A multiple myeloma RPMI-8226 cell line GAS6-RASA3 fusion gene and a detection kit, detection method and application thereof

Abstract

The application discloses a multiple myeloma RPMI-8226 cell line GAS6-rasa3 A fusion gene with a sequence as shown in SEQ ID NO:1, which can be used as a specific molecular marker of multiple myeloma cells to prepare products for monitoring the pathogenesis of multiple myeloma and the micro residual disease of myeloma cells. The application also provides a kit for detecting a multiple myeloma RPMI-8226 cell strain, wherein the kit comprises GAS6-rasa3 A positive control of a plasmid standard of the fusion gene. The application also provides a new method for detecting multiple myeloma cells, which has a sensitivity of up to one millionth, and has great application potential for the construction of a multiple myeloma animal model and the evaluation of drug efficacy.

Description

Technical Field

[0002] This invention relates to the field of biomedical technology, specifically to a multiple myeloma RPMI-8226 cell line. GAS6-RASA3 Fusion genes and their detection kits, detection methods and applications. Technical Background

[0003] Multiple myeloma (MM) is a malignant tumor characterized by the abnormal clonal proliferation of plasma cells in the bone marrow, accounting for 10%-15% of hematologic malignancies and is a relatively common hematologic malignancy affecting the elderly. Constructing animal models of multiple myeloma using myeloma cell lines is of great significance for exploring its pathogenesis and developing drugs. RPMI-8226 cells are a human multiple myeloma cell line widely used in the construction of mouse models of multiple myeloma.

[0004] Currently, the detection of myeloma cell counts in mice mainly relies on techniques such as flow cytometry. However, these methods have low sensitivity, typically only reaching one in ten thousand (10^15). -4 The sensitivity is on the order of magnitude of 10^20. This limitation makes it difficult for existing technologies to effectively capture the dynamic changes in early-stage lesions or minimal residual disease (MRD) of myeloma. Therefore, developing a highly sensitive detection technology to accurately monitor the progression of myeloma and MRD has become a critical issue that urgently needs to be addressed in this field. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a multiple myeloma RPMI-8226 cell line. GAS6-RASA3 Fusion gene and its detection kit, detection method and application: The fusion gene can be used as a specific molecular marker for multiple myeloma cells to prepare products for monitoring the progression of multiple myeloma disease and minimal residual disease of myeloma cells in animal models.

[0006] The GAS6-RASA3 The sequence of the fusion gene is shown in SEQ ID NO:1. This fusion gene is composed of... GAS6 and RASA3 It is formed by fusion and exists in the multiple myeloma RPMI-8226 cell line.

[0007] This invention also provides a kit for detecting the multiple myeloma RPMI-8226 cell line, the kit comprising: GAS6-RASA3 Positive control for plasmid standards of fusion genes.

[0008] Furthermore, the kit also includes: an upstream primer, a downstream primer, a Taqman probe, a mouse internal control upstream primer, a mouse internal control downstream primer, a mouse internal control probe, a PCR reaction buffer, and a negative control; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3; the nucleotide sequence of the Taqman probe is shown in SEQ ID NO:4; the nucleotide sequence of the mouse internal control upstream primer is shown in SEQ ID NO:5; the nucleotide sequence of the mouse internal control downstream primer is shown in SEQ ID NO:6; and the nucleotide sequence of the mouse internal control probe is shown in SEQ ID NO:7.

[0009] Furthermore, the 5' end of the Taqman probe is labeled with a FAM group, and the 3' end of the Taqman probe is labeled with a BHQ group. The positive control includes [a substance / component]. GAS6-RASA3 Plasmid standards for fusion genes and those containing mouse-derived genes Actb ( mActb The negative control contained plasmids of the gene.

[0010] The kit described above is used to detect [information] in the RPMI-8226 cell line. GAS6-RASA3 The detection method for fusion genes includes the following steps: (1) Total RNA was extracted from RPMI-8226 cells and reverse transcribed into cDNA as the sample to be tested; (2) Prepare the PCR reaction solution, and then add the sample to be tested, the positive control and the negative control respectively; (3) Real-time fluorescence PCR instrument detection, reaction conditions: 95℃ pre-denaturation for 1 min; 95℃, 15 s, 58℃, 35 s, 40 cycles of reaction, fluorescence signal was collected at 56℃, 35 s; wherein the PCR reaction solution includes upstream primer, downstream primer, Taqman probe, mouse internal control upstream primer, mouse internal control downstream primer, mouse internal control probe, and PCR reaction buffer.

