Application of StERF148 gene in regulating potato starch synthesis

Abstract

The application relates to the field of biotechnology, and particularly relates to StERF148 application of a gene in regulation of potato starch synthesis StERF148 The application carries out systematic function analysis on the gene through construction of potato transgenic materials StERF148 Research shows that SuSy4 the gene can activate sucrose synthase ISA1.1 and isoamylase AGPL3, GPT2.1, NTT2 expression of the gene is inhibited StERF148 Overexpression of the gene can inhibit starch synthesis in potato tubers StERF148 After knockout of the gene, dry matter accumulation and starch synthesis in potato tubers can be significantly promoted StERF148 The gene plays an important role in negative regulation of plant starch synthesis process. The application not only enriches the molecular regulation theory of potato starch metabolism, but also provides important gene resources and innovative ideas for potato quality improvement breeding.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to... StERF148 Application of genes in regulating potato starch synthesis. Background Technology

[0002] Potatoes are annual plants belonging to the Solanaceae family. Their tubers are highly nutritious, making them the world's fourth largest food crop after rice, wheat, and corn. Starch is the main processed product of potato tubers, and its utilization value is directly related to its physicochemical properties. Compared to other countries, my country's potato processing rate is only 15%, while its output accounts for about one-quarter of the global total, indicating a significant imbalance. Besides relatively backward processing technology and equipment, the scarcity and insufficient diversity of specialized potato varieties are also key limiting factors contributing to this phenomenon.

[0003] Starch synthesis requires the participation of multiple enzymes and is also regulated by transcription factors. Currently, research on transcription factors involved in starch synthesis in potatoes is still relatively limited. Therefore, identifying and systematically analyzing the functions of transcription factors related to tuber starch synthesis is a crucial foundation for elucidating the molecular regulatory mechanisms of starch synthesis, and has significant theoretical research value and scientific significance. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a method for regulating potato starch synthesis. StERF148 To clarify the function of genes and the proteins they encode, and to verify their application value, demonstrating... StERF148 Genes have the function of regulating potato starch content, providing new technical pathways and gene resources for the targeted improvement of potato starch quality, and enriching the selection of high-quality and high-yield potato cultivation and molecular breeding.

[0005] To achieve the above objectives, the present invention is implemented through the following solution: In a first aspect, the present invention provides a method for regulating potato starch synthesis. StERF148 The gene, wherein the nucleotide sequence of the gene is (a), (b), or (c); (a) The nucleotide sequence as shown in SEQ ID NO. 1; (b) A nucleotide sequence that hybridizes to and encodes the nucleotide sequence shown in SEQ ID NO. 1 under stringent conditions; (c) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO. 1 and encodes a nucleotide sequence.

[0006] In a second aspect, the present invention provides a protein encoded by the above-mentioned gene, wherein the amino acid sequence of the protein is (a) or (b). (a) A protein composed of the amino acids shown in SEQ ID NO. 2; (b) A functionally equivalent derivative protein consisting of one or more amino acid residues substituted and / or deleted and / or added to the amino acid sequence shown in SEQ ID NO. 2; In some specific embodiments, the present invention provides a protein having an amino acid sequence that has 80% identity with the sequence shown in SEQ ID NO. 2 and has the function of regulating potato tuber quality; preferably 85% identity, more preferably 90% identity, even more preferably 95% identity, and most preferably 99% identity.

[0007] Those skilled in the art will fully understand that, since the same amino acid may be determined by multiple different codons, the nucleotide sequence encoding the above-mentioned protein is not limited to one type. It can be obtained by mutating one or more nucleotides of the mutant nucleotide sequence shown in SEQ ID NO. 1 to form a synonymous mutation, resulting in a nucleotide sequence that can also encode the mutant amino acid sequence of the present invention. Alternatively, a nucleotide sequence that can encode the mutant amino acid sequence of the present invention can be designed based on codon optimization.

[0008] In this invention, the nucleic acid may be optimized or unoptimized, and this invention does not limit the specific type of nucleic acid.

