Application of tomato agos3 gene in improving resistance to tyrlcv and method for creating mutant

Abstract

The application discloses a tomato AGO3 Gene application in improving TYLCV resistance and mutant creation method belong to the technical field of genetic engineering. AGO3 The application discloses that the tomato AGO3 Gene functions as a negative regulation factor in TYLCV infection, and the accumulation level of TYLCV in a plant body can be significantly reduced by knocking out the gene. The creation method comprises the following steps: a CRISPR / Cas9 carrier pHEE401-AGO3 carrying double-target genes DT1 and DT2 is constructed; agrobacterium is transformed and tomato explants are infected; tissue culture, resistance screening and separation ratio analysis are performed; and a homozygous mutant is screened. The obtained mutant grows normally and has significantly enhanced TYLCV resistance. The application provides a new gene target and new germplasm resource for tomato virus resistance breeding, and has important breeding application value.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a tomato AGO3 Application of genes in enhancing resistance to Tomato Yellow Leaf Curl Virus (TYLCV) and methods for creating mutants. Background Technology

[0002] With global climate change and adjustments in agricultural production patterns, the occurrence and prevalence of tomato viral diseases are becoming increasingly serious. The occurrence of these diseases is influenced by a combination of factors, including viral population diversity, the complexity of vector insects, and cultivation management practices. Tomato viral diseases have risen to become one of the key diseases restricting tomato yield and quality, causing economic losses reported globally. Aphids, thrips, whiteflies, and other vector insects can transmit multiple secondary pathogens while spreading the target virus, further increasing the difficulty of integrated disease control in the field.

[0003] Tomato yellow leaf curl virus (TYLCV) belongs to the genus *Phaseolus lentigines*. First detected in the Middle East in the 1960s, it is now prevalent in tomato-producing regions across all continents. This virus exhibits a high rate of genome recombination, rapid mutation and spread, and is difficult to control. The whitefly is the only natural vector for its transmission. The impact of TYLCV on tomato yield and quality varies depending on the stage of infection. Seedling infection leads to stunted growth, withered new leaves, and yellowing of leaf margins and veins; severe cases can result in total crop failure. Mid-to-late stage infection affects fruit setting and development, resulting in smaller fruits, uneven coloring, and a decreased proportion of marketable fruit. Previous studies have identified six classic TYLCV resistance genes from wild tomato germplasm. Ty-1 , Ty-2 , Ty-3 , Ty-4 , Ty-5 , Ty-6 Commercially cultivated varieties were introduced to enhance the field resistance of the main cultivated varieties. However, in recent years, with the continuous mutation of virus strains in the field, the resistance level of varieties bred based on the above-mentioned genes has shown a downward trend year by year, and the existing resistance resources are no longer able to meet the actual production needs.

[0004] Plants' innate immunity to viruses primarily relies on the RNA silencing pathway, with AGO proteins being core components responsible for its execution. Previous reports have shown that different AGO family members exhibit functional differentiation during viral infection: some act as positive antiviral regulators, inhibiting viral accumulation by cleaving viral RNA or amplifying silencing signals; others, however, exhibit negative regulatory effects due to being targeted by viral-encoded silencing repressors. However... AGO3 The specific function and regulatory mechanism of the gene in tomato response to TYLCV infection are still unclear.

[0005] Viruses have evolved a new class of proteins, namely viral suppressors of RNA silencing (VSRs), through long-term interactions with their hosts. Currently, almost all pathogenic viruses encode VSRs, and some viruses possess multiple VSRs simultaneously. These VSRs suppress the host's antiviral RNAi immunity through different mechanisms of action, thereby successfully infecting the host plant. V2 is a VSR encoded by TYLCV, which can inhibit PTGS by interacting with SGS3 and competitively binding siRNA to SGS3, and also by competitively binding histone deacetylase 6 to methyltransferase 1, thereby inhibiting PTGS. This invention uses the V2-deficient virus TYLCV-ΔV2 to eliminate interference from viral suppressors of RNA (VSRs), thus accurately analyzing the viral suppressor of RNA silencing (VSR). AGO3 The regulatory role of genes in TYLCV.