[0011] Furthermore, the RPMI-8226 cell line was obtained from a mouse model of multiple myeloma.

[0012] Internal reference gene mActb The probe is labeled with a FAM group at its 5' end and a TAMRA group at its 3' end. The FAM group is a reporter group and the TAMRA group is a quencher group.

[0013] When the target DNA molecule is not present in the sample, the fluorescence of FAM is quenched by BHQ and no fluorescence is emitted; when the target DNA molecule is present in the sample, the probe binds to the target DNA molecule, and then the probe is degraded by the 5'→3' double-stranded exonuclease activity of Taq enzyme to release the fluorescent group FAM and emit fluorescence.

[0014] PCR reaction buffers are commonly used in this field, generally including cDNA first-strand synthesis reagents (HiScript® III RT SuperMix for qPCR (+gDNA wiper) kit, Novizan Biosciences, R323-01) and real-time fluorescence PCR mixture (Pro Taq HS Premix Probe qPCR Kit, Accurate Biotechnology, AG11704). Their main components include DNA polymerase and Mg... 2+ dNTPs, reverse transcriptase, and DTT.

[0015] The conditions for a valid test result are as follows: if there is no target gene amplification signal curve, and the internal control, positive control, and negative control are all normal, the result is negative; if there is a target gene amplification signal curve, and the internal control, positive control, and negative control are all normal, the result is positive. If the internal control, positive control, or negative control are abnormal, the cause must be identified, adjustments made, and the test repeated.

[0016] This invention identifies and verifies that multiple myeloma cell line RPMI-8226 carries a novel fusion gene. GAS6- RASA3 Subsequently, a kit for the detection and quantification of fusion genes combining real-time quantitative PCR and TaqMan probe technology was developed. Real-time PCR results, expressed as Ct values, offer advantages such as high specificity, high sensitivity, simple operation, and more intuitive results, making it the preferred method for detecting trace fusion genes. This invention's kit utilizes TaqMan probes for real-time fluorescent PCR detection. GAS6-RASA3 The fusion gene was used to monitor MRD in mice.

[0017] The beneficial effects of this invention are as follows: (1) The fusion gene carried by RPMI-8226 multiple myeloma cells was screened and identified using bioinformatics technology. GAS6-RASA3 This is a novel fusion gene that has not been reported to date. It can be used as a specific molecular marker in the preparation of products for monitoring the pathogenesis of multiple myeloma and minimal residual disease of myeloma cells in animal models.

[0018] (2) The invention relates to the following: GAS6-RASA3Fusion gene detection kits offer the following advantages: ① High accuracy: Utilizing both probes and primers for dual control, resulting in high specificity and low false positives. ② High specificity: Utilizing specific probes to identify fusion gene sequences. ③ Real-time monitoring: Monitoring of amplification signals throughout the entire process. ④ Safe and convenient: Simple and safe operation, highly automated, and prevents contamination. ⑤ Fast: Detection completes in 100 minutes.

[0019] (3) This invention uses real-time fluorescence PCR technology combined with Taqman probes to detect the presence of the virus in mice. GAS6-RASA3 Fusion gene and mouse internal reference gene mActb The expression status of genes can distinguish low-abundance gene signals from complex backgrounds, with a sensitivity of one part per million (10^12). -6 The sensitivity level of this technology has great potential for the construction of animal models of multiple myeloma and the evaluation of drug efficacy. Attached Figure Description

[0020] Figure 1 GAS6-RASA3 Fusion gene identification and verification. A: RPMI-8226 cell line qRT-PCR amplification of... GAS6- RASA3 The product of the fusion gene; BC: Sanger sequencing validated it. GAS6-RASA3 Fusion gene map and sequencing results.

