Mrna molecules and their use in the preparation of medicaments for the prevention or treatment of classical swine fever

Abstract

The application provides an mRNA molecule and application thereof in preparation of a medicine for preventing or treating classical swine fever, wherein the mRNA molecule encodes a first protein and / or a second protein; the first protein is selected from an extracellular region of a classical swine fever virus E2 protein; and the second protein comprises N1 to N2 amino acids from an N terminal of the first protein. After the mRNA molecule is used to immunize an organism, the organism can produce long-lasting and high-titer antibodies and induce a strong cellular immune response, thereby effectively resisting classical swine fever virus infection. Moreover, a better effect can be achieved after one-time immunization, which not only reduces the number of immunization operations and workload, reduces the stress reaction and cross-infection risk caused by multiple immunizations, but also improves the immunization efficiency, saves time and cost, and is especially suitable for large-scale breeding.

Description

Technical Field

[0001] This application relates to the field of biomedicine. Specifically, this application relates to mRNA molecules and their use in the preparation of drugs for the prevention or treatment of classical swine fever. Background Technology

[0002] Classical swine fever (CSF) is a highly contagious and severe viral disease caused by the classical swine fever virus (CSFV). Classified as a reportable Category A disease by the World Organization for Animal Health (OIE), it is prevalent year-round and devastating to the swine industry. Currently, CSF is prevented through systematic prophylactic vaccination and direct culling and eradication policies for unvaccinated animals. While large-scale outbreaks are rarely observed, sporadic outbreaks or endemic animal diseases are consistently observed annually in some regions. For example, in 2018, after 26 years without CSF, a resurgence occurred in Japan, causing significant economic losses.

[0003] Currently, there are no specific drugs to treat classical swine fever; prevention and control are only possible through vaccination. The commonly used vaccines are live attenuated vaccines, which have two significant drawbacks: first, there is a risk of vaccine strain virulence reversion; second, they cannot distinguish between infected and immunized animals through antibody testing, which restricts the import and export trade of these animals. Furthermore, most marketed subunit vaccines rely on complex manufacturing processes or adjuvants, but these subunit vaccines are significantly insufficient in inducing cellular immunity. Therefore, developing a novel, safe, and highly effective vaccine is of great importance.

[0004] Compared to traditional vaccines, mRNA vaccines have significant advantages: First, they have a shorter development cycle and are easier to mass-produce. mRNA vaccines are highly programmable, allowing for rapid modification of the vaccine sequence to address novel pathogens, giving them a significant advantage in combating new mutated viral infections. Second, they have good immunogenicity, simultaneously inducing humoral and cellular immunity. Third, they are very safe, as their production process does not involve viral components and requires no adjuvants, eliminating the risk of viral strain reversion and the need to consider the safety of adjuvants.

[0005] However, research on mRNA vaccines against classical swine fever is still needed. Summary of the Invention

[0006] This application aims to at least partially address the technical problems existing in the prior art. To this end, this application proposes an mRNA molecule and its application in the preparation of drugs for the prevention or treatment of classical swine fever. Immunizing the body with the mRNA molecule of this application can generate durable and high-titer antibodies and induce a strong cellular immune response, thereby effectively resisting swine fever virus infection. Furthermore, a single immunization can achieve optimal results, which not only reduces the number of immunization procedures and workload, and lowers the stress response and cross-infection risk that may be caused by multiple immunizations, but also improves immunization efficiency, saves time and costs, and is particularly suitable for large-scale farming.

[0007] In one aspect of this application, an mRNA molecule is provided. According to embodiments of this application, the mRNA molecule encodes a first protein and / or a second protein; the first protein is selected from the extracellular region of the classical swine fever virus (CSFV) E2 protein; the second protein comprises the N1st to N2th amino acids from the N-terminus of the first protein; N1 is selected from an integer from 1 to 5; N2 is selected from an integer from 167 to 172. The mRNA of this application can encode the extracellular region and / or the N-terminal portion of the CSFV E2 protein. Immunizing the body with this mRNA can generate durable and high-titer antibodies and induce a strong cellular immune response, thereby effectively resisting CSFV infection. Furthermore, a single immunization is sufficient to achieve optimal results.

[0008] In another aspect of this application, a DNA molecule is proposed. According to embodiments of this application, the DNA molecule encodes the aforementioned mRNA molecule.

[0009] In another aspect of this application, a protein or polypeptide is provided. According to embodiments of this application, the protein or polypeptide comprises the amino acid sequence encoded by the mRNA described above.

[0010] In another aspect of this application, a biological material is proposed. According to embodiments of this application, the biological material is an expression vector containing the aforementioned DNA molecules, a recombinant cell, or an engineered bacterium.

[0011] In another aspect of this application, a pharmaceutical composition is provided. According to embodiments of this application, the pharmaceutical composition comprises at least one of the following: the aforementioned mRNA molecule, the aforementioned DNA molecule, and the aforementioned protein or polypeptide.

[0012] In another aspect of this application, the use of the aforementioned mRNA molecule, DNA molecule, protein or polypeptide, or drug in the preparation of a drug for the prevention or treatment of classical swine fever is proposed.

[0013] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0014] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0015] Figure 1 This is a Western blot image showing the results of E2-ECD and E2-ECD-N antigen proteins expressed by cells transfected with E2-ECD and E2-ECD-N mRNA.

[0016] Figure 2 This is a graph showing the detection results of particle size and dispersion coefficient of mRNA vaccines;

[0017] Figure 3 This is a graph showing the analysis of E2-EDC protein-specific antibody levels in mouse serum after mRNA vaccination.

