Methods and systems for multi-round gene editing and plasmid elimination based on e. coli crisper-cas9

Abstract

The application discloses a kind of based on E. coli CRISPR-Cas9 multi-round gene editing and plasmid removal method, system, it is related to CRISPR-Cas9 gene editing technical field.The SacB toxin gene is inserted into sgRNA expression plasmid, and SacB gene expression cassette controlled by temperature-sensitive promoter is introduced on Cas9 expression plasmid.After carrying out a round of gene editing, only need to add appropriate amount of sucrose in system, can utilize the toxicity of SacB gene in the presence of sucrose, quickly and specifically remove sgRNA plasmid carrying SacB, Cas9 plasmid is inhibited SacB expression due to PL promoter at low temperature and can be retained.When entire gene editing is completed, raise culture temperature and add appropriate amount of sucrose, simultaneously activate SacB anti-screen system on two plasmids, realize the complete removal of all exogenous tool plasmid.The application realizes the efficient, fast, sequential removal of gene editing tool plasmid, significantly improves the efficiency of multi-round gene editing, simplifies operation process.

Description

Technical Field

[0001] This invention relates to the field of CRISPR-Cas9 gene editing technology, and in particular to a method and system for multi-round gene editing and plasmid removal based on Escherichia coli CRISPR-Cas9. Background Technology

[0002] The CRISPR / Cas9 system has become one of the most powerful gene editing tools in microbial genetic manipulation. In multi-round gene editing (e.g., knocking out multiple genes sequentially, or introducing multi-site mutations), it is usually necessary to co-transform plasmids expressing Cas9 protein and plasmids expressing sgRNA into the host bacteria.

[0003] Existing CRISPR / Cas9 gene editing technology has a significant limitation: after the previous round of gene editing, the transfected foreign plasmids remain stably within the host cell and are difficult to remove effectively. These residual plasmids cause a series of problems:

[0004] 1. Interference with subsequent editing: Residual foreign plasmids (especially sgRNA plasmids) can interfere with the introduction of sgRNA plasmids in the next round of gene editing, thus affecting gene editing efficiency.

[0005] 2. Inefficiency: To eliminate foreign plasmids, researchers typically rely on unstable plasmid replicons or cumbersome antibiotic elimination methods. These methods require multiple passages, are time-consuming, inefficient, and unsuitable for high-throughput operations.

[0006] 3. Does not meet industrial application requirements: In metabolic engineering and industrial fermentation, the final production strain should not contain any exogenous antibiotic resistance genes and tool plasmids to ensure biosafety and genetic stability.

[0007] Therefore, there is an urgent need in this field to develop a method and system that can rapidly, efficiently, and controllably remove CRISPR-Cas9 tool plasmids, especially one that can achieve stepwise removal of sgRNA plasmids and Cas9 plasmids. Summary of the Invention

[0008] To address the technical challenge of rapidly and selectively removing exogenous plasmids (especially sgRNA expression plasmids) during multi-round gene editing of *E. coli* using existing CRISPR-Cas9 technology, this invention provides a method and system for multi-round gene editing and removal of plasmids based on *E. coli* CRISPR-Cas9. The method and system provided by this invention can perform time-controlled, stepwise removal of sgRNA and Cas9 plasmids, overcoming problems such as decreased editing efficiency and cumbersome procedures caused by plasmid residue. Ultimately, it efficiently obtains pure engineered strains free of exogenous plasmids, enabling efficient and rapid multi-round gene editing of engineered bacteria. Specifically, this is achieved through the following techniques.

[0009] In a first aspect, the present invention provides a method for multi-round gene editing and plasmid removal based on Escherichia coli CRISPR-Cas9, comprising the following steps:

[0010] Construct sgRNA expression plasmids for each round of gene editing, as well as Cas9 expression plasmids; the sgRNA expression plasmids contain sgRNA expression cassettes driven by constitutive promoters, and constitutively expressed SacB anti-selection marker genes; the Cas9 expression plasmids contain SacB gene expression cassettes controlled by thermosensitive promoters.

[0011] The first round of sgRNA expression plasmid and Cas9 expression plasmid were co-transformed into E. coli host for the first round of gene editing; after completion, sucrose was added to the system and cultured at a temperature lower than that of the thermosensitive promoter to remove the first round of sgRNA expression plasmid.