[0021] Figure 2 pCE-Zero- GAS6-RASA3 The process of constructing a standard. A: pCE-Zero- GAS6-RASA3 Plasmid map; B: pCE-Zero- GAS6-RASA3 Sequencing results.

[0022] Figure 3 Fusion genes GAS6-RASA3 Legend of molecular diagnostic results. AB: GAS6-RASA3 Standard curve, positive samples and negative controls; C: bone marrow samples at different time points in a multiple myeloma mouse model. GAS6-RASA3 Results of TaqMan probe detection of fusion gene; D: Flow cytometry results of human multiple myeloma cells in bone marrow at different time points in a mouse model of multiple myeloma. Detailed Implementation

[0023] To make the technical problems, solutions, and advantages of this invention clearer, a detailed description will be provided below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0024] The numerical ranges used in this application are approximate values ​​and therefore may include values ​​outside the range unless otherwise stated. The numerical range includes all values ​​from the lower limit to the upper limit, increasing by one unit, provided there is an interval of at least two units between any lower and any higher value. For ranges containing values ​​less than 1 or fractions greater than 1 (e.g., 1.1, 1.5, etc.), one unit is appropriately considered as 0.0001, 0.001, 0.01, or 0.1. For ranges containing single digits less than 10 (e.g., 1 to 5), one unit is generally considered as 0.1. These are merely specific examples of what is intended to be expressed, and all possible combinations of values ​​between the listed lowest and highest values ​​are considered to be clearly described in this application.

[0025] The terms “comprising,” “including,” “having,” and their derivatives do not exclude the presence of any other components, steps, or processes, regardless of whether such other components, steps, or processes are disclosed in this application. To eliminate any doubt, unless expressly stated otherwise, all compositions using the terms “comprising,” “including,” or “having” in this application may contain any additional additives, excipients, or compounds. Conversely, except for those necessary for operational performance, the term “substantially constitutes…” excludes any other components, steps, or processes described below with respect to that term. The term “consisting of…” does not include any components, steps, or processes not specifically described or listed. Unless expressly stated otherwise, the term “or” refers to the individual members listed or any combination thereof.

[0026] The experimental reagents, sequencing materials, and laboratory animals involved in this invention were provided by the following companies: 1. Gene sequencing and primer synthesis were completed by Shanghai Sangon Biotech Co., Ltd. 2. cDNA first-strand synthesis reagents and homologous recombination reaction kits were purchased from Novizan Biosciences. 3. The real-time fluorescence PCR mixture was purchased from Accurate Biotechnology. 4. Escherichia coli DH5α was purchased from Shanghai Sangon Biotech Co., Ltd. 5. All NOD- Prkdc scid Il2rg null (NYG) (4-week-old female) was purchased from Liaoning Changsheng Biotechnology Co., Ltd. Example 1: Multiple myeloma cell line RPMI-8226 carrying GAS6-RASA3 Construction and detection of new fusion genes 1. RNA extraction from RPMI-8226 cells (1) Collect RPMI-8226 cells into a 15 mL enzyme-free sterile centrifuge tube and centrifuge at 1,500 rpm for 5 min.

[0027] (2) Carefully remove the supernatant, wash the cell pellet with 1 mL of sterile 1×PBS, and centrifuge at 1,500 rpm for 5 min.

[0028] (3) Carefully remove the supernatant, add 1 mL TRIzol to dissolve the cell pellet, add 200 μL chloroform and shake vigorously for 45 s, then let stand at room temperature for 3 min.

[0029] (4) Centrifuge at 12,000 g for 10 min at 4℃.

[0030] (5) Carefully transfer the supernatant to a new 1.5 mL enzyme-free centrifuge tube using a 200 μL enzyme-free pipette tip, add an equal volume of isopropanol to the supernatant, mix gently, and allow to settle at room temperature for 10 min or at -20℃ overnight.

[0031] (6) Centrifuge at 12,000 g for 15 min at 4℃.

[0032] (7) Carefully remove the supernatant, add 75% ethanol to wash the precipitate, and centrifuge at 12,000 g for 15 min at 4°C.