[0006] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0007] The purpose of this invention is to clarify the tomato AGO3 The application value of genes in regulating tomato resistance to TYLCV virus, and the establishment of a stable method to obtain... AGO3 Breeding system for gene knockout tomato lines.

[0008] To achieve the above objectives, the present invention provides a tomato AGO3 The application of genes in improving resistance to tomato yellow leaf curl virus (TFBV) involves reducing or knocking out certain genes in tomatoes. AGO3 Gene expression or activity was used to inhibit the accumulation of tomato yellow leaf curl virus in tomato plants; the tomato AGO3 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0009] This invention also provides a method for cultivating tomato mutants resistant to tomato yellow leaf curl virus, comprising the following steps: (1) Constructing a tomato with targeted ingredients AGO3 The CRISPR / Cas9 gene editing vector for the sgRNA expression cassette of the tomato gene AGO3 The nucleotide sequence of the gene is shown in SEQ ID NO:1; (2) The vector was introduced into Agrobacterium and transformed into tomato explants; (3) Transgenic plants were obtained through tissue culture and then screened through segregation of progeny. AGO3 Homozygous mutants that have undergone gene editing.

[0010] Preferably, the target sequence of the sgRNA in step (1) of the method includes the DT1 sequence shown in SEQ ID NO:2 and / or the DT2 sequence shown in SEQ ID NO:3.

[0011] Preferably, the CRISPR / Cas9 vector in step (1) of the method is selected from pHEE401.

[0012] Preferably, the Agrobacterium in step (2) of the method is selected from GV3101.

[0013] Preferably, the primer pairs used for screening mutants in step (3) of the method include SEQ ID NO:12 and SEQ ID NO:13 for detecting the DT1 target, and SEQ ID NO:14 and SEQ ID NO:15 for detecting the DT2 target.

[0014] Preferably, the mutant in step (3) of the method is a homozygous mutant in which mutations occur in both the DT1 and DT2 target regions of the AGO3 gene.

[0015] Preferably, to avoid the possibility that the CRISPR / Cas9 gene editing vector may continue to edit genes in plants, plants whose AGO3 gene has been effectively edited and which do not contain the CRISPR / Cas9 backbone can be selected as target lines for propagation.

[0016] The method provided by this invention can be used to cultivate virus-resistant tomato strains and can also be applied to tomato virus-resistant breeding.

[0017] The tomato antiviral strain prepared by this invention can be used to improve the resistance of tomatoes to yellow leaf curl virus, and especially to improve the resistance of tomatoes to TYLCV-ΔV2.

[0018] The technical solution provided by this invention has the following advantages: This invention discovers the knockout tomato AGO3 The mutant plants exhibited significant resistance to TYLCV-ΔV2, elucidating for the first time the negative regulatory function of the tomato AGO3 gene in TYLCV infection. This breakthrough overturned the traditional understanding of positive antiviral regulation and provided a novel gene target and theoretical basis for molecular breeding of tomato antiviral strains.

[0019] This invention utilizes CRISPR / Cas9 dual-target editing technology, combined with progeny segregation and screening, to obtain homozygous mutants that do not contain exogenous transgenic components. After inoculation with TYLCV, the viral DNA accumulation of the created homozygous mutants is significantly reduced compared to the wild type. Furthermore, the mutants show no abnormalities in agronomic traits such as plant height, leaves, flowers, and fruits, demonstrating promising prospects for breeding applications. Attached Figure Description

[0020] Picture 1 For tomatoes AGO3 Results of gene knockout vector construction and molecular identification of mutants; among which... Picture 1 In the diagram, A represents the pHEE401 vector. 35Sp is the cauliflower mosaic virus 35S promoter, driving the expression of the Hygmycin resistance gene. The EC1.2p promoter drives the zCas9 gene for Cas9 expression in germ cells. Two sgRNA expression cassettes driven by the U6-26p promoter are tandemly linked to achieve dual-target editing. SmR is a bacterial selection marker that is not transferred to plants. B represents... AGO3 A schematic diagram of gene targets; yellow represents the DT1 target sequence; red represents the DT2 target sequence; C represents tomato. AGO3 Three different editing mutations obtained from gene knockout; the left side shows the DT1 target mutation, the right side shows the DT2 target mutation, and blue represents amino acid changes; D represents... MT- ago3-7, MT-ago3-138 and MT-ago3-187 Sanger sequencing results of the mutant;

[0021] Picture 2 for MT-ago3 The mutant growth phenotypes were obtained from plants that had grown for 21 days, with leaves, flowers, and fruits collected from tomato plants that had grown for 3 months.

