe modified adenine nucleotides. (17) The modified nucleic acid aptamer obtained by replacing the cytosine nucleotide at the 3rd position of the 5' end of the nucleic acid aptamer Sgc8c with a cytosine-locked nucleic acid; (18) A modified nucleic acid aptamer is obtained by replacing the cytosine nucleotide at the 3rd position of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-OH modified cytosine nucleotide.

[0012] 2′-F modified cytosine nucleotides refer to nucleotide analogs in which an F substituent is introduced at the 2′ carbon position of the sugar ring of cytosine nucleotides; 2′-OH modified cytosine nucleotides refer to nucleotide analogs in which a hydroxyl substituent is introduced at the 2′ carbon position of the sugar ring of cytosine nucleotides; 2′-OMe modified adenine nucleotides refer to nucleotide analogs in which a methoxy substituent is introduced at the 2′ carbon position of the sugar ring of adenine nucleotides; 2′-OMe modified guanine nucleotides refer to nucleotide analogs in which a methoxy substituent is introduced at the 2′ carbon position of the sugar ring of guanine nucleotides; cytosine locked nucleic acids are bicyclic nucleotide analogs with cytosine as the base, in which the 2′-O and 4′-C of the sugar ring are connected by a methylene bridge.

[0013] Preferably, the modified nucleic acid aptamer specifically binds to PTK7 protein and / or PTK7-positive cells.

[0014] The present invention also provides a composition comprising the modified nucleic acid aptamer described above.

[0015] The present invention also provides a conjugate comprising the modified nucleic acid aptamer and a detectable marker linked to the modified nucleic acid aptamer.

[0016] The present invention also provides a detection article containing the modified nucleic acid aptamer or the conjugate described herein.

[0017] The present invention also provides a detection kit comprising at least one of the modified nucleic acid aptamer, the conjugate, and the detection product.

[0018] The present invention also provides the use of the modified nucleic acid aptamer or the conjugate thereof in the preparation of detection products or detection kits for PTK7 protein and / or PTK7 positive cells.

[0019] The present invention also provides the application of the modified nucleic acid aptamer in the preparation of a drug for treating PTK7-positive tumors.

[0020] The present invention also provides a method for detecting PTK7 protein and / or PTK7-positive cells for non-disease detection or diagnosis, comprising the following steps: (i) The sample to be tested is mixed with the modified nucleic acid aptamer or the conjugate to form a mixture; (ii) Detect the presence or absence of the PTK7 protein-modified nucleic acid aptamer complex in the mixture. If the complex is present, it indicates the presence of PTK7 protein and / or PTK7-positive cells in the test. If the complex is absent, it indicates the absence of PTK7 protein and / or PTK7-positive cells in the test.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: The modified nucleic acid aptamers of the present invention have clearly defined modification sites and are easy to synthesize, which significantly improves the binding affinity and active conformational stability of the modified nucleic acid aptamers to PTK7 protein and / or PTK7 positive cells. Attached Figure Description

[0022] Figure 1 The diagram shows the structures of different modified nucleic acid aptamers, (a) is M1, (b) is M2, (c) is M3, and (d) is M4. Figure 2 The results show the binding affinity of M1-M4 cells to PTK7 protein and PTK7-positive cells. (a) shows PTK7-positive cells, and (b) shows PTK7 protein. Figure 3 The results show the binding affinity of the modified nucleic acid aptamers of Examples 1, 17, and 18 to PTK7 positive cells. Figure 4 The circular dichroism spectra of Sgc8c and M1 are shown. Figure 5 Mg-free 2+ Test results of the binding affinity performance of Sgc8c and M1 to PTK7 protein at different temperatures under the condition; Figure 6 Mg-free 2+ Under the condition of Sgc8c and M1 at 4℃ 1 H NMR spectrum; Figure 7The results show the in vivo fluorescence imaging and tumor fluorescence intensity quantification in HT-29 tumor-bearing mice after intravenous injection of Sgc8c and M1. (a) is the fluorescence imaging, and (b) is the tumor fluorescence intensity quantification. Detailed Implementation

[0023] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not limit it in any way.

[0024] The sequence of the nucleic acid aptamer Sgc8c involved in this invention is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3′ (SEQ ID NO: 1).