[0033] (8) Carefully remove the supernatant and remove as much residual alcohol solution as possible. Dry the precipitate at room temperature for 5 min. After the precipitate is dry and transparent, add an appropriate volume of DEPC water to dissolve the RNA precipitate. Gently pipette and mix well, then centrifuge in a handheld centrifuge for 30 s and place on ice.

[0034] (9) The RNA concentration was determined using a NANODROP2000 spectrophotometer (Thermo Scientific) and stored at -80℃ for later use.

[0035] 2. RNA reverse transcription The reverse transcription operation was performed according to the instructions of the Novozymes HiScript® III RT SuperMix for qPCR (+gDNA wiper) kit, using the following system and reaction conditions. The instrument used was an Agilent gradient PCR instrument (G8800-001).

[0036] (1) Genomic DNA removal

[0037] Mix gently by pipetting, 42°C, 2 min.

[0038] (2) Configure the reverse transcription reaction system Add 5×HiScript Ⅲ qRTSuperMix directly to the reaction tube in step (1).

[0039]

[0040] (3) Perform reverse transcription reaction 37℃ for 15 min; 85℃ for 5 s. Then the sample was stored at -20℃ for later use.

[0041] 3. Construction of Standard Products 3.1 GAS6-RASA3 Amplification of fusion genes According to the instructions for use of the Novizan C115 kit, cDNA from the RPMI-8226 multiple myeloma cell line was amplified using RPMI-8226 multiple myeloma cell line as a template. GAS6-RASA3 The full-length sequence of the fusion gene, primer sequences (see Table 3), reaction system (see Table 4), and reaction conditions (see Table 5) are as follows:

[0042]

[0043]

[0044] The number of cycles is 35.

[0045] 3.2 Purification of PCR products The PCR products were subjected to 1.5% agarose gel electrophoresis. The PCR products were recovered by gel cutting based on the target band, and the concentration of the recovered products and the absorbance at 260 nm, 280 nm, and 230 nm were measured using a spectrophotometer (Thermo Scientific). The gel cutting and recovery procedure followed the instructions of the Gel DNA Recovery Kit (D2111) from Guangzhou Meiji Biotechnology Co., Ltd.

[0046] 3.3 Homologous recombination reaction (ligation of PCR products and vectors) The reverse transcription operation was performed according to the instructions of the ClonExpress® Ultra One Step Cloning Kit from Novizan Biosciences, using the following recombination reaction system (Table 6.1) and reaction conditions (Table 6.2).

[0047]

[0048]

[0049] Gently mix with a pipette and incubate at 50°C for 15 minutes in a PCR instrument.

[0050] 3.4 Transformation of Recombinant Products (1) Take 100 μL of Escherichia coli DH5α competent cells from the -80℃ freezer, place them on ice to thaw, take 5 μL of recombinant product and add it to the competent cells, and place them on ice for 30 min. (2) Heat shock in a 42℃ water bath for 45 s, then quickly transfer to ice and place for 5 min; (3) Add 900 μL of LB medium and incubate at 37°C with shaking for 1 h; (4) Centrifuge at 5,000 rpm for 5 min, discard 800 μL of culture medium, gently resuspend the precipitate by pipetting, and spread the bacterial solution evenly on LB agar plates containing ampicillin antibiotic (50 μg / mL) in a sterile operating table. Then place the LB plates upright in a 37℃ incubator and invert the plates for 12-16 h after 10 min. (5) Randomly select 8 single-clone colonies and place them in 20 μL of sterile water. Use upstream and downstream primers of the fusion gene to verify the fusion gene by PCR. Inoculate the successfully identified bacterial solution into LB medium containing ampicillin (50 μg / mL) and culture for 12-16 h. Send the bacterial solution to Sanger for sequencing. The bacterial solution with correct sequencing is further amplified and plasmid extracted, and stored at -20℃ for later use.

[0051] 4. Taqman probe detection 4.1 Preparation of Standard Templates First, calculate the plasmid copy number based on the molecular weight [plasmid copy number = (Avogadro's constant × plasmid concentration) / (fragment size × 660)]. Then, serially dilute the plasmid with sterile distilled water at a 10-fold concentration gradient. 3 ~10 7 A copy / μL was used as a template for real-time quantitative PCR (QT-PCR) standards.