[0009] In this invention, the stringent conditions refer to conditions where the probe hybridizes with its target sequence to a level of detectability exceeding that with other sequences. These stringent conditions are sequence-dependent and can vary depending on the environment. By strictly controlling hybridization or washing conditions, target sequences that are 100% complementary to the probe can be identified. The stringent conditions can be selectively adjusted to allow for some sequence mismatches, thereby enabling the detection of lower levels of similarity.

[0010] Thirdly, the above StERF148 The application of genes in regulating plant starch synthesis is also within the scope of protection of this invention.

[0011] Furthermore, the regulation refers to the regulation of the expression of relevant amylase genes; the relevant amylases include sucrase synthase. SuSy4 and isoamylase ISA1.1 Gene expression, while inhibiting AGPL3 , GPT2.1 , NTT2 Gene expression.

[0012] Furthermore, the ways in which the expression of amylase genes is regulated include one or more of a)-e): f) Negative regulation AGPL3 Gene expression; g) Negative regulation GPT2.1 Gene expression; h) Negative regulation NTT2 Gene expression; i) Positive regulation SuSy4 Gene expression; j) Positive regulation ISA1 Gene expression.

[0013] Fourthly, the present invention provides a biological material comprising deletions or knockouts as shown in SEQ ID NO. 1. StERF148 Gene recombinant vectors, expression cassettes, or recombinant bacteria.

[0014] Fifthly, it is used for silencing, knocking out, or modifying. StERF148 The application of recombinant gene vectors, expression cassettes, or recombinant bacteria in breeding to increase potato starch content is also within the scope of protection of this invention, wherein... StERF148 The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0015] Furthermore, StERF148 Gene expression vectors can be used to construct recombinant expression vectors containing the StERF148 gene from existing plant expression vectors; plant expression vectors include binary Agrobacterium vectors, such as pTF101s, pEGAD, pGES201 or other derived plant expression vectors.

[0016] This invention also relates to methods containing deletions or knockouts. StERF148 Cells containing genes StERF148 Genes or recombinant vectors; cells can be plant cells, such as legume cells, or microbial cells, such as bacterial or fungal cells, such as yeast cells. Cells can be isolated, in vitro, cultured, or part of a plant.

[0017] Sixthly, the present invention provides a method for increasing the starch content of crops by using genetic engineering techniques to increase the starch content of plants. StERF148 Gene knockout at multiple targets, the StERF148 The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0018] Furthermore, the target sequence of the multi-target knockout is shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0019] Seventhly, the present invention provides a method for cultivating plants with high starch content, which involves... StERF148 Gene knockout at multiple targets resulted in plants with high starch content. StERF148 The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0020] Furthermore, the target sequence of the multi-target knockout is shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0021] The plant involved in this invention can be a plant part, plant material, or plant seed. The plant is a legume, such as a common bean or a soybean; it can also be other plants, such as monocotyledons, such as rice, wheat, barley, corn, sorghum, sugarcane, oats, or rye; or other dicotyledons, such as tobacco, sunflower, beet, chili pepper, potato, or tomato.

[0022] Beneficial effects: This invention clarifies for the first time... StERF148 The application of genes in regulating potato starch synthesis: Studies have shown that StERF148 can activate sucrose synthase. SuSy4 and isoamylase ISA1.1 Gene expression, while inhibiting AGPL3, GPT2.1, NTT2 Gene expression; construction and identification of overexpression and knockout vector materials to demonstrate overexpression. StERF148 The gene inhibits starch synthesis in potato tubers; while knockout StERF148 The gene significantly promotes the accumulation of dry matter and starch synthesis in potato tubers, indicating that... StERF148 Genes play a crucial role in the negative regulation of starch synthesis in plants. This invention not only enriches the molecular regulatory theory of potato starch metabolism but also provides important gene resources and innovative ideas for potato quality improvement breeding, contributing to the targeted improvement and industrialization of potato starch quality. Attached Figure Description