[0025] The existing Sgc8 aptamer targets have limited binding affinity, insufficient conformational stability, and resistance to Mg. 2+ To address the issue of strong dependence, this invention provides a chemical modification scheme based on the conformational regulation of the glycocycle at the key Sgc8c site. While maintaining its base sequence and target specificity, this scheme enhances the binding affinity of Sgc8 to PTK7 and PTK7-positive cells, strengthens the stability of its active conformation, and reduces its dependence on Mg. 2+ Dependence.

[0026] The technical solution of the present invention is as follows: Using the Sgc8c parent sequence as a backbone, solid-phase synthesis was performed in the 3′→5′ direction using an automated DNA synthesizer, with 2′-F or 2′-OMe modified phosphoramide monomers applied at predetermined sites according to the target sequence. Each synthetic cycle included detrimethylation, coupling, end-capping, and oxidation. After synthesis, the oligonucleotides were cleaved and deprotected from the controlled-pore glass support, precipitated at -40°C for 10 min after the addition of 3 M NaCl and ethanol, collected by centrifugation, and dissolved in 0.1 M triethylamine acetate (TEAA) buffer. After filtration through a 0.22 μm filter, the precipitate was purified by reversed-phase high-performance liquid chromatography (HPLC). The aqueous phase was 0.1 M TEAA, and the acetonitrile gradient was set sequentially as follows: 0–4 min 5%, 4.01 min 10%, 50 min 65%, and 55–65 min 90%. After lyophilization, the purified product was treated with acetic acid aqueous solution at 37 ℃ for 30 min to remove triphenylmethyl groups, and then precipitated and desalted again. The product was quantified by absorbance at 260 nm and the molecular weight was confirmed by mass spectrometry. The obtained sample was stored at -20 ℃.

[0027] Example 1 In this embodiment, the cytosine nucleotide at position 3 of the 5′ end of the Sgc8c parent is replaced with a 2′-F modified cytosine nucleotide (2′-FC), resulting in the structure of the nucleic acid aptamer as shown below. Figure 1 As shown in (a), it is called M1, and its sequence is as follows: 5′-AT[2′-FC]TAACTGCTGCGCCGCCGGGAAAATACTGTACGTTAGA-3′.

[0028] Comparative Example 1 In this comparative example, the cytosine nucleotide at position 7 of the 5′ end of the Sgc8c parent nucleotide was replaced with a 2′-F modified cytosine nucleotide, and the resulting nucleic acid aptamer sequence is as follows: 5′-ATCTAA[2′-FC]TGCTGCGCCGCCGGGAAAATACTGTACGTTAGA-3′.

[0029] Comparative Example 2 In this comparative example, the cytosine nucleotides at positions 10 and 13 of the 5′ end of the Sgc8c parent sequence were replaced with 2′-F modified cytosine nucleotides, and the resulting nucleic acid aptamer sequences are as follows: 5′-ATCTAACTG[2′-FC]TG[2′-FC]GCCGCCGGGAAAATACTGTACGTTAGA-3′.

[0030] Comparative Example 3 In this comparative example, the cytosine nucleotides at positions 10 and 13 of the 5′ end of the Sgc8c parent sequence were replaced with 2′-F modified cytosine nucleotides, and the thymine nucleotide at position 11 was replaced with 2′-F modified uracil nucleotides (2′-FU). The resulting sequence is as follows: 5′-ATCTAACTG[2′-FC][2′-FU]G[2′-FC]GCCGCCGGGAAAATACTGTACGTTAGA-3′.

[0031] Example 2 In this embodiment, the cytosine nucleotides at positions 15 and 16 of the 5′ end of the Sgc8c parent sequence are replaced with 2′-F modified cytosine nucleotides, and the resulting nucleic acid aptamer sequence is as follows: 5′-ATCTAACTGCTGCG[2′-FC][2′-FC]GCCGGGAAAATACTGTACGGTTAGA-3′.

[0032] Example 3 In this embodiment, the cytosine nucleotides at positions 18 and 19 of the 5′ end of the Sgc8c parent sequence are replaced with 2′-F modified cytosine nucleotides, and the resulting nucleic acid aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCG[2′-FC][2′-FC]GGGAAAATACTGTACCGGTTAGA-3′.

[0033] Comparative Example 4 In this comparative example, the cytosine nucleotide at position 34 of the 5′ end of the Sgc8c parent nucleotide was replaced with a 2′-F modified cytosine nucleotide, and the resulting nucleic acid aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTA[2′-FC]GGTTAGA-3′.