[0012] The second round of sgRNA expression plasmid was transformed into E. coli hosts that had undergone the previous round of gene editing for the second round of gene editing. After completion, sucrose was added to the system and the system was cultured at a temperature lower than that of the thermosensitive promoter to eliminate the second round of sgRNA expression plasmid. Several rounds of gene editing were performed using this method.

[0013] After the final round of gene editing, sucrose was added to the system and cultured at a temperature no lower than that of the thermosensitive promoter to remove all sgRNA expression plasmids and Cas9 expression plasmids, thus obtaining E. coli host cells that have undergone several rounds of gene editing.

[0014] After each round of gene editing, a final concentration of sucrose is added to the system to ensure that the SacB reverse selection marker gene is toxic to the E. coli host.

[0015] The specific working principle of the method provided by this invention is as follows:

[0016] (1) To address the problem of the difficulty in clearing sgRNA expression plasmids after each round of gene editing, a constitutive promoter-driven sgRNA expression cassette and a constitutively expressed SacB anti-selection marker gene are linked in the sgRNA expression plasmid, and a temperature-sensitive PL promoter-controlled SacB gene expression cassette is linked in the Cas9 expression plasmid.

[0017] (2) After one round of gene editing, the large-scale expression of the SacB gene on the sgRNA expression plasmid makes the E. coli host cells after one round of gene editing sensitive to sucrose. When sucrose is added and the E. coli host cells are cultured within a specific temperature range, the constitutively expressed SacB gene product on the sgRNA expression plasmid has a toxic effect on the E. coli host, efficiently and specifically eliminating strains containing the sgRNA expression plasmid;

[0018] The selection plate here is Kan-resistant, and the Cas9 expression plasmid is Kan-resistant. After eliminating strains containing the sgRNA expression plasmid, Kan-resistant plates are used for selection, leaving only the Cas9 plasmid in the cells. Strains without the Cas9 plasmid die under Kan-resistant selection. Therefore, within a specific temperature range, because the temperature-sensitive promoter on the Cas9 expression plasmid is not activated, the SacB gene it controls is also not activated, thus preserving strains containing only the Cas9 expression plasmid, providing a "clean" cellular background for the next round of gene editing.

[0019] (3) After all the multi-round gene editing tasks are completed, the final strain is transferred to a culture medium containing a specific concentration of sucrose and cultured at another specific temperature range.

[0020] Within this specific temperature range, the thermosensitive promoter on the Cas9 expression plasmid is activated, and the SacB gene controlled by it is expressed in large quantities. At this time, not only can strains containing sgRNA expression plasmids be efficiently and specifically eliminated, but strains containing Cas9 expression plasmids can also be eliminated.

[0021] The method provided by this invention effectively removes the sgRNA expression plasmid and retains the Cas9 expression plasmid after each round of CRISPR-Cas9 gene editing; and after the last round of CRISPR-Cas9 gene editing, the sgRNA expression plasmid and the Cas9 expression plasmid are simultaneously and completely removed, resulting in a final strain that does not contain any exogenous tool plasmids.

[0022] Furthermore, the nucleotide sequence of the constitutive promoter is shown in SEQ ID NO.1.

[0023] In this invention, the temperature-sensitive characteristic of thermosensitive promoters is utilized. A specific thermosensitive promoter is selected, and culture conditions are adjusted according to its sensitive temperature to inhibit or activate the promoter, thereby controlling the inhibition or activation of the SacB gene expression cassette in the Cas9 expression plasmid. Further, the thermosensitive promoter is a thermosensitive PL promoter, with the nucleotide sequence shown in SEQ ID NO.2; the sensitive temperature of the thermosensitive promoter is 42℃.

[0024] Furthermore, when the thermosensitive promoter is a thermosensitive PL promoter, sucrose is added to the system after each of the other rounds of gene editing, except after the last round of gene editing, and the system is cultured at 30°C.

[0025] When cultured at 30℃, the thermosensitive promoter is suppressed, and the expression of the SacB gene in the Cas9 expression plasmid is also suppressed accordingly.