[0052] 4.2 Real-time quantitative PCR The real-time quantitative PCR operation was performed according to the instructions of the Accurate Biotechnology Pro Taq HS PremixProbe qPCR Kit, following the system (see Table 7) and reaction conditions (see Table 8). The instrument used was the Bio-Rad CFX96 real-time quantitative PCR system.

[0053]

[0054] A two-step PCR reaction procedure was used.

[0055]

[0056] 4.3 Calculating the expression level of the target gene The copy number of the target gene and the internal reference in the test sample were calculated using the sample CT value and the standard curve. mActb The number of copies, selected mActb For samples with a CT value ≤ 35, the expression level of the target gene is calculated according to the formula.

[0057] Target gene expression level = (target gene copy number / internal reference gene copy number) × 100%.

[0058] Bioinformatics techniques were used to screen for fusion genes in the multiple myeloma cell line RPMI-8226, and no fusion genes had been reported in a reputable fusion gene repository or in the literature. GAS6-RASA3 New fusion genes.

[0059] GAS6-RASA3 The new fusion gene is from GAS6 Exons 1-12 of the gene and RASA3 The 23rd and 24th exons are spliced ​​together, and the specific CDS sequence is shown in SEQ ID NO:1.

[0060] Sanger sequencing of the PCR products confirmed that the RPMI-8226 cell line carried the virus. GAS6-RASA3 New fusion gene, verification results are available in [link / see details]. Figure 1 .

[0061] A suitable plasmid was selected, and a sequence containing the fusion breakpoint was cloned into the plasmid. Positive clones were selected for PCR amplification and Sanger sequencing to verify the correctness of the sequence transformed into the plasmid, thereby obtaining the standard. Figure 2 ).

[0062] Primers and probes for detecting the internal reference / target gene were designed, and real-time fluorescence PCR technology was used to detect the internal reference gene. mActb , GAS6-RASA3 Expression of the fusion gene. The kit optimizes amplification efficiency and rate by adjusting the primer-probe ratio of the internal control / target gene and the PCR reaction conditions.

[0063] 1. Design of specific primers and probes According to gene sequence ( mActb Gene sequence, GAS6 Gene sequence, RASA3The gene sequences were all obtained from the nucleic acid database of the U.S. National Center for Biotechnology Information. mActb Gene Entrez Gene ID, Gene Reference Sequence NM_007393.5; GAS6 Gene Entrez, Gene ID 2621, Gene Reference Sequence NM_000820.4 RASA3 Specific probes and primers were designed based on the gene Entrez (Gene ID22821, gene reference sequence NM_007368.4).

[0064] 2. Reagent kit allocation system cDNA first-strand synthesis reagent: HiScript® III RT SuperMix for qPCR (+gDNA wiper) kit (Novizan Biotechnology, R323-01). Detection system PCR reaction solution: Pro Taq HS Premix Probe qPCR Kit (Accurate Biotechnology, AG11704), whose main components include DNA polymerase, Mg... 2+ dNTPs, reverse transcriptase, and DTT.

[0065] Primers and probes: including detection GAS6-RASA3 Fusion genes and internal reference mActb The primers and their corresponding probes are as follows: GAS6-RASA3 -F: AGCGGCTTCGCCTTCTACAG (SEQ ID NO: 2) GAS6-RASA3 -R: CGTCTTGTAGGTCTCCTGGG (SEQ ID NO: 3) GAS6-RASA3 -Probe: FAM-AGCCTGGACTACAAGGCCTGTGGGAGCAAATC-BHQ (SEQ ID NO:4) mActb -F: AGAAGCTGTGCTATGTTGCTCTA (SEQ ID NO:5) mActb -R: AAGGCTGGAAAAGAGCCTCAG (SEQ ID NO:6) mActb -Probe: FAM-TCGAGCAGGAGATGGCCACTGCCGCATC-TAMRA (SEQ ID NO: 7).

[0066] Positive control: contains substances containing... GAS6-RASA3 Plasmid standards for fusion genes and those containing mActb The gene plasmid; negative controls: deionized water and cDNA from three other multiple myeloma cell lines (U266, KMS-11, MM1S).