[0034] Example 4 In this embodiment, the cytosine nucleotides at positions 18, 19, and 34 of the 5′ end of the Sgc8c parent nucleotide were replaced with 2′-F modified cytosine nucleotides, resulting in the following sequence of the nucleic acid aptamer: 5′-ATCTAACTGCTGCGCCG[2′-FC][2′-FC]GGGAAAATACTGTA[2′-FC]GGTTAGA-3′.

[0035] Example 5 In this embodiment, the cytosine nucleotide at position 29 of the 5′ end of the Sgc8c parent is replaced with a 2′-F modified cytosine nucleotide, and the resulting nucleic acid aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAAATA[2′-FC]TGTACGGTTAGA-3′.

[0036] Example 6 In this embodiment, the cytosine nucleotides at positions 3 and 29 of the 5′ end of the Sgc8c parent nucleotide are replaced with 2′-F modified cytosine nucleotides, and the structure of the resulting aptamer is as follows. Figure 1 As shown in (b), it is called M2, and its sequence is as follows: 5′-AT[2′-FC]TAACTGCTGCGCCGCCGGGAAAATA[2′-FC]TGTACGGTTAGA-3′.

[0037] Example 7 In this embodiment, the cytosine nucleotides at positions 3, 15, and 16 of the 5′ end of the Sgc8c parent nucleotide are replaced with 2′-F modified cytosine nucleotides, and the structure of the resulting nucleic acid aptamer is as follows. Figure 1As shown in (c), it is called M3, and its sequence is as follows: 5′-AT[2′-FC]TAACTGCTGCG[2′-FC][2′-FC]GCCGGGAAAATACTGTACGTTAGA-3′.

[0038] Example 8 In this embodiment, the cytosine nucleotides at positions 3, 18, and 19 of the 5′ end of the Sgc8c parent sequence are replaced with 2′-F modified cytosine nucleotides, resulting in the following sequence of the nucleic acid aptamer: 5′-AT[2′-FC]TAACTGCTGCGCCG[2′-FC][2′-FC]GGGAAAATACTGTACGTTAGA-3′.

[0039] Example 9 In this embodiment, the cytosine nucleotides at positions 3, 15, 16, and 29 of the 5′ end of the Sgc8c parent sequence are replaced with 2′-F modified cytosine nucleotides, resulting in the following sequence of the nucleic acid aptamer: 5′-AT[2′-FC]TAACTGCTGCG[2′-FC][2′-FC]GCCGGGAAAATA[2′-FC]TGTACGGTTAGA-3′.

[0040] Example 10 In this embodiment, the cytosine nucleotides at positions 3, 15, 16, 18, 19, 29, and 34 of the 5′ end of the Sgc8c parent nucleotide were replaced with 2′-F modified cytosine nucleotides, resulting in the following sequence of the nucleic acid aptamer: 5′-AT[2′-FC]TAACTGCTGCG[2′-FC][2′-FC]G[2′-FC][2′-FC]GGGA AAATA[2′-FC]TGTA[2′-FC]GGTTAGA-3′.

[0041] Comparative Example 5 In this comparative example, the adenine nucleotides at positions 5 and 6 of the 5′ end of the Sgc8c parent sequence were replaced with 2′-OMe-modified adenine nucleotides (2′-OMe-A). The resulting aptamer sequence is as follows: 5′-ATCT[2′-OMe-A][2′-OMe-A]CTGCTGCGCCGCCGGGAAAATACTGTACGGTTAAA-3′.

[0042] Example 11 In this embodiment, the adenine nucleotide at position 39 of the 5′ end of the Sgc8c parent is replaced with a 2′-OMe-modified adenine nucleotide, and the guanine nucleotide at position 40 is replaced with a 2′-OMe-modified guanine nucleotide (2′-OMe-G). The resulting aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTT[2′-OMe-A][2′-OMe-G]A-3′.

[0043] Comparative Example 6 In this comparative example, the adenine nucleotides at positions 5, 6, and 39 of the 5′ end of the Sgc8c parent nucleotide were replaced with 2′-OMe-modified adenine nucleotides, and the guanine nucleotide at position 40 was replaced with 2′-OMe-modified guanine nucleotides. The resulting nucleic acid aptamer sequences are as follows: 5′-ATCT[2′-OMe-A][2′-OMe-A]CTGCTGCGCCGCCGGGAAAATACTGTACGGTT[2′-OMe-A][2′-OMe-G]A-3′.