[0018] Figure 4 This is a graph showing the analysis of E2-EDC protein-specific antibody levels in mouse serum after E2-ECD and E2-ECD-N mRNA vaccines;

[0019] Figure 5 This is a graph showing the results of measuring the level of E2-ECD protein-specific antibodies in the serum of immunized mice using enzyme-linked immunosorbent assay (ELISA).

[0020] Figure 6 This is a graph showing the results of six months of detection of E2-ECD protein-specific antibody levels in the serum of immunized mice after one dose of E2-ECD and E2-ECD-N mRNA vaccines, measured by enzyme-linked immunosorbent assay (ELISA).

[0021] Figure 7 This is a diagram showing the results of detecting the T-cell immune response induced in the spleen of immunized mice by E2-ECD and E2-ECD-N mRNA vaccines using enzyme-linked immunospot assay.

[0022] Figure 8 The protective effects of E2-ECD and E2-ECD-N mRNA vaccines against CSFV C strain in rabbits were tested using a rabbit challenge and thermometry experiment. Detailed Implementation

[0023] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0024] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0025] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0026] In this document, the terms “comprising” or “including” are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0027] This application proposes mRNA molecules, DNA molecules, proteins, peptides, biomaterials, drugs, and applications, which will be described in detail below.

[0028] mRNA molecules

[0029] In one aspect of this application, an mRNA molecule is provided. According to an embodiment of this application, the mRNA molecule encodes a first protein and / or a second protein; the first protein is selected from the extracellular region of the classical swine fever virus E2 protein; the second protein comprises the N1st to N2nd amino acids of the first protein from the N-terminus; N1 is selected from an integer from 1 to 5; N2 is selected from an integer from 168 to 172.

[0030] The extracellular domain (ECD) of the classical swine fever virus (CSV) E2 protein is the portion of the E2 protein located outside the cell membrane, responsible for binding to receptors on the surface of host cells. Immunization with mRNA expressing the E2-ECD protein can produce high titers of antibodies and induce a cellular immune response, increasing the number of E2-ECD-specific T cells capable of secreting interferon-γ (IFN-γ) or interleukin-2 (IL-2).

[0031] Furthermore, the inventors discovered that truncating the N-terminal portion of the E2-ECD protein (the second protein, also known as the E2-ECD-N protein), i.e., the extracellular N-terminal portion of the E2-ECD protein, can also generate high-titer antibodies and induce cellular immune responses. Moreover, when the truncated segment meets the aforementioned N1 and N2 conditions, the resulting second protein mRNA exhibits even better immunogenicity.

[0032] According to embodiments of this application, N1 is selected from an integer of 1 to 3, such as 1, 2, and 3; N2 is selected from an integer of 170 to 172, such as 170, 171, and 172. This allows for the generation of durable and high-titer antibodies, inducing a strong cellular immune response, thereby effectively resisting swine fever virus infection.

[0033] According to embodiments of this application, the first protein has an amino acid sequence as shown in SEQ ID NO: 1 or an amino acid sequence having at least 85% homology thereto; the second protein has an amino acid sequence as shown in SEQ ID NO: 2 or an amino acid sequence having at least 85% homology thereto. Immunization of the body with mRNA molecules expressing the above-mentioned first and / or second proteins can generate durable and high-titer antibodies and induce a strong cellular immune response, thereby effectively resisting classical swine fever virus infection, with optimal effects achieved after a single immunization.

[0034] In this paper, the terms “identity,” “homology,” or “similarity” are used to describe the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences relative to a reference sequence, determined by conventional methods, for example, see Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN procedure (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Institute)). Foundation, Washington, DC). There are many algorithms for aligning sequences and determining sequence identity, including: Needleman et al. (1970) J. Mol. Biol. 48: 443, a homology alignment algorithm; Smith et al. (1981) Adv. Appl. Math. 2: 482, a local homology algorithm; Pearson et al. (1988) Proc. Natl. Acad. Sci. 85: 2444, a similarity search method; and the Smith-Waterman algorithm (Meth. Mol. Biol). .70:173-187 (1997); and the BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J.Mol.Biol. 215:403-410). Computer programs utilizing these algorithms are also available, including but not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth.Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al.

[0035] In this paper, the term "at least 85% homology" refers to at least 85% homology with each reference sequence, which may be 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%.

[0036] According to embodiments of this application, the mRNA molecule comprises, from the 5' end to the 3' end, a 5' cap structure, a 5' untranslated region, a signal peptide sequence, a coding region (encoding a first protein and / or a second protein), a 3' untranslated region, and a polyadenylate.

[0037] The 5' cap structure enhances mRNA stability and translation efficiency, protects it from degradation by 5' exonucleases, and promotes the binding of translation initiation factors. The 5' untranslated region (5'UTR) regulates translation initiation efficiency by including elements such as the optimized Kozak sequence; its sequence composition and length also affect mRNA stability and translation efficiency. The 3' UTR enhances mRNA stability and translation efficiency by including a poly(A) tail and other regulatory elements, while also regulating mRNA intracellular localization and degradation rates. Polyadenylates (polyA) can improve mRNA stability, promote translation initiation, and enhance translation efficiency. Signal peptides guide the antigen protein encoded by mRNA into the endoplasmic reticulum, thereby initiating subsequent protein folding, modification, and transport processes. This guidance ensures that the antigen protein is correctly presented on the cell surface or secreted extracellularly, where it is recognized by the immune system and activates an immune response, inducing the production of protective antibodies and T-cell immunity, effectively exerting the immunoprotective effect of vaccines.

[0038] In some embodiments, the signal peptide sequence region has a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence having at least 85% homology with it. The aforementioned signal peptide is a β2-microglobulin signal peptide, which is a strongly secreted signal peptide that can promote immunogen secretion and increase immunogenicity.