[0026] Furthermore, when the thermosensitive promoter is a thermosensitive PL promoter, sucrose is added to the system and the mixture is incubated at 42°C. When incubation at 42°C is selected, the thermosensitive promoter is activated, and the SacB gene in the Cas9 expression plasmid is expressed in large quantities and rapidly.

[0027] Furthermore, after each round of gene editing, a final concentration of sucrose of 5 wt% was added to the system.

[0028] When the gene-edited *E. coli* were cultured in a medium containing a final concentration of 5 wt% sucrose, the sgRNA expression plasmid was selectively eliminated due to the toxic effects of the SacB gene.

[0029] Furthermore, the host of the Escherichia coli is Escherichia coli strain K-12, MG1655, BL21 or DH5α.

[0030] In a second aspect, the present invention also provides a system for multi-round gene editing and plasmid removal based on Escherichia coli CRISPR-Cas9, comprising an sgRNA expression plasmid and a Cas9 expression plasmid; wherein the sgRNA expression plasmid contains an sgRNA expression cassette driven by a constitutive promoter and a SacB anti-selection marker gene containing constitutive expression.

[0031] The Cas9 expression plasmid contains a SacB gene expression cassette controlled by a thermosensitive promoter.

[0032] In a third aspect, the present invention also provides an application of the above-mentioned system for multi-round gene editing and plasmid removal based on Escherichia coli CRISPR-Cas9, specifically for constructing Escherichia coli gene editing libraries, or for performing metabolic engineering of Escherichia coli, or for producing recombinant proteins using engineered Escherichia coli bacteria.

[0033] In a fourth aspect, the present invention also provides an Escherichia coli host cell, obtained by employing any of the above methods or systems, after multiple rounds of gene editing and plasmid removal.

[0034] Compared with the prior art, the advantages of the present invention are:

[0035] 1. This invention overcomes the limitations of a single clearance strategy. Through ingenious genetic design, it achieves a sequential operation method and system that "first clears the sgRNA expression plasmid from the previous round of editing, retaining the Cas9 expression plasmid; after all editing is completed, clear all sgRNA and Cas9 expression plasmids." This perfectly aligns with the experimental workflow of multi-round gene editing, ensuring that each round of editing is performed in an optimal cellular background, greatly improving the success rate and efficiency of continuous editing.

[0036] 2. Utilizing the powerful anti-selection function of the SacB gene, the plasmid removal process is very rapid, usually completed within one culture or one generation of growth, without relying on passive loss through multiple generations of passage, thus significantly shortening the experimental cycle.

[0037] 3. The entire elimination process can be achieved simply by adjusting the culture temperature and adding inexpensive sucrose; there is no need to change antibiotics, use inducers, or perform complex colony purification, which greatly simplifies the operation steps, reduces costs, and is particularly suitable for automated, high-throughput gene editing platforms.

[0038] 4. The dual safeguard mechanism of the entire method and system (synergistic effect of sucrose pressure and temperature induction) ensures that all exogenous DNA can be completely removed at the editing endpoint, resulting in engineered bacteria with a clear genetic background and no residual resistance markers. This is crucial for industrial biotechnology applications and compliance with biosafety regulations.

[0039] 5. The core components of the entire method and system are stable and can be widely applied to different engineered strains of Escherichia coli (such as K-12, BL21, DH5α, etc.), and can be used in conjunction with various CRISPR-Cas9 tool variants or homologous recombination systems, which has broad applicability and promotional value. Attached Figure Description

[0040] Figure 1 This is a schematic diagram of the multi-round gene editing and plasmid removal method based on Escherichia coli CRISPR-Cas9 provided by the present invention.

[0041] Figure 2 This is a plate diagram of pSG-SacB plasmid elimination in Example 2.

[0042] Figure 3This is a PCR verification gel electrophoresis image from Example 2 to confirm whether the pSG-SacB plasmid was successfully eliminated.

[0043] Figure 4 This is a plate diagram showing the simultaneous elimination of the pSG-SacB plasmid and the Cas9-PL-SacB plasmid after the entire gene editing process, as described in Example 3.

[0044] Figure 5 This is a PCR verification gel electrophoresis image from Example 3 to confirm whether the pSG-SacB plasmid was successfully eliminated.