[0044] Comparative Example 7 In this comparative example, the guanine nucleotides at positions 14 and 17 of the 5′ end of the Sgc8c parent sequence were replaced with 2′-OMe-modified guanine nucleotides. The resulting aptamer sequence is as follows: 5′-ATCTAACTGCTGC[2′-OMe-G]CC[2′-OMe-G]CCGGGAAAATACT GTACGGTTAGA-3′.

[0045] Comparative Example 8 In this comparative example, the guanine nucleotide at position 20 of the 5′ end of the Sgc8c parent nucleotide was replaced with a 2′-OMe modified guanine nucleotide, and the resulting aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCC[2′-OMe-G]GGAAAATACTGTACGGTTAGA-3′.

[0046] Comparative Example 9 In this comparative example, the guanine nucleotides at positions 35 and 36 of the 5′ end of the Sgc8c parent sequence were replaced with 2′-OMe-modified guanine nucleotides. The resulting aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTAC[2′-OMe-G][2′-OMe-G]TTAGA-3′.

[0047] Comparative Example 10 In this comparative example, the guanine nucleotides at positions 20, 35, and 36 of the 5′ end of the Sgc8c parent nucleotide were replaced with 2′-OMe-modified guanine nucleotides. The resulting nucleic acid aptamer sequences are as follows: 5′-ATCTAACTGCTGCGCCGCC[2′-OMe-G]GGAAAATACTGTAC[2′-OMe-G][2′-OMe-G]TTAGA-3′.

[0048] Comparative Example 11 In this comparative example, the guanine nucleotides at positions 21 and 22 of the 5′ end of the Sgc8c parent nucleotide were replaced with 2′-OMe-modified guanine nucleotides, and the adenine nucleotides at positions 23-25 ​​were replaced with 2′-OMe-modified adenine nucleotides. The resulting aptamer sequences are as follows: 5′-ATCTAACTGCTGCGCCGCCG[2′-OMe-G][2′-OMe-G][2′-OMe-A] [2′-OMe-A][2′-OMe-A]ATACTGTACGTTAGA-3′.

[0049] Example 12 In this embodiment, the adenine nucleotides at positions 26 and 28 of the 5′ end of the Sgc8c parent sequence are replaced with 2′-OMe-modified adenine nucleotides, and the resulting nucleic acid aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAA[2′-OMe-A]T[2′-OMe-A]CTGTACGTTAGA-3′.

[0050] Example 13 In this embodiment, the guanine nucleotide at position 31 of the 5′ end of the Sgc8c parent is replaced with a 2′-OMe-modified guanine nucleotide, and the adenine nucleotide at position 33 is replaced with a 2′-OMe-modified adenine nucleotide. The resulting nucleic acid aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAAATACT[2′-OMe-G]T[2′-OMe-A]CGGTTAGA-3′.

[0051] Comparative Example 12 In this comparative example, the guanine nucleotide at position 31 of the 5′ end of the Sgc8c parent nucleotide was replaced with a 2′-OMe-modified guanine nucleotide, and the adenine nucleotides at positions 26, 28, and 33 were replaced with 2′-OMe-modified adenine nucleotides. The resulting aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAA[2′-OMe-A]T[2′-OMe-A]CT [2′-OMe-G]T[2′-OMe-A]CGGTTAGA-3′.

[0052] Comparative Example 13 In this comparative example, the adenine nucleotides at positions 26, 28, and 39 of the 5′ end of the Sgc8c parent nucleotide were replaced with 2′-OMe-modified adenine nucleotides, and the guanine nucleotide at position 40 was replaced with 2′-OMe-modified guanine nucleotides. The resulting nucleic acid aptamer sequences are as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAA[2′-OMe-A]T[2′-OMe-A]CTGTACGGTT[2′-OMe-A][2′-OMe-G]A-3′.

[0053] Comparative Example 14 In this comparative example, the adenine nucleotides at positions 33 and 39 of the 5′ end of the Sgc8c parent nucleotide were replaced with 2′-OMe-modified adenine nucleotides, and the guanine nucleotides at positions 31 and 40 were replaced with 2′-OMe-modified guanine nucleotides. The resulting aptamer sequences are as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAAATACT[2′-OMe-G]T[2′-OMe-A]CGGTT[2′-OMe-A][2′-OMe-G]A-3′.