[0023] Figure 1 A graph showing the correlation coefficients between starch synthesis genes and candidate transcription factors; Figure 2 This is a diagram showing the expression patterns of starch synthesis genes and candidate transcription factors. Figure 3 The expression level of the StERF148 gene during tuber development and in different tissues; Figure 4 for StERF148 Diagram showing the binding of the gene to the promoter of the starch synthesis gene; Figure 5 for StERF148 Gel images of gene binding to starch synthesis gene promoter; where 1-blank group (no protein added), 2-negative control group (with MBP empty vector protein added), 3-experimental group (with MBP-StERF148 protein and labeled probe added), 4-experimental group (with 10x competitive probe added to group 3), and 5-experimental group (with 100x competitive probe added to group 3). Figure 6 for StERF148 Dual-luciferase binding analysis of genes and starch synthesis genes; Figure 7 for StERF148 Results of mutation type detection in mutant plants; Figure 8 for StERF148 Detection of gene expression levels at different developmental stages of H168 mutant tubers; Figure 9 for StERF148 Detection of expression levels in overexpressing plants; Figure 10 for StERF148 Analysis of starch content in tubers of overexpressing and mutant plants. Detailed Implementation

[0024] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise specified, the test materials used in the following embodiments were purchased from conventional biochemical reagent stores. Unless otherwise stated, percentages and parts are by weight. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar with the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0025] The potato double haploid material DM, the potato tetraploid material Desiree, and the diploid material CIP65 used in this invention all originated from the potato planting resource bank of the Potato Science Research Institute of Yunnan Normal University.

[0026] Example 1 StERF148 The discovery of genes 1.1 Genome-wide co-expression analysis: Nine starch synthesis-related genes specifically expressed in potato tubers were selected as indicator genes, namely: GPT2.1, SuSy4, SS5, SBE3, AGPL3, GBSS1, SS2, SS3, SuSy2 Referring to transcriptome sequencing data published by Massa (2011) et al., the Furaciana potato (Potato fulva) was obtained. Solanumm phureja Table 1 shows the FPKM values ​​of each tissue in the double-monoploid (DM) material and the expression of 9 indicator genes in this transcriptome data.

[0027] Table 1. FPKM values ​​of indicator genes in DM

[0028] Genes with an FPKM value less than 2 were removed from the tubers, resulting in 7711 genes selected. Co-expression analysis was performed using the CORREL function, with each gene representing a different expression level. GPT2.1, SuSy4, SS5, SBE3, AGPL3, GBSS1, SS2, SS3, SuSy2 The correlation coefficients were sorted to obtain 10 genes with correlation coefficients greater than 0.7 that were annotated as transcription factors (e.g., ...). Figure 1 (As shown).

[0029] 1.2 Analysis of expression patterns of candidate transcription factors and starch synthesis genes in DM: Analysis of the expression patterns of transcription factors and starch synthesis-related genes revealed that the gene PGSC0003DMT400081322, belonging to the AP2 / ERF family, was highly and specifically expressed in DM tubers. Figure 2 In addition, tubers, roots, stems, leaves, and flowers were collected at seven developmental stages. The samples were flash-frozen in liquid nitrogen and then ground into powder. Approximately 100 mg of powder was placed in a 1.5 mL centrifuge tube, and RNA was extracted according to the instructions of the Tiangen Plant Polysaccharide and Polyphenol Total RNA Kit (DP441). Given the high starch content in potato tuber samples, 700 μL of lysis buffer (SL) was added. The sample was passed through an adsorption column (CR3) twice to increase RNA content. After elution, the RNA concentration was measured for reverse transcription. The extracted RNA was reverse transcribed using the TAKARA Reverse Transcription Kit (RR047A) to obtain cDNA. The total amount of RNA added was approximately 1 μg, and the resulting cDNA was diluted 4-fold for later use. RT-qPCR was performed according to the All-Gold Kit (AQ601-02-V2), and the primers used are shown in Appendix Table 2. Relative gene expression levels were analyzed using a 22 -ΔΔCT The method used primer sequences for calculation were: StERF148-qp-F: GAAGAAGCTGCAAGAGCTTATGATAG, StERF148-qp-R: GCAATTTGCGAATTCCATAACAGGTTC. The results showed that the expression of this gene gradually increased during tuber development, and was lower in roots, stems, leaves, and flowers. Figure 3 Therefore, this gene was selected as a candidate gene and named... StERF148 .