[0067] 1. Collect blood from the tail vein and fundus of model mice, or directly extract bone marrow cells from mice, and extract total RNA from the cells: Collect venous blood or bone marrow samples from mice, add 3 volumes of erythrocyte lysis buffer, invert and mix well, place on ice for 15 min, centrifuge at 450 g for 10 min to collect cells, discard the supernatant, add 1 mL of TRIzol to the cells, repeatedly pipette until the precipitate is completely dissolved, and let stand at room temperature for 5 min; add 0.2 mL of chloroform, vortex well; centrifuge at 12,000 rpm at 4℃ for 10 min, carefully transfer the supernatant to a new enzyme-free centrifuge tube; add an equal volume of isopropanol, invert and mix thoroughly, and let stand at room temperature for 10 min; centrifuge at 4℃ at 12,000 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate; centrifuge at 4℃ at 12,000 rpm for 5 min, discard the ethanol solution; dry at room temperature for 5-10 min, and add 20 μL of RNase-free water to dissolve the precipitate.

[0068] 2. Following the instructions of the Novozymes HiScript® III RT SuperMix for qPCR (+gDNA wiper) kit, reverse transcribe the RNA into cDNA.

[0069] 3. Reagent preparation: Prepare X μL of PCR reaction solution for the detection system according to the number of samples to be tested, where X = 18 μL reaction solution × (n samples + 1 positive control + 1 negative control + 1 blank control). Each 18 μL aliquot consists of the following: 2×Pro Taq HS Probe Premix (10 μL), Primer F (10 μM) (0.4 μL), Primer R (10 μM) (0.4 μL), Probe (0.4 μL), and RNase-free water (6.8 μL).

[0070] 4. Sample addition: Add 2 μL of cDNA, positive control and negative control to the PCR reaction solution of the detection system respectively; the blank control is 2 μL of physiological saline or no substance is added.

[0071] 5. Detection: Detection was performed on a real-time fluorescence PCR instrument, such as the Bio-Rad CFX96. Reaction conditions: 95℃ pre-denaturation for 1 min; 95℃, 15 s, 58℃, 35 s, 40 cycles; fluorescence signal was collected at 56℃, 35 s.

[0072] 6. Result Interpretation: If there is no target gene amplification signal curve and the internal control, positive control, and negative control tests are all normal, the result is negative. If there is a target gene amplification signal curve and the internal control, positive control, and negative control tests are all normal, the result is positive. If the internal control, positive control, or negative control shows abnormalities, the cause needs to be identified, adjustments made, and the tests repeated. Figure 3 AB demonstrated GAS6-RASA3 The standard curve, positive samples, and negative controls for the test.

[0073] 7. GAS6-RASA3 It can serve as a specific molecular marker for constructing multiple myeloma animal models using the RPMI-8226 cell line: all NOD- Prkdc scid Il2rg null (NYG) mice (4 weeks old, female) were purchased from Liaoning Changsheng Biotechnology Co., Ltd. NYG mice were injected via tail vein with human multiple myeloma cells RPMI-8226. The proportion of human myeloma cells in the mice was detected by flow cytometry at different time points. The experimental animals were divided into two groups of three: ① Control group, injected via tail vein with 200 μL of sterile 1×PBS; ② RPMI-8226 group, injected via tail vein with 2×10⁻⁶ human multiple myeloma cells. 5 Cells / 200 μL 1×PBS. The proportion of human multiple myeloma cells in mouse bone marrow was measured on days 3, 6, and 12 after tail vein injection of myeloma cells. The detection kit constructed above was used to analyze a group of... GAS6-RASA3 MRD monitoring was performed on samples from positive mice at four time points. Figure 3 D). The experiment found that: (1) RPMI-8226 was first expressed in the mice on day 6 after the tail vein injection in this group of animal models. GAS6-RASA3 As time goes on GAS6-RASA3 Expression gradually increased, and on day 12, the mice's... GAS6-RASA3 Expression was higher. Human myeloma cells were not detected by flow cytometry on days 3 and 6, but were detected on day 12. The TaqMan probe detection results showed significantly higher expression compared to the flow cytometry results. These results indicate that... GAS6-RASA3 It can be used as a novel molecular marker for monitoring MRD in animal models, and the accuracy and reliability of the kit have been demonstrated.