[0045] Figure 6 This is a gel electrophoresis image used in Example 3 to verify whether the Cas9-PL-SacB plasmid was successfully eliminated via PCR. Detailed Implementation

[0046] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0047] Example 1: Construction of a multi-round gene editing and plasmid removal system for E. coli CRISPR-Cas9

[0048] In this embodiment, Escherichia coli DH5α competent cells were used as the engineered bacteria for constructing expression plasmids.

[0049] 1. Construction of sgRNA expression plasmid pSG-SacB

[0050] The starting vector was pTargetF, a commonly used sgRNA expression backbone plasmid in this field (provided by Aoke (Wuhan) Biotechnology Co., Ltd., or other similar plasmids). The pTargetF plasmid typically contains an sgRNA scaffold sequence and a specific antibiotic resistance gene (spectruminant resistance gene, Spec^R).

[0051] (1) Obtaining the SacB gene fragment: The complete coding sequence of the SacB gene was obtained from the pYM25A plasmid (see the literature "Efficient longfragment editing technique enables large-scale and scarless bacterial genome engineering") by PCR amplification, and appropriate restriction sites (such as Xba I and Hind III) were introduced at the 5' end of the primer.

[0052] (2) Preparation of vector backbone: pTargetF plasmid was linearized by digestion with the same restriction endonucleases (Xba I and Hind III), and the large fragment was purified by gel recovery.

[0053] (3) Ligation and transformation: The purified SacB gene fragment was ligated to the linearized pTargetF vector backbone using T4 DNA ligase. The ligation product was transformed into Escherichia coli DH5α competent cells, plated on LB plates containing spectinomycin (50 μg / mL), and incubated overnight at 37°C.

[0054] (4) Screening and verification of positive clones: single colonies are picked and plasmids are sequenced.

[0055] Positive clones were sent to a sequencing company for sequencing to ensure that the SacB gene was correctly inserted and without mutations. The plasmid that verified the correct insertion was named pSG-SacB. In this plasmid, the SacB gene is continuously expressed, driven by a constitutive promoter on the vector. The nucleotide sequence of the constitutive promoter is as follows:

[0056] cacatatacctgccgttcactattatttagtgaaatgagatattatgatattttctgaattgtgattaaaaaggcaactttatgcccatgcaacagaaactataaaaaatac agagaatgaaaagaaacagatagattttttagttctttaggcccgtagtctgcaaatccttttatgattttctatcaaacaaaagaggaaaatagaccagttgcaatccaaac gagagtctaatagaatgaggtcgaaaagtaaatcgcgcgggtttgttatactgataaagcaggcaagacctaaaatgtgtaaagggcaaagtgtatactttggcgtcacccctta catattttaggtctttttttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagcagaccgctaacacagtacataaaaaaggagacatgaacg, as in SEQ Shown as ID NO.1.

[0057] 2. Construction of Cas9 expression plasmid pCas9-PL-SacB

[0058] This invention uses the pYM25A plasmid as the basic platform for Cas9 expression and reverse selection. This plasmid already contains the Cas9 gene and a constitutively expressed SacB gene. In this embodiment, the SacB expression regulatory element of the plasmid is replaced.

[0059] (1) Obtaining the PL promoter: The Psim6 plasmid containing the temperature-sensitive PL promoter (provided by Aoke (Wuhan) Biotechnology Co., Ltd., which is a well-known and commonly used tool plasmid in the field and is publicly available) was used as a template. The 5' and 3' ends of the PCR primer pair were introduced with sequences (about 20-40 bp) that are homologous to the upstream and downstream of the original SacB gene promoter on the pYM25A plasmid, respectively, for homologous recombination.

[0060] The nucleotide sequence of the temperature-sensitive PL promoter is as follows:

[0061] caacctccttagtacatgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgtatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttacaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctaagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctgaaaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtgatactgagcacatcagcaggacgcactgaccacc, as shown in SEQ ID NO.2.

[0062] The specific sequences of the PCR primer pair are:

[0063] PCR forward primer sequence: 5'- aactgtcagaccaagtttacgagctcaacctccttagtacatgcaaccat-3', as shown in SEQ ID NO.3.