[0022] Picture 3 For tomatoes AGO3 Results of the effect of gene knockout mutant plants on the resistance of TYLCV-ΔV2; among which, Picture 3 Figure A shows the symptoms of tomatoes with different TYLCV-ΔV2 genotypes 21 days after inoculation, with MOCK representing healthy controls treated with immersion buffer. Figure B shows the Southern blot analysis of TYLCV-ΔV2 accumulation in different tomato genotypes 21 days after TYLCV-ΔV2 infection, with Total DNA representing the DNA loading control, SC representing the supercoiled DNA conformation of the virus, SS representing the single-stranded DNA conformation of the virus, Loading representing the loading control, and the viral DNA content values ​​being the grayscale ratio relative to Total DNA. Figure C shows the MT-WT... ago3-7 , ago3-138 and ago3-187 A statistical graph showing the differences in viral accumulation among mutants is provided. Error bars represent the standard deviations of three biological replicates, and asterisks indicate statistically significant differences. <0.001). Detailed Implementation

[0023] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0025] Example 1 This embodiment provides a tomato AGO3 The method for creating and cultivating gene knockout mutants uses aseptically cultured tomato cotyledons as explants and employs an Agrobacterium-mediated transgenic method to introduce gene knockout mutants. AGO3 The CRISPR / Cas9 recombinant vector targeting the gene was introduced into the target plant to obtain tomato. AGO3 Homozygous plants with gene mutations. The process includes the following steps: (1) Download from the Solanaceae gene database AGO3 The gene CDS sequence is shown in SEQ ID NO:1. Targets with potentially high editing efficiency were identified using an online website (http: / / crispr.cos.uni-heidelberg.de / ), and the specificity of the target sequences was further analyzed using an online website (http: / / www.rgenome.net / cas-offinder / ). The two most preferred sgRNA target sequences (denoted as DT1 and DT2) were obtained, and their specific sequences are shown below. All nucleic acid sequences below are 5'-3'. See [link to relevant documentation]. Picture 1 B in the middle: AGO3 Gene (SEQ ID NO:1): DT1 (SEQ ID NO:2): CACGAGCACGGTATTGGCT; DT2 (SEQ ID NO:3): CTATGGGACGACCTGATGG; (2) Primers were designed for PCR amplification, and the pHEE401-AGO3 fragment was cloned; among them, the primers were AGO3-118-BsF, AGO3-118-F0, AGO3-493-R0 and AGO3-493-BsR, and the sequences are shown in SEQ ID NO:4-7 respectively. AGO3-118-BsF (SEQ ID NO:4): ATATATGGTCTCGATTGCACGAGCACGGTATTGGCTGTT; AGO3-118-F0 (SEQ ID NO:5): TGCACGAGCACGGTATTGGCTGTTTTAGAGCTAGAAATAGC; AGO3-493-R0 (SEQ ID NO:6): AACCCATCAGGTCGTCCCATAGCAATCTCTTAGTCGACTCTAC; AGO3-493-BsR (SEQ ID NO:7): ATTATTGGTCTCGAAACCCATCAGGTCGTCCCATAGCAA; (3) such as Picture 1 As shown in A, DT1 and DT2 were constructed into the vector pHEE401 with CRISPR / Cas9 to obtain the recombinant plasmid pHEE401-AGO3; (4) The recombinant plasmid pHEE401-AGO3 was transformed into Agrobacterium GV3101 by heat shock. The bacterial culture was spread on a resistance medium and U6-26p was used. F、U6-29p R was used as the detection primer (primer sequence below) to screen for monoclonal Agrobacterium with the pHEE401-AGO3 recombinant plasmid; U6-26p F (SEQ ID NO:8): TGTCCCAGGATTAGAATGATTAGGC; U6-29p R (SEQ ID NO:9): AGCCCTCTTTCTTTCGATCCATCAAC; (5) The screened and identified positive Agrobacterium single clones were inoculated into LB liquid medium containing double antibiotics and placed in a constant temperature shaker at 28°C and 220 rpm for overnight amplification culture. The bacterial culture was amplified when the OD of the bacterial culture was 100%. 600 The culture was terminated when the OD value reached 0.6–0.8. The bacterial cells were collected by centrifugation, and the supernatant was removed. The cells were resuspended in suspension buffer, and the OD value of the bacterial culture was adjusted. 600 The concentration was adjusted to 0.6, and the mixture was allowed to stand for 3 hours at room temperature in the dark to activate it, thus preparing an Agrobacterium infection solution that can be used for genetic transformation of tomatoes.