[0054] Comparative Example 15 In this comparative example, the adenine nucleotides at positions 26, 28, 33, and 39 of the 5′ end of the Sgc8c parent nucleotide were replaced with 2′-OMe-modified adenine nucleotides, and the guanine nucleotide at position 40 was replaced with 2′-OMe-modified guanine nucleotides. The resulting nucleic acid aptamer sequences are as follows: 5′-ATCTAACTGCTGCGCCGCCGGGAAA[2′-OMe-A]T[2′-OMe-A]CTGT[2′-OMe-A]CGGTT[2′-OMe-A][2′-OMe-G]A-3′.

[0055] Comparative Example 16 In this comparative example, the thymine nucleotides at positions 27, 30, and 32 of the 5′ end of the Sgc8c parent were replaced with 2′-F modified uracil nucleotides; the cytosine nucleotide at position 29 was replaced with 2′-F modified cytosine nucleotides; the adenine nucleotides at positions 23-26 and 28 were replaced with 2′-OMe modified adenine nucleotides; and the guanine nucleotides at positions 22 and 31 were replaced with 2′-OMe modified guanine nucleotides. The resulting nucleic acid aptamer sequence is as follows: 5′-ATCTAACTGCTGCGCCGCCGG[2′-OMe-G][2′-OMe-A][2′-OMe-A] [2′-OMe-A][2′-OMe-A][2′-FU][2′-OMe-A][2′-FC][2′-FU][2′-OMe-G][2′-FU]ACGGTTAGA-3′.

[0056] Example 14 In this embodiment, the cytosine nucleotide at position 3 of the 5′ end of the Sgc8c parent is replaced with a 2′-F modified cytosine nucleotide, and the adenine nucleotides at positions 26 and 28 are replaced with 2′-OMe modified adenine nucleotides. The resulting nucleic acid aptamer sequence is as follows: 5′-AT[2′-FC]TAACTGCTGCGCCGCCGGGAAA[2′-OMe-A]T[2′-OMe-A]CTGTACGTTAGA-3′.

[0057] Comparative Example 17 In this comparative example, the cytosine nucleotide at position 3 of the 5′ end of the Sgc8c parent was replaced with a 2′-F modified cytosine nucleotide, the guanine nucleotide at position 31 was replaced with a 2′-OMe modified guanine nucleotide, and the adenine nucleotide at position 33 was replaced with a 2′-OMe modified adenine nucleotide. The resulting nucleic acid aptamer sequence is as follows: 5′-AT[2′-FC]TAACTGCTGCGCCGCCGGGAAAATACT[2′-OMe-G]T [2′-OMe-A]CGGTTAGA-3′.

[0058] Example 15 In this embodiment, the cytosine nucleotides at positions 3, 15, and 16 of the 5′ end of the Sgc8c parent nucleotide are replaced with 2′-F modified cytosine nucleotides, and the adenine nucleotides at positions 26 and 28 are replaced with 2′-OMe modified adenine nucleotides. The structure of the resulting aptamer is as follows. Figure 1 As shown in (d), it is called M4, and its sequence is as follows: 5′-AT[2′-FC]TAACTGCTGCG[2′-FC][2′-FC]GCCGGGAAA[2′-OMe-A]T[2′-OMe-A]CTGTACGTTAGA-3′.

[0059] Example 16 In this embodiment, the cytosine nucleotides at positions 3, 15, and 16 of the 5′ end of the Sgc8c parent nucleotide are replaced with 2′-F modified cytosine nucleotides, the guanine nucleotide at position 31 is replaced with 2′-OMe modified guanine nucleotides, and the adenine nucleotide at position 33 is replaced with 2′-OMe modified adenine nucleotides. The resulting nucleic acid aptamer sequence is as follows: 5′-AT[2′-FC]TAACTGCTGCG[2′-FC][2′-FC]GCCGGGAAAATACT [2′-OMe-G]T[2′-OMe-A]CGGTTAGA-3′.

[0060] Flow cytometry (FCM): HT-29 cells (human colon cancer cells) were cultured in DMEM / F12 medium containing 10% FBS and 1% penicillin-streptomycin at 37 °C and 5% CO2. Cells were collected using enzyme-free cell dissociation buffer, with 2 × 10⁶ cells per aliquot. 5 Cells were washed with DPBS containing 5 mM MgCl2 and 5 mM D-glucose. The binding buffer was prepared by adding 0.1 mg / mL tRNA from Examples 1-16 and Comparative Examples 1-17 and 1 mg / mL BSA. Cells were incubated at 37 °C for 30 min with 50, 25, 12.5, 6.25, 3.13, 1.56, 0.78, and 0.39 nM of 5′-FAM-labeled aptamers, respectively. After washing, the cells were placed on ice, and fluorescence signals were collected using flow cytometry. The cell binding and dissociation constants were obtained using nonlinear fitting, and the results are shown in Table 1.