[0030] Example 2 Verification StERF148 Effects of genes on the transcriptional level of starch synthesis-related genes 2.1 Yeast one-hybrid experiment: SS3, AGPL3, SBE3, SuSy4, AGPS1.1, GBSSI, ISA1.1, GPT2.1, NTT2 The promoter sequence was constructed into the pHIS2 vector. StERF148 The CDS sequence was then constructed into the pGADT7 vector, and the primer sequences used are shown in Table 2. StERF148- pGADT7 and SS3- pHIS2 AGPL3-pHIS2 SBE3- pHIS2 SuSy4- pHIS2 AGPS1.1- pHIS2 GBSSI- pHIS2 ISA1.1- pHIS2 GPT2.1- pHIS2 NTT2- Yeast one-hybrid experiments were performed by co-transformation of two plasmids, pHIS2. The results showed that StERF148 and... SS3, SBE3, AGPS1.1 GBSSI Yeast strains co-transformed with the respective promoters could not grow on selective SD / -Trp / -Leu / -His or SD / -Trp / -Leu / -His media supplemented with 3-AT; conversely, the gene... StERF148 and SuSy4, AGPL3, ISA1.1, GPT2.1, NTT2 After co-transformation with the promoters of the two yeast colonies, the colonies were able to grow on selective culture media. Figure 4 The above results indicate that genes StERF148 It can specifically bind to the promoters of 5 synthetic genes.

[0031] Table 2 Primer sequences used in yeast one-hybrid experiments

[0032] 2.2 In vitro validation using gel migration assay (EMSA): ... StERF148 The CDS sequence was recombined into the pMAL-C2X vector with an MBP tag, and transformed into *E. coli* Rosetta (DE3) to obtain positive strains. After shaking the positive strains, 100 mM IPTG solution was added, and the cultures were incubated at 16 °C and 180 rpm for 16–18 h to induce StERF148 protein expression. The induced protein was then verified using EMSA. StERF148 Binding elements. The fluorescently labeled probe sequences used are shown in Table 3. The competing probe sequences are consistent with the labeled probe sequences.

[0033] Table 3 EMSA probe primer sequences

[0034] like Figure 5 As shown, the marker probes designed from the ERE motifs of the promoters of five starch synthesis genes, and... StERF148 After co-incubation with the proteins, clear and stable specific binding bands appeared in all samples, indicating that... StERF148 It can target and bind to the promoter of the target gene. Furthermore, as the concentration of the competing probe increases, the signal intensity of the specific binding band decreases significantly, and high concentrations of competing probe can completely inhibit the formation of the binding band, confirming that the binding process is sequence-specific.

[0035] 2.3 Dual-luciferase reporter gene assay: [The text abruptly ends here, likely due to an incomplete StERF148 A CDS sequence without a stop codon was ligated into the pRI101AN-eGFP vector as a reporter plasmid. GPT2.1, SuSy4, AGPL3, SA1, NTT2 The promoter sequence was constructed into the pGreenII 0800-LUC vector as an effector, and the primer sequences used are shown in Table 4. Both the recombinant plasmid and the pRI101AN-eGFP empty vector were transformed into Agrobacterium GV3101. The specific transformation method was as follows: Approximately 1 μg of the recombinant plasmid and the pSuper1300 empty vector were added to 50 μL of GV3101 competent cells. After mixing, the cells were incubated on ice for 5 min, in liquid nitrogen for 5 min, at 37 ℃ for 5 min, and on ice for 5 min. 1 mL of antibiotic-free LB was added, and the cells were incubated at 28 ℃ for 2 h. Subsequently, the cells were centrifuged at 5,000 rpm for 3 min, and the supernatant was discarded, leaving 100 μL. This supernatant was then plated onto LB agar plates containing kanamycin and rifampicin (Rif), and incubated upside down at 28 ℃ for 48 h. Positive clones were plated on LB agar plates (Kana + Rif). After 24 h, the plates were scraped and resuspended in MMA (500 mL: MES 0.976 g, MgCl2·6H2O 1.015 g; acetylsylgenone 40 mg / L added before use) to adjust OD. 600 =0.8; The reporter plasmid bacterial suspension with adjusted OD value was mixed with the effector bacterial suspension at a 1:1 ratio and allowed to stand for 2 h. The pRI101AN-eGFP empty vector bacterial suspension was also mixed with the reporter bacterial suspension at a 1:1 ratio as a negative control. Tobacco leaves were marked with a black marker pen on the back and then injected into the leaves. Samples were taken using a sampler 48 h later.