[0039] In some embodiments, the 5' cap structure is an m7GPPPN structure, also known as a methylguanosine cap; the 5' untranslated region has a nucleotide sequence as shown in SEQ ID NO: 4 or a nucleotide sequence having at least 85% homology thereto, and the 3' untranslated region has a nucleotide sequence as shown in SEQ ID NO: 5 or a nucleotide sequence having at least 85% homology thereto. The polyadenylate may contain 50-150 bases A, preferably having a nucleotide sequence as shown in SEQ ID NO: 6 or a nucleotide sequence having at least 85% homology thereto.

[0040] According to embodiments of this application, the mRNA molecule further includes a miRNA binding site.

[0041] According to embodiments of this application, the mRNA molecule is a linear mRNA, a circular mRNA, or a self-replicating mRNA.

[0042] According to embodiments of this application, the mRNA molecule does not contain chemical modifications that reduce immunogenicity.

[0043] According to embodiments of this application, the mRNA molecule does not contain chemical modifications to its backbone.

[0044] According to embodiments of this application, the mRNA molecule comprises a natural nucleoside.

[0045] According to embodiments of this application, the mRNA molecule comprises modified nucleic acids, including pseudouridine triphosphate modification or N1-methylpseudouridine triphosphate modification. This further reduces mRNA immunogenicity, decreases immune response activation, and thus avoids allergic reactions and protein translation inhibition. Simultaneously, these modifications can improve mRNA translation efficiency, increase protein yield, enhance mRNA stability, prolong its intracellular half-life, and optimize translation accuracy.

[0046] According to embodiments of this application, the mRNA molecule has a nucleotide sequence such as SEQ ID NO: 7 or having at least 85% homology with it (E2-EDC mRNA) or SEQ ID NO: 8 or having at least 85% homology with it (E2-EDC-N mRNA). This enables the generation of durable and high-titer antibodies and induces a strong cellular immune response, thereby effectively resisting classical swine fever virus infection, and achieving optimal results with a single immunization.

[0047] Table 1 Sequence Information

[0048]

[0049]

[0050] According to embodiments of this application, the mRNA is a linear mRNA, a circular mRNA, or a self-replicating mRNA.

[0051] It should be noted that the mRNA molecules of this application can exist in monomeric form or in the form of homodimers and / or homotrimers formed by the fusion of linker fragments (e.g., oligomerization domains).

[0052] DNA molecules, proteins, peptides, biomaterials

[0053] In another aspect of this application, a DNA molecule is proposed. According to embodiments of this application, the DNA molecule encodes the aforementioned mRNA molecule. Therefore, immunizing the body with the mRNA molecule encoded by the DNA molecule of this application can generate durable and high-titer antibodies and induce a strong cellular immune response, thereby effectively resisting swine fever virus infection. Furthermore, a single immunization can achieve optimal results, which not only reduces the number of immunization procedures and workload, lowers the stress response and cross-infection risk that may be caused by multiple immunizations, but also improves immunization efficiency, saves time and costs, and is particularly suitable for large-scale farming.

[0054] According to embodiments of this application, the DNA molecule includes a first DNA molecule and / or a second DNA molecule; the first DNA molecule encodes the first protein, and the second DNA molecule encodes the second protein.

[0055] According to an embodiment of this application, the first DNA molecule has a nucleotide sequence as shown in SEQ ID NO: 9 or a nucleotide sequence having at least 85% homology with it; the second DNA molecule has a nucleotide sequence as shown in SEQ ID NO: 10 or a nucleotide sequence having at least 85% homology with it.

[0056]

[0057] AGGCTGGCCTGCAAAGAGGATTACCGCTACGCCATCAGCAGCACCAACGAGATCGGACTGCTCGGAGCTGGCGGACTGACCACCACATGGAAAGAGTACAGCCACGACCTGCAGCTGAACGACGGAACCGT GAAGGCCATTTGTGTGGCCGGCAGCTTCAAAGTGACAGCCCTGAACGTGGTGTCCAGGCGCTATCTGGCCTCTGCACAAAGGCGCCCTGCTGACAAGCGTGACATTCGAGCTGCTGTTCGACGGCACAA ACCCCAGCACAGAGGAAATGGGCGACGACTTCGGATTCGGACTGTGCCCCTTCGACACAAGCCCAGTGGTCAAGGGCAAGTACAACACCACACTGCTGAACGGCAGCGCCTTCTACCTCGTGTGTCCAATC GGATGGACCGGCGTGATCGAGTGTACAGCCGTGTCTCCAACCACACTGAGGACCGAGGTGGTCAAGACATTCAGGCGCGAGAAGCCCTTTCCACACCGCATGGACTGTGTGACCACAACCGTGTaA(SEQID NO: 10, 5'-3')

[0058] In another aspect of this application, a protein or polypeptide is proposed. According to embodiments of this application, the protein or polypeptide comprises the amino acid sequence encoded by the mRNA described above. Therefore, immunizing the body with the protein or polypeptide encoded by the mRNA molecule of this application can generate durable and high-titer antibodies and induce a strong cellular immune response, thereby effectively resisting swine fever virus infection. Furthermore, a single immunization can achieve optimal results, which not only reduces the number of immunization procedures and workload, lowers the stress response and cross-infection risk that may be caused by multiple immunizations, but also improves immunization efficiency, saves time and costs, and is particularly suitable for large-scale farming.

[0059] In another aspect of this application, a biological material is proposed. According to embodiments of this application, the biological material is an expression vector containing the aforementioned DNA molecules, a recombinant cell, or an engineered bacterium.

[0060] In this document, the term "expression vector" generally refers to a nucleic acid molecule capable of self-replication within a suitable host, transferring the inserted nucleic acid molecule into host cells and / or between host cells. The expression vector may include vectors primarily for inserting DNA or RNA into cells, vectors primarily for replicating DNA or RNA, and expression vectors primarily for transcription and / or translation of DNA or RNA. The expression vector also includes vectors having multiple of the functions described above.