[0061] Table 1

[0062] Table 1 shows that the affinity changes of Sgc8c glycan modification exhibit a significant position-dependent effect. The dissociation constant of unmodified Sgc8c for HT-29 cells was 3.52 nM; after introducing 2′-F at position 3 of the 5′ end, the cell-binding dissociation constant decreased to 0.48 nM. The cell-binding dissociation constants of sequences modified with 2′-F at positions 15 and 16, 18 and 19, and 29 of the 5′ end were 2.05, 2.01, and 1.11 nM, respectively; the cell-binding dissociation constants of sequences modified with 2′-F at two sites at positions 3 and 29 of the 5′ end, and at three sites at positions 3, 15, and 16 of the 5′ end, were 0.94 and 0.41 nM, respectively. For 2′-OMe modification, the cell binding dissociation constants for combinations of the 5′ ends at positions 26 and 28, 31 and 33, and 39 and 40 were 1.24, 1.03, and 1.59 nM, respectively. Further combination of 2′-F modifications at positions 3, 15, and 16 of the 5′ end with 2′-OMe modifications at positions 26 and 28 reduced the cell binding dissociation constant to 0.38 nM. These results indicate that more glycan ring modifications do not necessarily lead to higher affinity; rather, the specific site and combination of sites are crucial.

[0063] Surface plasmon resonance (SPR): Using a CM5 sensor chip, the carboxyl groups on the chip surface were activated with freshly prepared EDC / NHS mixture. 10 μg / mL PTK7 protein and irrelevant His-tagged protein were immobilized in sodium acetate buffer (pH 4.5), and the remaining active sites were blocked with ethanolamine. At 25 °C, nucleic acid aptamer samples from Examples 1, 6, 7, and 15 were prepared in DPBS containing 5 mM MgCl2 at concentrations of 50, 25, 12.5, 6.25, 3.13, 1.56, 0.78, and 0.39 nM. Samples of each concentration were injected in ascending order, with binding and dissociation times of 180 s and a flow rate of 10 μL / min. After each cycle, regeneration was performed with 1.5 M NaCl for 30 s at a flow rate of 30 μL / min. The SPR dissociation constants were fitted using instrumental analysis software, and the results are shown in Table 2. Figure 2 As shown.

[0064] Table 2

[0065] The data in Table 2 show that the glycan ring modification exhibits a clear position-dependent effect. M1-M4 all showed higher target binding capacity than natural Sgc8c; among them, M1, with only the introduction of 2′-F modification at the 3rd cytosine position, had a KD of 0.48 nM in HT-29 cells, compared to 3.52 nM for natural Sgc8c, representing a 6-7 fold increase in affinity. Considering the synthetic economy, minimal structural perturbation, and significant increase in affinity associated with single-point modification, the 3rd 2′-F modification corresponding to M1 was selected as the basic module for subsequent combinatorial engineering.

[0066] Example 17 In this embodiment, the cytosine nucleotide at position 3 of the 5′ end of the Sgc8c parent sequence is replaced with locked cytosine nucleic acid (LNA-C), and the resulting nucleic acid aptamer sequence is as follows: 5′-AT[LNA-C]TAACTGCTGCGCCGCCGGGAAAATACTGTACGTTAGA-3′.

[0067] Example 18 In this embodiment, the cytosine nucleotide at position 3 of the 5′ end of the Sgc8c parent is replaced with a 2′-OH modified cytosine nucleotide (2′-OH-C), and the resulting nucleic acid aptamer sequence is as follows: 5′-AT[2′-OH-C]TAACTGCTGCGCCGCCGGGAAAATACTGTACGTTAGA-3′.

[0068] The binding curves of HT-29 cells for Examples 1, 17, and 18 were measured respectively, and the cell binding dissociation constant was obtained by nonlinear fitting. The results are as follows: Figure 3 As shown.

[0069] Introducing 2′-F, LNA, or 2′-OH at the third position, respectively, resulted in all variants maintaining sub-nanomolar affinity, with differences among them less than those caused by different modification sites. This suggests that the affinity change is related to the shift in sugar ring conformation from C2′-endo to C3′-endo, and cannot be attributed solely to electron-withdrawing or electron-donating effects of the modifying group.