[0036] Table 4 Primer sequences used for dual-luciferase reporter gene detection

[0037] The assay was performed using the Vazyme Dual-LUC kit (DL101). Specifically, 100 μL of cell lysis buffer was added to each sample for 10 min of lysis, followed by centrifugation at 12,000 rpm for 2 min. 5 μL of the supernatant was then collected for analysis. Firefly luciferase activity (Luc value) was measured by adding 20 μL of firefly luciferase substrate, followed by rapid addition of Ren luciferase substrate and measurement of Ren luciferase activity (Ren value). The Luc / Ren ratio was then calculated. The significance of Luc / Ren was analyzed using a paired t-test (see [link to Analytical Chemistry]). Figure 6 The results show that... StERF148 negative regulation AGPL3, GPT2.1, NTT2 The expression, while positively regulating SuSy4、ISA1 Gene expression.

[0038] Example 3: Construction of overexpression and knockout vectors 3.1 Construction of the knockout vector: based on the target gene StERF148 The cDNA (sequence SEQ ID NO. 1) was used to design knockout target sites. The first target sequence is located between bases 42-64 of the CDS sequence: CCGCCGTTTGTCATCCACCGACT (SEQ ID NO. 3); the second target sequence is located between bases 390-412: CCACTACTACAGTCATCCAGAGC (SEQ ID NO. 4). Adapters were added, and the primers were synthesized by a primer synthesis company. Fragment amplification was then performed, using PCBC-DT1T2 as a template to amplify a terminator and a promoter.

[0039] The reaction system is as follows:

[0040] The reaction procedure is as follows:

[0041] Will Bsa I digested the PKSE402 vector plasmid containing the Cas9 expression cassette with enzyme I. The reaction system is as follows:

[0042] The reaction procedure is as follows:

[0043] PCR products a and the vector plasmid after enzyme digestion b Purification was performed using in-fusion ligase, following the instructions. The specific steps are as follows: The following connection system is configured on ice:

[0044] The reaction procedure is as follows:

[0045] The following are the specific steps for transforming E. coli using the DH5α Chemically Competent Cell product instructions from Weidi Biotechnology: a. DH5α competent cells from Remove from 80°C and quickly insert into ice. After 5 minutes, wait for the bacterial block to melt, add 2.5 μL of the above ligation product and gently mix by tapping the bottom of the EP tube with your hand. Let stand in ice for 25 minutes. b. Heat shock in a 42 °C water bath for 45 seconds, then quickly return to the ice and let stand for 5 minutes (shaking will reduce conversion efficiency). c. Add 700 μL of antibiotic-free LB, mix well, and incubate at 37°C and 200 rpm for 60 minutes. d. Centrifuge at 5000 rpm for 1 min to collect the bacterial cells, and take about 100 μL of supernatant to gently resuspend the bacterial cells by pipetting and spread them on LB plates containing Kan; e. Invert the plate and incubate it overnight in a 37°C incubator.