[0061] According to embodiments of this application, the expression vector can be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, by culturing a suitable host cell containing the expression vector, the expression vector can produce the desired expression product. According to embodiments of the invention, the expression vector is a eukaryotic expression vector, a prokaryotic expression vector, a virus, or a bacteriophage. Exemplarily, the expression vector is a plasmid expression vector.

[0062] According to an embodiment of the present invention, the recombinant cells are obtained by introducing the aforementioned expression vector into host cells.

[0063] According to embodiments of the present invention, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0064] According to embodiments of the present invention, the host cell includes at least one of Escherichia coli, immune cells, neurons, progenitor cells or precursor cells, epithelial cells, endothelial cells, and stem cells. The recombinant cells of this application do not contain human cells at various stages of formation and development, specifically excluding human germ cells, fertilized egg cells, and embryonic cells.

[0065] It should be noted that the characteristics and advantages described above for mRNA molecules also apply to this DNA molecule, protein, polypeptide, and biological material, and will not be repeated here.

[0066] Drugs and Applications

[0067] In another aspect of this application, a pharmaceutical composition is provided. According to embodiments of this application, the pharmaceutical composition comprises at least one of the following: the aforementioned mRNA molecule, the aforementioned DNA molecule, and the aforementioned protein or polypeptide. Thus, administration of the pharmaceutical composition to pigs can generate durable and high-titer antibodies and induce a strong cellular immune response, thereby effectively resisting swine fever virus infection. Furthermore, a single immunization is sufficient to achieve optimal results, which not only reduces the number of immunization procedures and workload, lowers the stress response and cross-infection risk that may be caused by multiple immunizations, but also improves immunization efficiency and saves time and costs.

[0068] According to embodiments of this application, the drug includes a vaccine.

[0069] According to embodiments of this application, the drug further includes a carrier, the carrier including a viral carrier or a non-viral carrier; the viral carrier is selected from adeno-associated virus carriers, adenovirus carriers, lentiviral carriers or herpes simplex virus carriers; the non-viral carrier is selected from plasmids, cationic lipids, liposome nanoparticles, liposomes, polymer-based carriers, virus-like particles or extracellular vesicles.

[0070] According to embodiments of this application, the carrier comprises liposome nanoparticles. This effectively protects mRNA from degradation, promotes its entry into cells, and achieves efficient delivery.

[0071] According to embodiments of this application, the liposome nanoparticles comprise:

[0072] 40 to 60 parts by weight of ionizable cationic lipids, for example, 40, 45, 50, 55, or 60 parts by weight;

[0073] 8 to 16 parts by weight of phospholipids, for example, 8, 10, 12, 14, or 16 parts by weight;

[0074] 30 to 45 parts by weight of cholesterol lipids, for example, 30, 35, 40, or 45 parts by weight;

[0075] 1 to 5 parts by weight of PEG-modified lipids, for example, 1, 2, 3, 4, or 5 parts by weight.

[0076] This can improve the stability and delivery efficiency of liposome nanoparticles while reducing immunogenicity and toxicity.

[0077] According to embodiments of this application, the ionizable cationic lipids include at least one of the following: amino cationic lipids SM102, 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)-2-hydroxydodecyl)ethyl)piperazin-1-yl)ethyl)aminodiyl)di(dodecane-2-ol) (C12-200), (6Z,9Z,28Z,31Z)-heptadecene-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate (MC3), N,N-dimethyl-2,3-bis((9Z,12Z)-octadec-9,12-dien-1-oxy)propylamine (DLinDMA), 2-(2,2-di(( 9Z,12Z)-Octadeca-9,12-dien-1-yl)-1,3-dioxane-4-yl)-N,N-dimethylethylamine (DLinKC2DMA, [XTC2]), 3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione (cKK-E12), 10,13-dimethyl-17-(6-methylheptyl-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetrahydro-1H-cyclopentanphenanthrene-3-yl 3-(1H-imidazol-5-yl)propionate (ICE), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadecadeca-9,1-di-1-yl)-1,3-dioxane-4-yl)-N,N-dimethylethylamine (DLinKC2DMA, [XTC2]), 3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione (cKK-E12), 10,13-dimethyl-17-(6-methylheptyl-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetrahydro-1H-cyclopentaphenanthrene-3-yl 3-(1H-imidazol-5-yl)propionate (ICE), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadecadeca-9,1-di-1-yl)-1,3-dioxane-4-yl)-N,N-dimethylethylamine (DLinKC2DMA, [XTC 2-Dien-1-yl)tetracos-15,18-dien-1-amine (HGT5000), (4Z,15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadec-9,12-dien-1-yl)tetracos-4,15,18-trien-1-amine (HGT5001), N,N-dioleoyl-N,N-dimethylammonium chloride (DODAC), N,N-distearate-N,N-dimethylammonium bromide (DDAB), 1,2-dimyristoxypropyl-3-dimethylhydroxyethylammonium chloride (DMRIE), dioleoyloxy-N-[2-arginine formamide)ethyl]-N,N-dimethyl-1-propanetrimonium trifluoroacetate (DOSPA), octadecyl Amide arginine (DOGS), 1,2-dioleoyl-3-dimethylaminopropane (DODAP), N,N-dimethyl-(2,3-dioleoyloxy)propylamine (DODMA) and N,N-dimethyl-(2,3-dimyristoyloxy)propylamine (DMDMA), 1,2-dilinolenic acid-N,N-dimethylaminopropane (DLenDMA), (2S)-2-(4-((10,13-dimethyl-17-(6-methylheptyl-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetrahydro-1H-cyclopenta[a]phenanthrene-3-yl)oxy)butoxy)-N,N-dimethyl-3-((9Z,12Z)-octadec-9,12-Dien-1-oxy)propane (CLinDMA), 2-[5'-(cholest-5-en-3[β]-oxy)-3'-oxopentoxy)-3-dimethyl-1-(cis,cis-9',12'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleoyloxybenzylamine (DMOBA), 1,2-N,N'-dioleoylamino-3-dimethylaminopropane (DOcarbDAP), (9Z,9'Z,12Z,12'Z)- 3-(dimethylamino)propane-1,2-diylbis(octadec-9,12-dienoate) (DLinDAP), 1,2-dilininylamino-3-dimethylaminopropane (DLinCDAP), 2,2-dilininyl-4-dimethylaminomethyl-[1,3]-dioxane (DLin-K-DMA), 2-((2,3-bis((9Z,12Z)-octadec-9,12-dien-1-oxy)propyl)dithio)-N,N-dimethylethylamine (HGT4003).