[0070] Sgc8c and M1 were prepared to a final concentration of 1 μM in DPBS containing 5 mM MgCl2, and circular dichroism (CD) spectroscopy was performed using a quartz cuvette with a path length of 0.5 mm. The scanning wavelength range was 200–320 nm, the data step size was 1 nm, the spectral bandwidth was 1 nm, and the response time was 1.5 s. Each sample was scanned three times consecutively, and the average value was taken, while subtracting the background signal from the corresponding buffer solution. The results are as follows. Figure 4 As shown.

[0071] CD spectroscopy revealed that, compared to natural Sgc8c, M1 exhibited an enhanced main positive peak at approximately 280 nm and deepened negative peaks near approximately 250 nm and 210 nm, suggesting that the 2′-F modification at the 3rd position of the 5′ end altered the local conformation of Sgc8c. Combined with the affinity results for different sugar ring modifications, this change is consistent with the increased proportion of the C3′-endo conformation and enhanced local base stacking.

[0072] Surface plasmon resonance (SPR): Using a CM5 sensor chip, the carboxyl groups on the chip surface were activated with freshly prepared EDC / NHS mixture. 10 μg / mL PTK7 protein and irrelevant His-tagged protein were immobilized in sodium acetate buffer (pH 4.5), and the remaining active sites were blocked with ethanolamine. Sgc8c and nucleic acid aptamer sample M1 from Example 1 were prepared in DPBS at concentrations of 50, 25, 12.5, 6.25, 3.13, 1.56, 0.78, and 0.39 nM at different temperatures of 4 °C, 10 °C, and 25 °C. Samples of each concentration were injected in ascending order, with binding and dissociation times of 180 s and a flow rate of 10 μL / min. After each cycle, regeneration was performed with 1.5 M NaCl for 30 s at a flow rate of 30 μL / min. The SPR dissociation constant was fitted using instrumental analysis software, and the results are shown below. Figure 5 As shown.

[0073] Depend on Figure 5 It can be seen that in the absence of Mg 2+ Under the same conditions, the SPR dissociation constants of Sgc8c and M1 differed significantly at different temperatures. Under the same conditions, M1 exhibited a lower SPR dissociation constant, indicating that M1 has better binding affinity and its active conformation is more favorable to Mg. 2+ It has low dependence.

[0074] Nuclear magnetic resonance (NMR): Samples of Sgc8c and nucleic acid aptamer M1 from Example 1 were prepared to a final concentration of 0.5 mM, with a total volume of 500 μL. The samples were dissolved in DPBS containing 90% H2O / 10% D2O, without the addition of MgCl2. One-dimensional NMR was performed at 4°C. 1 H NMR spectra. All NMR data were acquired using a Bruker AVANCE 600 MHz nuclear magnetic resonance spectrometer and processed and analyzed using TopSpin 5.0.0 software. The results are as follows: Figure 6 As shown.

[0075] Figure 6 of 1 H NMR data showed that, under the same conditions, M1 formed more obvious base complementary pairing, indicating that the active conformation structure of nucleic acid aptamer sample M1 in Example 1 was more stable.

[0076] 5-7 week old immunodeficient nude mice (BALB / c nude mice) were selected and subcutaneously injected with 3×10⁻⁶ mice on their backs. 6 HT-29 cells. Tumor volume reached 300-400 mm. 3 Then, they are randomly grouped (n=3). Figure 7 The control groups were administered 2 nmol of 5′-Cy5-labeled Sgc8c or M1 via tail vein injection, with the formulation buffer being DPBS containing 5 mM MgCl2. Whole-body fluorescence images were acquired using a small animal in vivo imaging system before administration (0 min) and at 10, 30, 60, 90, 120, 240, and 480 min after administration, and the fluorescence intensity in the tumor region was quantified.

[0077] Figure 7 The results showed that 10 min after intravenous administration, the fluorescence signal generated by M1 in the tumor area was about twice that of Sgc8c; at 30, 60 and 90 min, the tumor fluorescence signal of the M1 group was still higher than that of the Sgc8c group, indicating that the single-site 2′-F modification at position 3 can improve the early tumor targeting ability of Sgc8c.