[0046] Preliminary identification of positive clones: Amplification was performed using specific primers Cas9-909F / Cas9-2450R on the vector, and positive clones were sequenced. Plasmids were extracted from the correctly sequenced positive clones for later use. Cas9-909F: 5'- GCAGCTCTCCAAGGACACAT-3' Cas9-2450R: 5'-CGTGAGTCTTCTGGCCCTT-3' 3.2 Construction of Overexpression Vector: For overexpression, the CDS sequence of StERF148 after removing the stop codon was constructed into the p2300MGFPUV-35S-6x MYC vector. The steps were the same as for the knockout vector construction. The primers used were: 2300-StERF148-F: CACGGGGGACTCTAGAATGTGTGGTGGTGCAATT 2300-StERF148-R:TTCTGGATCCTCTAGAAACTACATTATAACTTGGTTGTAG.

[0047] Example 4 Gene StERF148 Obtaining edited strains Using CIP65 (C65) as the knockout StERF148 Genetically transformed plants using Desiree (DES) as an overexpression gene StERF148 Genetic transformation materials.

[0048] The specific steps are as follows: Stems of C65 and DES plants obtained after 4 weeks of growth were cut into approximately 1 cm pieces (without axillary buds). The stem segments were placed on solid culture plates containing 4.3 g MS powder, 20 g sucrose, 3 g plant gel, 1 mg / L ZT, and 2 mg / L NAA, pH=5.8, and cultured under light for 48 h. During this period, the transformed Agrobacterium was activated on LB solid medium and cultured at 28 ℃ for 24 h. The bacterial plaques were then scraped off using a sterilized spatula and resuspended in MS20 (20 g sucrose) liquid medium, with AS (40 mg / mL) added at a 1:1000 ratio. The pre-cultured stem segments were then immersed in this liquid for 8-10 min. After draining the bacterial suspension, the stem segments were placed on culture plates containing 4.3 g MS powder, 20 g sucrose, 3 g plant gel, 1 mg / L ZT, and 2 mg / L NAA, 40 mg / LAS, pH=5.8, and co-cultured in the dark for 48 h. The stem segments were then transferred to differentiation medium containing 4.3 g MS powder, 20 g sucrose, 3 g plant gel, 2 mg / L ZT + 0.01 mg / mL NAA and 200 mg / L TMT for differentiation culture. After 2 weeks, the stem segments were transferred to differentiation medium containing 100 mg / L kana. The medium was changed every two weeks until regenerated seedlings were obtained. The regenerated seedlings were placed on rooting medium containing 4.3 g MS powder, 20 g sucrose, 3 g plant gel, 200 mg / L TMT and 50 mg / L kana. Genomic DNA was extracted from leaves of plants that could root normally for identification.

[0049] Using extracted DNA as a template, PCR was performed on the mutant plants using the following primers: StERF148-test-F: ATGTGTGGTGGTGCAATT; StERF148-test-R: TCAAACTACATTATAACTTGGTTGTAG. Sequencing was then performed, and the sequencing results were compared with the reference sequence to analyze the target site mutations. The mutation types of the two mutant plants (H70 and H168) were finally obtained as follows: Figure 7As shown, the expression levels of mutant plants were analyzed using primers AP2-KO-qp-F: CCATGGACGTTGTCGGATTC; AP2-KO-qp-R: TCGTGACCGCCGTTTGTC. Overexpressing plants were identified using primers: 2300-StERF148-F: CACGGGGGACTCTAGAATGTGTGGTGGTGCAATT and 2300-test-R: GTCAATGATACTACCATGG. The primers used for detecting expression levels in overexpressing plants were StERF148-qp-F: GAAGAAGCTGCAAGAGCTTATGATAG and StERF148-qp-R: GCAATTGCGAATTCCATAACAGGTTC.

[0050] turn out StERF148 Expression levels were significantly decreased at all five stages of tuber development in the H168 mutant. Figure 8 In the overexpression lines (A18, A25, and A27), StERF148 The expression level was at least 5 times higher than that of the wild type. Figure 9 ).