[0078] According to embodiments of this application, the cholesterol lipids are cholesterol or PEGylated cholesterol.

[0079] According to embodiments of this application, the drug is administered via subcutaneous injection, intramuscular injection, intraperitoneal injection, intrapleural injection, intravenous injection, arterial injection, or a combination thereof.

[0080] According to embodiments of this application, the drug is administered 3 times a week, 2 times a week, once a week, once every two weeks, once every three weeks, once every four weeks, once a month, or once every 3-6 months.

[0081] In another aspect, this application proposes the use of the aforementioned mRNA molecule, DNA molecule, protein or polypeptide, and drug in the preparation of a drug for the prevention or treatment of classical swine fever. Immunizing the body with the mRNA molecule, DNA molecule, protein, polypeptide, or drug of this application can generate durable and high-titer antibodies and induce a strong cellular immune response, thereby effectively resisting swine fever virus infection. Furthermore, a single immunization can achieve optimal results, which not only reduces the number of immunization procedures and workload, and lowers the risk of stress and cross-infection that may be caused by multiple immunizations, but also improves immunization efficiency, saves time and costs, and is particularly suitable for large-scale farming.

[0082] According to embodiments of this application, the classical swine fever is at least caused by pigs infected with the classical swine fever virus strain CSFV-GZ-2009. The mRNA molecules of this application encode the E2-EDC and E2-EDC-N proteins, which are derived from the CSFV-GZ-2009 virus strain. Therefore, when this mRNA molecule, DNA molecule, protein, or polypeptide enters the pig's body, it can induce the production of high-titer neutralizing antibodies, effectively neutralizing the CSFV-GZ-2009 virus, increasing the number of E2-ECD-specific T cells capable of secreting interferon-γ (IFN-γ) or interleukin-2 (IL-2), further clearing infected cells, thereby exerting an immune protective effect.

[0083] It should be noted that the characteristics and advantages described above for mRNA molecules, DNA molecules, proteins, and peptides also apply to this drug, and will not be repeated here.

[0084] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from the market.

[0085] Example 1: Construction of antigen expression vector for classical swine fever virus mRNA vaccine

[0086] Classical swine fever virus mRNA vaccine sequences contain the following elements: a 5' untranslated region (5'UTR), a signal peptide sequence, an mRNA sequence encoding an antigen protein, a 3' untranslated region (3'UTR), and polyadenylate (poly A).

[0087] Specifically, the E2 protein coding sequence in the mRNA vaccine was designed based on the E2 gene sequence of the virulent strain CSFV-GZ-2009 (GenBank: HQ380231) of genotype 1.1. During vector construction, expression elements including the 5' UTR, signal peptide sequence, corresponding antigen expression gene sequence, His tag gene sequence, and 3' UTR were synthesized and assembled and cloned into a plasmid vector containing the T7 element. The proteins encoded by the antigen genes are E2-ECD, E2-ECD-N, E2-ECD-Na, and E2-ECD-Nb, respectively. E2-ECD-Na and E2-ECD-Nb proteins are smaller truncated versions of E2-ECD-N.

[0088] Table 2 Nucleic Acid Sequence Information

[0089]

[0090]

[0091]

[0092] After the synthesized DNA sequence was verified by sequencing, four plasmids were extracted using a plasmid extraction kit and named pST2-E2-ECD-His, pST2-E2-ECD-N-His, pST2-E2-ECD-Na-His, and pST2-E2-ECD-Nb-His, respectively. The plasmid concentration and purity were detected using a UV spectrophotometer for later use.

[0093] Example 2: In vitro transcription of mRNA

[0094] The transcription template was amplified from the plasmid obtained in Example 1 using a poly(d)T tail reverse primer to obtain a transcription template with a polyA tail. The linearized DNA template was transcribed using a NEB kit, and... The reagents were used for capping. Then, the DNA template was removed using RNase-Free DNase I. Finally, the RNA was recovered using NEB's RNA recovery and purification kit. Agarose gel analysis confirmed the integrity of the mRNA.

[0095] Example 3: mRNA transfection and expression detection

[0096] HEK293T cells were seeded in 12-well plates, and 0.3 μg of the mRNA obtained in Example 2 was transfected per well using Lipofectamine 2000 according to the kit instructions. Sixteen h after transfection, the cell culture supernatant was analyzed by Western blotting. For reducing SDS-PAGE electrophoresis, each sample was mixed with SDS loading buffer containing β-mercaptoethanol and boiled at 95°C for 15 min. For non-reducing SDS-PAGE electrophoresis, the supernatant of each sample was mixed with SDS loading buffer without β-mercaptoethanol. Then, the expression of E2-ECD and E2-ECD-N proteins was identified using a His-tagged antibody. The results are shown below. Figure 1 As shown, the experimental group transfected with E2-ECD mRNA exhibited a band of approximately 50 kDa in the reducing SDS-PAGE electrophoresis assay, while the band size was 100 kDa in the non-reducing SDS-PAGE electrophoresis assay, indicating that E2-ECD mRNA is expressed in its dimer form and secreted into the cell supernatant. The experimental group transfected with E2-ECD-N mRNA existed as a monomer of approximately 25 kDa in both electrophoresis assays.