[0064] PCR reverse primer sequence: 5'-gttttgcaaactttttgatgttcatggtggtcagtgcgtcctgctgatgt-3', as shown in SEQ ID NO.4.

[0065] (2) Preparation of vector backbone: pYM25A plasmid was linearized by reverse PCR amplification.

[0066] (3) Ligation and transformation: The PL promoter fragment and the linearized pYM25A plasmid were mixed at a molar ratio of 3:1 and ligated using T5 exonuclease. The ligation product was transformed into Escherichia coli DH5α competent cells, plated on LB plates containing kanamycin (50 μg / mL), and incubated overnight at 37°C.

[0067] (4) Screening and verification of positive clones: single colonies are picked and plasmids are sequenced.

[0068] Positive clones were sent to a sequencing company for sequencing to ensure that the PL-SacB element was correctly inserted and without mutations. The plasmid that was verified to be correct was named Cas9-PL-SacB. In this plasmid, the SacB gene is regulated by the PL promoter.

[0069] Example 2: Single-round gene editing and temporal clearance of sgRNA plasmids, and ultimate clearance of all plasmids.

[0070] This embodiment takes the knockout of the lacZ gene in Escherichia coli MG1655 as an example. The gene editing and plasmid removal methods are shown in the figure.

[0071] 1. Experimental Procedure

[0072] (1) Transformation of Cas9-PL-SacB plasmid: The Cas9-PL-SacB plasmid was transformed into the host cell (Escherichia coli MG1655) to be gene edited. The successfully transformed strain was named MG1655 / Cas9-PL-SacB.

[0073] (2) Transformation of pSG-SacB and Donor DNA (lacZ): pSG-SacB and Donor DNA (lacZ) were simultaneously electroporated into the MG1655 / Cas9-PL-SacB strain to knock out the lacZ gene. The selected strains were sent for sequencing, and the strains with successful lacZ gene knockout were named G1655-∆lacZ. Donor DNA (lacZ) is the repair template, which is the DNA that needs to be replaced in the genome. It has 500 bp homologous arms upstream and downstream.

[0074] (3) The strain with successful lacZ gene knockout (the strain with the correct band verified by PCR) was inoculated into LB medium, then spread on Kans resistant plates containing 5% sucrose and incubated at 30°C. After single colonies grew, colony PCR was performed to verify whether the pSG-SacB plasmid in the colonies had been successfully eliminated. The strain with successful elimination was named G1655-∆lacZ / Cas9-PL-SacB.

[0075] 2. Experimental Results

[0076] The experimental results after single-round gene editing and temporal clearance of sgRNA plasmids are shown in Figures 2 and 3. Figure 2 Plate diagram of pSG-SacB plasmid elimination. Figure 3 This is a gel electrophoresis image used to verify whether the pSG-SacB plasmid was successfully eliminated by PCR. In the image, M represents a 5000bp marker band, lane 1 shows the bands containing both the pSG-SacB and Cas9-PL-SacB plasmids in the strain after the lacZ gene was knocked out, and lanes 2-8 show the PCR bands of colonies cultured with 5% sucrose. Figure 3 In the strain, if it also contains an sgRNA expression plasmid, a band will be present; if it does not contain an sgRNA expression plasmid, no band will be present. Figure 2 and Figure 3 It can be seen that the pSG-SacB plasmid has been eliminated in all selected strains.

[0077] The experimental results of ultimate removal of all plasmids are as follows: Figure 4-6 As shown. Figure 4 This is a plate diagram showing the simultaneous elimination of the pSG-SacB plasmid and the Cas9-PL-SacB plasmid after the entire gene editing process was completed. Figure 5 Gel electrophoresis image used to verify whether pSG-SacB plasmid was successfully eliminated via PCR. Figure 6This is a gel electrophoresis image used to verify the successful elimination of the Cas9-PL-SacB plasmid using PCR. M represents a 5000bp marker band; lane 1 shows bands containing both pSG-SacB and Cas9-PL-SacB plasmids in the strain after lacZ gene knockout; lanes 2-8 show PCR bands of colonies cultured at 42°C with 5% sucrose. Figure 4-6 It can be seen that both pSG-SacB plasmid and Cas9-PL-SacB plasmid have been eliminated.