[0078] The embodiments described above provide a detailed explanation of the technical solutions and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, and equivalent substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A modified nucleic acid aptamer targeting PTK7, characterized in that, The modified nucleic acid aptamer is the modified nucleic acid aptamer Sgc8c, and the nucleotide sequence of the nucleic acid aptamer Sgc8c is SEQ ID NO:1; The modified nucleic acid aptamers include: (1) A modified nucleic acid aptamer is obtained by replacing the cytosine nucleotide at the 3rd position of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-F modified cytosine nucleotide, a 2′-OH modified cytosine nucleotide, or a cytosine-locked nucleic acid; (2) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 15 and 16 at the 5′ end of the nucleic acid aptamer Sgc8c with cytosine nucleotides modified by 2′-F. (3) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 18 and 19 at the 5′ end of the nucleic acid aptamer Sgc8c with cytosine nucleotides modified by 2′-F. (4) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 18, 19, and 34 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides; (5) The modified nucleic acid aptamer obtained by replacing the cytosine nucleotide at position 29 of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-F modified cytosine nucleotide; (6) The modified nucleic acid aptamer obtained by replacing the cytosine nucleotides at positions 3 and 29 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides; (7) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, and 16 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides; (8) The modified nucleic acid aptamer obtained by replacing the cytosine nucleotides at positions 3, 18, and 19 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides; (9) A modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, 16 and 29 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides. (10) A modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, 16, 18, 19, 29 and 34 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides. (11) The modified nucleic acid aptamer is obtained by replacing the adenine nucleotide at position 39 of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-OMe modified adenine nucleotide and replacing the guanine nucleotide at position 40 with a 2′-OMe modified guanine nucleotide. (12) The modified nucleic acid aptamer is obtained by replacing the adenine nucleotides at positions 26 and 28 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-OMe modified adenine nucleotides; (13) The modified nucleic acid aptamer is obtained by replacing the guanine nucleotide at position 31 of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-OMe modified guanine nucleotide and the adenine nucleotide at position 33 with a 2′-OMe modified adenine nucleotide. (14) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotide at position 3 of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-F modified cytosine nucleotide, and replacing the adenine nucleotides at positions 26 and 28 with adenine nucleotides modified with 2′-OMe. (15) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, and 16 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides and replacing the adenine nucleotides at positions 26 and 28 with 2′-OMe modified adenine nucleotides. (16) The modified nucleic acid aptamer is obtained by replacing the cytosine nucleotides at positions 3, 15, and 16 at the 5′ end of the nucleic acid aptamer Sgc8c with 2′-F modified cytosine nucleotides, replacing the guanine nucleotide at position 31 with 2′-OMe modified guanine nucleotides, and replacing the adenine nucleotide at position 33 with 2′-OMe modified adenine nucleotides. (17) The modified nucleic acid aptamer obtained by replacing the cytosine nucleotide at the 3rd position of the 5' end of the nucleic acid aptamer Sgc8c with a cytosine-locked nucleic acid; (18) A modified nucleic acid aptamer is obtained by replacing the cytosine nucleotide at the 3rd position of the 5′ end of the nucleic acid aptamer Sgc8c with a 2′-OH modified cytosine nucleotide.

2. The PTK7-targeting modified nucleic acid aptamer according to claim 1, characterized in that, The modified nucleic acid aptamer specifically binds to PTK7 protein and / or PTK7-positive cells.

3. A coupling agent, characterized in that, It includes the modified nucleic acid aptamer as described in claim 1 or 2 and the detectable marker linked to the modified nucleic acid aptamer.

4. A testing product, characterized in that, Contains the modified nucleic acid aptamer as described in claim 1 or 2, or the conjugate as described in claim 3.

5. A test kit, characterized in that, It comprises at least one of the modified nucleic acid aptamer of claim 1 or 2, the conjugate of claim 3, and the detection article of claim 4.

6. The use of a modified nucleic acid aptamer as described in claim 1 or 2 or a conjugate as described in claim 3 in the preparation of a detection product or kit for PTK7 protein and / or PTK7 positive cells.

7. The use of the modified nucleic acid aptamer according to claim 1 or 2 in the preparation of a medicament for treating PTK7-positive tumors.

8. A method for detecting PTK7 protein and / or PTK7-positive cells for non-disease detection or diagnosis, characterized in that, Includes the following steps: (i) The sample to be tested is mixed with the modified nucleic acid aptamer of claim 1 or 2 or the conjugate of claim 3 to form a mixture; (ii) Detect the presence or absence of the PTK7 protein-modified nucleic acid aptamer complex in the mixture. If the complex is present, it indicates the presence of PTK7 protein and / or PTK7-positive cells in the mixture. If the complex is not present, it indicates that PTK7 protein and / or PTK7-positive cells are not present in the sample.

Images