[0097] Example 4: Preparation of Classical Swine Fever CSFV mRNA Vaccine

[0098] The mRNA obtained in Example 2 was packaged using LNP packaging technology. Lipids were dissolved in anhydrous ethanol at a mass ratio of cationic lipid (SM102):distearate phosphatidylcholine (DSPC):cholesterol:DMG-2000 = 50:10:38.5:1.5 to form the organic phase; the mRNA was dissolved in 50 mM citrate buffer (pH 4.0) to form the aqueous phase; subsequently, the organic and aqueous phases were combined at a volume ratio of 1:3 using a microfluidic device to encapsulate the mRNA. The resulting formulation was diluted with buffers such as PBS, dialyzed, and concentrated by ultrafiltration. After filtration through a 0.22 μm filter membrane, it was used for animal immunization.

[0099] The average particle size and dispersion coefficient of LNP-packaged mRNA vaccines were determined using a Malvern nanoparticle potentiometer via dynamic light scattering. Results are as follows: Figure 2 As shown, the particle size of the formulation is approximately 75.0 nm, and the dispersion index is less than 0.1. The encapsulation efficiency of the mRNA was detected using the Quant-it RiboGreen RNA assay kit. The results showed that the encapsulation efficiency was above 90%.

[0100] Example 5: Investigation into the minimum effective unit of classical swine fever CSFV mRNA vaccine

[0101] To investigate the minimal functional domain of the E2 protein for immunoprotective efficacy, four experimental groups were designed, with three SPF-grade Balb / c mice in each group. Mice in each of the four groups were immunized twice with the LNP-mRNA vaccines E2-ECD, E2-ECD-Na, and E2-ECD-Nb obtained in Example 4, respectively. Serum was collected from mice on day 28 after the first immunization, and antibody levels were detected using an ELISA assay. In short, 2 mg / ml purified E2-ECD was used as the antigen to coat 96-well plates. After washing three times with PBS containing 0.05% Tween 20 (PBST), blocking buffer was added, and the plates were incubated at room temperature for 1 hour. The washing was repeated three times, and antiserum of different dilutions was added. After incubation at 37°C for 1 hour, the plates were washed three times, and then incubated with goat anti-mouse IgG at room temperature for 1 hour. TMB was added for color development, and then 2N sulfuric acid was added to stop the reaction. The luminescence at OD450-570 was detected using a microplate reader. Finally, EC50 was calculated by fitting a four-parameter logistic curve using GraphPad PrismVersion 8.

[0102] like Figure 3As shown, high titers of E2-specific IgG antibodies were detectable in the serum of mice vaccinated only with the E2-ECD LNP-mRNA vaccine, with antibody titers ranging from 1:1600 to 1:25600. Among mice vaccinated with the E2-ECD-Nb mRNA vaccine, two produced low-level antibodies with a titer of 1:200, significantly lower than those produced with the E2-ECD LNP-mRNA vaccine. No antibodies were detected in the serum of mice vaccinated with the E2-ECD-NamRNA vaccine.

[0103] Based on the above research results, to further investigate the immunogenicity of the mRNA vaccine E2-ECD-N, which contains a longer fragment at the N-terminus of the E2-ECD protein, mice were immunized twice with the LNP-mRNA vaccines E2-ECD and E2-ECD-N obtained in Example 4. Serum from the mice was collected on day 28 after the first immunization, and antibody levels were detected using an ELISA assay.

[0104] like Figure 4 As shown, high titers of antibodies were detected in the serum of mice vaccinated with both E2-ECD and E2-ECD-N LNP-mRNA vaccines. Furthermore, there was no significant difference in the E2-specific antibody titers induced by the two mRNA vaccines. These results indicate that the E2-ECD-N mRNA vaccine, containing a longer N-terminal fragment of the E2-ECD protein, has comparable immunogenicity to the E2-ECD mRNA vaccine and is significantly superior to the E2-ECD-Na and E2-ECD-Nb mRNA vaccines.

[0105] Example 6: Humoral Immunity Detection of Classical Swine Fever CSFV mRNA Vaccine in Mice

[0106] Forty-five SPF-grade Balb / c mice were randomly divided into nine groups. One group served as the negative control, receiving PBS buffer. The remaining eight groups were the experimental groups. Two groups received a single injection of 0.5 μg and 5 μg of E2-ECD mRNA vaccine on day 0, respectively, and the other two groups received a second injection at the same dose on day 14. Two groups received a single injection of 0.5 μg and 5 μg of E2-ECD-N mRNA vaccine on day 0, respectively, and the other two groups received a second injection at the same dose on day 14. Serum was collected from mice on day 28 after the initial immunization, and antibody levels were detected using an ELISA assay. In short, 2 mg / ml purified E2-ECD was used as the antigen to coat 96-well plates. After washing three times with PBS containing 0.05% Tween 20 (PBST), blocking buffer was added, and the plates were incubated at room temperature for 1 hour. The washing was repeated three times, and antiserum at different dilutions was added. After incubation at 37°C for 1 hour, the plate was washed three times and then incubated with goat anti-mouse IgG at room temperature for 1 hour. TMB was added for color development, followed by the addition of 2N sulfuric acid to stop the reaction. The luminescence at OD450-570 was detected using a microplate reader. Finally, a four-parameter logistic curve was fitted using GraphPad Prism Version 8 to calculate EC50.