[0026] (6) Using the Agrobacterium-mediated tomato genetic transformation system, the prepared Agrobacterium infection solution was used to infect the cotyledon explants of sterile tissue culture seedlings of Micro-Tom tomatoes. After a series of tissue culture procedures, including Agrobacterium co-culture, callus induction, adventitious shoot differentiation on resistance differentiation medium, and root induction on rooting medium, three T0 generation pHEE401-AGO3 transgenic lines were obtained. After the root systems of the tissue culture seedlings of the three lines grew vigorously and the plant type was stable, they were transferred to a greenhouse for further cultivation. When the plants grew to the 4-6 leaf stage, leaves were collected to extract genomic DNA, which was then analyzed using primers U6-26p. F、U6-29p R performed PCR amplification on the extracted DNA, and the results showed that bands of about 700 bp were amplified in the T0 generation tissue culture seedlings of the three lines. Therefore, it was determined that the pHEE401-AGO3 recombinant plasmid was transformed into the T0 generation tissue culture seedlings of the three lines. (7) Continue to cultivate the T0 generation tissue culture seedlings of the three lines and harvest seeds from each plant to obtain three T0 generation pHEE401-AGO3 transgenic tomato line populations; (8) The T1 generation population was sown, transplanted and cultured to the 4-6 leaf stage. Genomic DNA was extracted from the leaves. The T1 generation pHEE401-AGO3 transgenic tomatoes were analyzed using primers Cas9-F and Cas9-R. The nucleotide sequences of Cas9-F and Cas9-R are shown in SEQ ID NO:10 and SEQ ID NO:11. The Cas9 segregation ratio statistical results showed that the Cas9 segregation ratio of the three positive transgenic lines was 3:1, that is, all three lines were single-insertion transgenic lines. Tomato plants with Cas9 in the three lines were selected for continued conventional greenhouse culture and single plants were used for seed production to obtain the T2 generation. Cas9-F (SEQ ID NO:10): CGACGAGCACCATCAGGATCTG; Cas9-R (SEQ ID NO:11):GTGTCAGCACAATGTCCTCGAGG; (9) T2 generation seeds were sown, transplanted, and cultured until the 4-6 leaf stage. Genomic DNA was extracted from leaves. PCR amplification of the DT1 and DT2 targets was performed using primer pairs AGO3-DT1-detect-F / R and AGO3-DT2-detect-F / R, respectively. The four primer sequences are shown in SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15, respectively. The amplified products were sequenced to analyze the gene editing type. The results are as follows: Picture 1 As shown in C, ago3-7 exist AGO3 The first target region is missing 1 bp, and the second target region is missing 3 bp; ago3-138 exist AGO3 The first target region is missing 1 bp, and the second target region is increased by 1 bp; ago3-187 exist AGO3 The first target region is missing 2 bp, and the second target region is missing 2 bp; for example Picture 1 As shown in D, ago3- 7 , ago3-138 and ago3-187 The peaks in the target region all showed significant single peaks, indicating that the mutants of these three different editing types were all homozygous mutants. To avoid the possibility of CRISPR / Cas9 gene editing vectors continuing to edit genes in plants, Sanger sequencing and other methods were used to preferentially select [the appropriate gene editing vector]. AGO3 Plants whose genes have been effectively edited and which do not contain the CRISPR / Cas9 backbone are kept as single plants for propagation to ensure that the gene editing status remains unchanged, thus obtaining homozygous mutant tomatoes.