[0051] Example 5: Determination of starch content in StERF148 gene mutant and overexpression plants Starch extraction was performed on potato tubers from mutant plants (H70 and H168) and overexpression lines (A18, A25, and A27) of Example 4, respectively. Specifically, the potato tubers were cut into small pieces and juiced using a juicer with a residue-juice separation function. 100 mL of distilled water was added to rinse away any residual starch in the juicer. 15 mL of 95% ethanol was added and shaken well. After precipitation for 1-2 hours, the supernatant was carefully removed, and the mixture was washed 3-5 times with 100 mL of distilled water until a pure white starch precipitate was obtained. The precipitate was then rapidly frozen in liquid nitrogen and freeze-dried together with the dry matter sample in a freeze dryer. The weight of the freeze-dried dry matter sample was recorded as m2. The sample was then ground into powder using a grinder. The dry matter powder and starch powder were placed in 50 mL centrifuge tubes and sealed for storage to prevent moisture absorption. The changes in the dry matter content of the transgenic potato tubers were analyzed using the formula: dry matter content (%) = m1 / m2 × 100. Starch content was determined using the Keming Starch Content Test Kit (DF-1-Y). Following the instructions, accurately weigh 10 mg of dry matter sample into a 2 mL centrifuge tube for testing. Potato dry matter has a high starch content; therefore, it was diluted 10 times with reagent 3 before testing. 10 mg of starch powder was accurately weighed, and the amylose content was determined using the Keming Amylose Content Test Kit (ZDF-1-Y).

[0052] like Figure 10 As shown, StERF148Genes play an important regulatory role in starch metabolism in potato tubers. StERF148 The dry matter content of the mutant tubers was significantly higher than that of the wild type, but no statistically significant difference was detected in the dry matter content of the overexpression lines compared to the wild type. Starch content in the dry matter was determined, and... StERF148 The total starch content of mutant tubers was significantly increased compared to wild-type, while the starch content of overexpression lines was significantly decreased. Amylose content is one of the main factors affecting the physicochemical properties of starch. The amylose content in mutant and overexpression plants was measured separately. The results showed that mutant tubers had a higher amylose content, while overexpression plants had a lower amylose content.

[0053] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Those skilled in the art, under the guidance of the present invention, can make various similar representations without departing from the spirit and claims of the present invention, and such modifications all fall within the protection scope of the present invention.

Claims

1. A method for regulating potato starch synthesis StERF148 The gene, the nucleotide sequence of which is SEQ ID NO.

1.

2. A protein encoded by the gene of claim 1, wherein the amino acid sequence of the protein is SEQ ID NO.

2.

3. The claim 1 StERF148 Application of genes in regulating plant starch synthesis.

4. The application according to claim 3, characterized in that, The regulation refers to the regulation of the expression of relevant amylase genes; the relevant amylases include sucrose synthase. SuSy4 and isoamylase ISA1.1 Gene expression, while inhibiting AGPL3 , GPT2.1 , NTT2 Gene expression.

5. The application according to claim 4, characterized in that, Including one or more of a)-e): a) Negative regulation AGPL3 Gene expression; b) Negative regulation GPT2.1 Gene expression; c) Negative regulation NTT2 Gene expression; d) Positive regulation SuSy4 Gene expression; e) Positive regulation ISA1 Gene expression.

6. A biomaterial, characterized in that, Including deletions or knockouts as shown in SEQ ID NO. 1 StERF148 Gene recombinant vectors, expression cassettes, or recombinant bacteria.

7. Used for silencing, knocking out, or modifying. StERF148 The application of recombinant gene vectors, expression cassettes, or recombinant bacteria in breeding to increase potato starch content is characterized by, The StERF148 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

8. A method for increasing the starch content of crops, characterized in that, Using genetic engineering techniques to target plants StERF148 Gene knockout at multiple targets, the StERF148 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

9. A method for cultivating plants with high starch content, characterized in that, In plants StERF148 Gene knockout at multiple targets resulted in plants with high starch content. StERF148 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

10. The method according to claim 7 or 8, characterized in that, The target sequence for the multi-target knockout is shown in SEQ ID NO. 3 and SEQ ID NO. 4.

Images