[0107] like Figure 5 As shown, both E2-ECD and E2-ECD-N mRNA vaccines induced similarly high antibody titer levels. Significant dose-response was observed in both the E2-ECD and E2-ECD-N mRNA vaccine groups, with a significant increase in antibody titers in the high-dose group. In contrast, the two-dose immunization showed a less significant relationship between dose and antibody induction levels. In both the low-dose and high-dose groups, booster immunization significantly enhanced the antibody response. However, the increase in antibody response was more significant in the low-dose group compared to the high-dose group. These data suggest a potential interchangeability between dose and booster in influencing antibody response, particularly in the high-dose group. These results indicate that E2-ECD and E2-ECD-N mRNA-LNP are comparable in immunogenicity, and vaccination with either one can induce high antibody titers.

[0108] Example 7: Long-term immunization assay of classical swine fever CSFV mRNA vaccine in mice

[0109] Next, the duration of humoral immune responses in mice vaccinated with E2-ECD and E2-ECD-N mRNA was assessed. Mice were immunized once, with each mouse receiving 0.5 μg and 5 μg, respectively. Serum samples were collected every 2 or 4 weeks post-immunization for 24 weeks to assess E2-ECD-specific antibody titers. Figure 6As shown, both the E2-ECD and E2-ECD-N mRNA vaccines induced stable and strong antibody responses over 24 weeks. Furthermore, antibody titers in the high-dose group continued to increase over 24 weeks, while antibody titers in the low-dose group remained at a stable level for 12 weeks without declining. These data suggest that a single immunization with either the E2-ECD or E2-ECD-N mRNA vaccine can provide high antibody titers that last for at least 6 months.

[0110] Example 8: Detection of Classical Swine Fever CSFV mRNA Vaccine in Mouse Cellular Immunization

[0111] Cellular immune responses in mice on day 10 following a single immunization were assessed using enzyme-linked immunospot (ELIS) ​​technology. To detect antigen-specific T-cell responses, IFN-γ and IL-2 ELISOT assays were performed using the Mabtech ELISPOT kit. Specifically, spleen cells (5 × 10⁶ cells / year) were used. 5 Cells (per well) were seeded into pre-coated ELISPOT plates containing capture antibody and stimulated with 30 μg / ml E2-ECD recombinant protein or left untreated. After 36 hours of protein incubation, cells were discarded and washed with PBS. Detection antibody was added and incubated at room temperature for 2 hours. Subsequently, the plate was washed, and streptavidin-ALP or streptavidin-HRP was added for 1 hour. Finally, substrate solution was added for further reaction. Once clear spots appeared, vigorous washing with deionized water was performed to prevent color development. The spots were quantified using a CTL S6 Ultra analyzer. Experimental results are as follows: Figure 7 As shown, both E2-ECD and E2-ECD-NmRNA vaccines can significantly induce the production of E2-ECD-specific IFN-γ and IL-2 secretory T cells, indicating that both candidate vaccines can induce effective cellular immune responses.

[0112] Example 9: Rabbit Immunization and Challenge Experiment with Classical Swine Fever CSFV mRNA Vaccine

[0113] Fifteen rabbits were randomly divided into three groups. One group served as a blank control, receiving a subcutaneous injection of 900 μl PBS solution. The remaining two groups were experimental groups, receiving subcutaneous injections of 100 μg / rabbit E2-ECD and E2-ECD-N mRNA vaccines, respectively, at week 0. On day 31 post-immunization, rabbits were challenged with the CSFV-C strain at a dose of 100 RID. Body temperature was measured after challenge. Results are as follows: Figure 8As shown, none of the rabbits vaccinated with the E2-ECD mRNA vaccine developed fever during the 4-day observation period. In the E2-ECD-N group, one in five rabbits experienced a short-term fever lasting less than 12 hours. In contrast, all rabbits in the control group developed fever (>40℃) that lasted for more than 48 hours. These data indicate that the E2-ECD mRNA vaccine completely protects rabbits from CSFV infection, and the E2-ECD-N mRNA vaccine also provides excellent protection against CSFV infection.

[0114] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. An mRNA molecule, characterized in that, The mRNA molecule encodes a first protein and / or a second protein; The first protein is selected from the extracellular region of the classical swine fever virus E2 protein; The second protein comprises the N1st to N2nd amino acids from the N-terminus of the first protein; N1 is selected from integers from 1 to 5; N2 is selected from integers between 168 and 172.

2. The mRNA molecule according to claim 1, characterized in that, N1 is selected from integers from 1 to 3; N2 is selected from integers between 170 and 172.

3. The mRNA molecule according to claim 1, characterized in that, The first protein has an amino acid sequence as shown in SEQ ID NO: 1 or an amino acid sequence having at least 85% homology with it; Optionally, the second protein has an amino acid sequence as shown in SEQ ID NO: 2 or an amino acid sequence having at least 85% homology with it; Optionally, the mRNA molecule comprises, from the 5' end to the 3' end, a 5' cap structure, a 5' untranslated region, a signal peptide sequence, a coding region, a 3' untranslated region, and a polyadenylate. The signal peptide sequence has a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence having at least 85% homology with it; The 5' untranslated region has a nucleotide sequence as shown in SEQ ID NO: 4 or a nucleotide sequence having at least 85% homology with it; The 3' untranslated region has a nucleotide sequence as shown in SEQ ID NO: 5 or a nucleotide sequence having at least 85% homology with it; The polyadenylated acid contains 50-150 bases A, and preferably has a nucleotide sequence as shown in SEQ ID NO: 6 or a nucleotide sequence having at least 85% homology with it; Optionally, the mRNA molecule comprises natural nucleic acids; Optionally, the mRNA molecule includes modified nucleic acids, wherein the modified nucleic acids include pseudouridine triphosphate modification or N1-methylpseudouridine triphosphate modification; Optionally, the mRNA exists in monomeric form or in the form of homodimers and / or homotrimers formed by the fusion of linker fragments; Optionally, the mRNA is a linear mRNA, a circular mRNA, or a self-replicating mRNA.