[0074] The results in summary demonstrate that this kit can detect samples with high throughput, speed, and accuracy, while exhibiting good specificity and reproducibility, and effectively avoiding false positive and false negative results.

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements without departing from the principle of the present invention, and these improvements should also be considered within the scope of protection of the present invention.

[0076] sequence list The Second Affiliated Hospital of Dalian Medical University Multiple myeloma RPMI-8226 cell line GAS6-RASA3 Fusion genes and their applications SEQ ID NO:1 SEQ ID NO:2 AGCGGCTTCGCCTTCTACAG SEQ ID NO:3 CGTCTTGTAGGTCTCCTGGG SEQ ID NO:4 AGCCTGGACTACAAGGCCTGTGGGAGCAAATC SEQ ID NO:5 AGAAGCTGTGCTATGTTGCTCTA SEQ ID NO:6 AAGGCTGGAAAAGAGCCTCAG SEQ ID NO:7 TCGAGCAGGAGATGGCCACTGCCGCATC SEQ ID NO:8 GGATCTTCCAGAGATATAAACCCTCGTCTGGATGGC SEQ ID NO:9 CTGCCGTTCGACGATCTGGCTTCCATATTTCGTC SEQ ID NO:10 GGATCTTCCAGAGAT ATGGATGACGATATCGCTGCG SEQ ID NO:11 CTGCCGTTCGACGATCTAGAAGCACTTGCGGTGCAC

Claims

1. A multiple myeloma RPMI-8226 cell line GAS6-RASA3 Fusion gene, characterized by, The sequence of the gene is shown in SEQ ID NO:

1.

2. A kit for detecting the multiple myeloma RPMI-8226 cell line, characterized in that, The kit includes [features / equipment] GAS6-RASA3 Positive control for plasmid standards of fusion genes.

3. The kit for detecting multiple myeloma RPMI-8226 cell line according to claim 2, characterized in that, The kit also includes: upstream primer, downstream primer, Taqman probe, mouse internal control upstream primer, mouse internal control downstream primer, mouse internal control probe, PCR reaction buffer, and negative control; The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2; The nucleotide sequence of the downstream primer is shown in SEQ ID NO:3; The nucleotide sequence of the Taqman probe is shown in SEQ ID NO:4; The nucleotide sequence of the upstream primer of the mouse internal control is shown in SEQ ID NO:5; The nucleotide sequence of the downstream primer of the mouse internal control is shown in SEQ ID NO:6; The nucleotide sequence of the mouse-derived internal reference probe is shown in SEQ ID NO:

7.

4. The kit for detecting multiple myeloma RPMI-8226 cell line according to claim 3, characterized in that, The 5' end of the Taqman probe is labeled with a FAM group, and the 3' end of the Taqman probe is labeled with a BHQ group.

5. A method for detecting the multiple myeloma RPMI-8226 cell line, characterized in that, The detection method includes the following steps: (1) Total RNA was extracted from RPMI-8226 cells and reverse transcribed into cDNA as the sample to be tested; (2) Prepare the PCR reaction solution, and then add the sample to be tested, the positive control and the negative control respectively; (3) Real-time fluorescence PCR instrument detection, reaction conditions: 95℃ pre-denaturation for 1 min; 95℃ for 15 s; 58℃ for 35 s; 40 cycles of reaction, fluorescence signal was collected at 56℃ for 35 s; The PCR reaction solution includes an upstream primer, a downstream primer, a Taqman probe, a mouse internal control upstream primer, a mouse internal control downstream primer, a mouse internal control probe, and a PCR reaction buffer.

6. The detection method for the multiple myeloma RPMI-8226 cell line according to claim 5, characterized in that, The RPMI-8226 cell line was obtained from a mouse model of multiple myeloma.

7. GAS6-RASA3 Application of fusion genes as molecular markers in the preparation of products for monitoring tumor burden in multiple myeloma.

Images