[0027] AGO3-DT1-detect-F (SEQ ID NO:12):GCATGAATTCATCCGCTCAC; AGO3-DT1-detect-R (SEQ ID NO:13):GGAGTCTGACTAACCAGCTG; AGO3-DT2-detect-F (SEQ ID NO:14): GCTCACTGCAAATGGAGTAAC; AGO3-DT2-detect-R (SEQ ID NO:15): CAGGCTTATCCATCAACCAC; (10) For three different editing types ago3-7 , ago3-138 and ago3-187 Morphological observations of mutants, such as Picture 2As shown, after comparing with wild-type materials, it was found that the mutant showed no abnormalities in plant height, leaves, flowers and fruit appearance, proving that this gene has no regulatory effect on the nutrition and reproductive organ development of tomatoes.

[0028] (11) Select wild-type MT tomatoes with uniform growth, and ago3-7 , ago3-138 , ago3-187 Three homozygous mutant strains were artificially inoculated with the DNA virus TYLCV-ΔV2. Wild-type MT plants inoculated with buffer were used as a blank control. All treatments included three biological replicates. The susceptibility phenotype of the plants was continuously observed, and the viral accumulation level in the plants was quantitatively detected using Southern blot. The phenotypic observation results are as follows: Picture 3 As shown in A, the wild-type after inoculation with TYLCV-ΔV2 and ago3-7 , ago3-138 , ago3-187 None of the mutant strains showed significant disease symptoms; virus test results were as follows: Picture 3 As shown in B and C, compared to the wild type, each AGO3 The cumulative levels of TYLCV-ΔV2 in the knockout strains were significantly reduced. Based on the above data, it can be concluded that... AGO3 Loss of gene function significantly inhibits the accumulation of TYLCV-ΔV2 in plants.

[0029] In summary, this invention discloses a tomato AGO3 A novel function of the gene, which negatively regulates resistance to the DNA virus TYLCV-ΔV2, was discovered through knockout. AGO3 This method can significantly enhance resistance to TYLCV-ΔV2. Simultaneously, this invention establishes a complete system for breeding genetically stable homozygous mutants free of exogenous editing vectors. The mutant germplasm obtained through this method can be used to analyze the molecular regulatory pathways of tomato antiviral activity, and can also serve as basic breeding material for disease-resistant resource innovation and the cultivation of superior new varieties, possessing high scientific research value and practical potential in tomato molecular disease resistance breeding research.

[0030] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. Tomato AGO3 The application of genes in improving resistance to tomato yellow leaf curl virus is characterized by, By reducing or eliminating the tomato AGO3 Gene expression or activity was used to inhibit the accumulation of tomato yellow leaf curl virus in tomato plants; the tomato AGO3 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. A method for cultivating tomato mutants resistant to tomato yellow leaf curl virus, characterized in that, Includes the following steps: (1) Constructing a tomato with targeted ingredients AGO3 The CRISPR / Cas9 gene editing vector for the sgRNA expression cassette of the tomato gene AGO3 The nucleotide sequence of the gene is shown in SEQ ID NO:1; (2) The gene editing vector was introduced into Agrobacterium and transformed into tomato explants; (3) Obtain transgenic plants through tissue culture and screen them. AGO3 Homozygous mutants that have undergone gene editing.

3. The method according to claim 2, characterized in that, The target sequence of the sgRNA in step (1) includes the DT1 sequence shown in SEQ ID NO:2 and / or the DT2 sequence shown in SEQ ID NO:

3.

4. The method according to claim 2, characterized in that, The primer pairs used for screening in step (3) include SEQ ID NO:12 and SEQ ID NO:13 for detecting the DT1 target, and SEQ ID NO:14 and SEQ ID NO:15 for detecting the DT2 target.

5. The method according to claim 2, characterized in that, The mutant mentioned in step (3) is a homozygous mutant in which mutations occur in both the DT1 and DT2 target regions of the AGO3 gene.

6. The application of the tomato homozygous mutant obtained by the method described in any one of claims 2 to 5 in tomato antiviral breeding.

Images