4. The mRNA molecule according to any one of claims 1-3, characterized in that, The mRNA molecule has a nucleotide sequence as shown in SEQ ID NO: 7 or 8, or a nucleotide sequence that is at least 85% homologous to it.

5. A DNA molecule, characterized in that, The DNA molecule encodes the mRNA molecule according to any one of claims 1 to 4; Optionally, the DNA molecule includes a first DNA molecule and / or a second DNA molecule; The first DNA molecule encodes the first protein, and the second DNA molecule encodes the second protein; Optionally, the first DNA molecule has a nucleotide sequence as shown in SEQ ID NO: 9 or a nucleotide sequence having at least 85% homology with it; The second DNA molecule has a nucleotide sequence as shown in SEQ ID NO: 10 or a nucleotide sequence that is at least 85% homologous to it.

6. A protein or polypeptide, characterized in that, The protein or polypeptide comprises the amino acid sequence encoded by the mRNA as described in any one of claims 1 to 4.

7. A biomaterial, characterized in that, The biomaterial is an expression vector, recombinant cell, or engineered bacteria containing the DNA molecule described in claim 5.

8. A pharmaceutical composition, characterized in that, It includes at least one of the following: the mRNA molecule according to any one of claims 1 to 4, the DNA molecule according to claim 5, and the protein or polypeptide according to claim 6; Optionally, the drug includes a vaccine.

9. The pharmaceutical composition according to claim 8, characterized in that, The drug further includes a carrier, which may be a viral carrier or a non-viral carrier; the viral carrier is selected from adeno-associated virus carriers, adenovirus carriers, lentiviral carriers or herpes simplex virus carriers; the non-viral carrier is selected from plasmids, cationic lipids, liposome nanoparticles, liposomes, polymer-based carriers, virus-like particles or extracellular vesicles. Optionally, the liposome nanoparticles comprise: 40–60 parts by weight of ionizable cationic lipids; 8-16 parts by weight of phospholipids; 30-45 parts by weight of cholesterol lipids; 1-5 parts by weight of PEG-modified lipids; Optionally, the ionizable cationic lipid comprises at least one of the following: amino cationic lipid SM102, 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)-2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)aminodiyl)di(dodecane-2-ol), (6Z,9Z,28Z,31Z)-heptaneheptadecene-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate, N,N-dimethyl-2,3-bis((9Z,12Z)-octadec-9,12-dien-1-oxy)propylamine, 2-(2,2-di((9Z,12Z)-octadec-9,12-dien-1-yl)-1 3-Dioxane-4-yl)-N,N-dimethylethylamine, 3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione, 10,13-dimethyl-17-(6-methylheptyl-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetrahydro-1H-cyclopentanphenanthrene-3-yl 3-(1H-imidazol-5-yl)propionate, (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadec-9,12-dien-1-yl)tetradec-15,18-dien-1-amine, (4Z,15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadec-9,12-dien-1-yl)tetradec-15,18-dien-1-amine Z)-Octadec-9,12-dien-1-yl)tetradec-4,15,18-trien-1-amine, N,N-dioleoyl-N,N-dimethylammonium chloride, N,N-distearate-N,N-dimethylammonium bromide, 1,2-dimyristoylpropyl-3-dimethylhydroxyethylammonium chloride, dioleoyloxy-N-[2-arginine formamide)ethyl]-N,N-dimethyl-1-propanium trifluoroacetate, octadecanoamide arginine, 1,2-dioleoyl-3-dimethylaminopropane, N,N-dimethyl-(2,3-dioleoyloxy)propylamine and N,N-dimethyl-(2,3-dimyristoyloxy)propylamine, 1,2-dilinyloxy-N,N-dimethylaminopropane, (2S)-2-(4- ((10,13-Dimethyl-17-(6-methylheptyl-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetrahydro-1H-cyclopentan[a]phenanthrene-3-yl)oxy)butoxy)-N,N-dimethyl-3-((9Z,12Z)-octadec-9,12-dien-1-oxy)propane, 2-[5'-(cholest-5-en-3[β]-oxy)-3'-oxopentoxy)-3-dimethyl-1-(cis,cis-9',12'-octadecadienoxy)propane, N,N-dimethyl-3,4-dioleoyloxybenzylamine, 1,2-N,N'-dioleoylamino-3-dimethylaminopropane, (9Z,9'Z,12Z,12'Z)-3-(dimethylamino)propane-1,2-diylbis(octadec-9,12-dienoate), 1,2-dilininylamino-3-dimethylaminopropane, 2,2-dilininyl-4-dimethylaminomethyl-[1,3]-dioxane, 2-((2,3-bis((9Z,12Z)-octadec-9,12-dien-1-oxy)propyl)dithio)-N,N-dimethylethylamine; Optionally, the cholesterol lipid is cholesterol or PEGylated cholesterol.

10. The use of the mRNA molecule of any one of claims 1 to 4, the DNA molecule of claim 5, the protein or polypeptide of claim 6, or the pharmaceutical composition of claim 8 or 9 in the preparation of a medicament for the prevention or treatment of classical swine fever; Optionally, the classical swine fever is caused at least by pigs infected with the classical swine fever virus strain CSFV-GZ-2009.

Images