[0078] Example 3

[0079] This embodiment takes the knockout of the ldhA gene of Escherichia coli MG1655-∆lacZ (the strain in Example 2 where the lacZ gene has been knocked out) as an example. The gene editing and plasmid removal methods are shown in the figure.

[0080] 1. Experimental Procedure

[0081] (1) Transformation of pSG-SacB and Donor DNA: pSG-SacB and Donor DNA (ldhA) were simultaneously electroporated into the MG1655-∆lacZ / Cas9-PL-SacB strain to knock out the ldhA gene. The strains were selected and sent for sequencing. The strains with successful ldhA gene knockout were named G1655-∆lacZ-ldhA.

[0082] (2) The strain G1655-∆lacZ-ldhA with the ldhA gene successfully knocked out was inoculated into LB medium and then spread on LB plates with 5% sucrose and incubated at 42°C. After single colonies grew, colony PCR was performed to verify whether the pSG-SacB plasmid and Cas9-PL-SacB plasmid in the colony had been successfully eliminated.

[0083] By using two simple sequential steps, namely "30℃ + sucrose solution of a specific concentration" and "42℃ + sucrose solution of a specific concentration", we achieved rapid elimination of sgRNA plasmids after gene editing while retaining Cas9 plasmids, enabling rapid entry into the next round of gene editing. Furthermore, after the entire gene editing process is completed, we achieved efficient conversion from gene-edited bacteria to plasmid-free pure engineered bacteria.

[0084] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A method for multi-round gene editing and plasmid removal based on Escherichia coli CRISPR-Cas9, characterized in that, Includes the following steps: Construct sgRNA expression plasmids for each round of gene editing, as well as Cas9 expression plasmids; the sgRNA expression plasmids contain sgRNA expression cassettes driven by constitutive promoters, and constitutively expressed SacB anti-selection marker genes; the Cas9 expression plasmids contain SacB gene expression cassettes controlled by thermosensitive promoters. The first round of sgRNA expression plasmid and Cas9 expression plasmid were co-transformed into E. coli host for the first round of gene editing; after completion, sucrose was added to the system and cultured at a temperature lower than that of the thermosensitive promoter to remove the first round of sgRNA expression plasmid. The second round of sgRNA expression plasmid was transformed into E. coli hosts that had undergone the previous round of gene editing for the second round of gene editing. After the second round of gene editing was completed, sucrose was added to the system and the system was cultured at a temperature lower than that of the thermosensitive promoter to remove the second round of sgRNA expression plasmid. Several rounds of gene editing were performed using this method. After the final round of gene editing, sucrose was added to the system and cultured at a temperature no lower than that of the thermosensitive promoter to remove all sgRNA expression plasmids and Cas9 expression plasmids, thus obtaining E. coli host cells that have undergone several rounds of gene editing. After each round of gene editing, a final concentration of sucrose is added to the system to ensure that the SacB reverse selection marker gene is toxic to the E. coli host.

2. The method for multi-round gene editing and plasmid removal based on E. coli CRISPR-Cas9 according to claim 1, characterized in that, The nucleotide sequence of the constitutive promoter is shown in SEQ ID NO.

1.

3. The method for multi-round gene editing and plasmid removal based on E. coli CRISPR-Cas9 according to claim 1, characterized in that, The thermosensitive promoter is a thermosensitive PL promoter, and its nucleotide sequence is shown in SEQ ID NO.2; the sensitive temperature of the thermosensitive promoter is 42℃.

4. The method for multi-round gene editing and plasmid removal based on E. coli CRISPR-Cas9 according to claim 3, characterized in that, Except for the final round of gene editing, sucrose was added to the system after each of the other rounds of gene editing, and the system was incubated at 30°C.

5. The method for multi-round gene editing and plasmid removal based on E. coli CRISPR-Cas9 according to claim 3, characterized in that, After the final round of gene editing, sucrose was added to the system and it was cultured at 42°C.

6. The method for multi-round gene editing and plasmid removal based on E. coli CRISPR-Cas9 according to claim 1, characterized in that, After each round of gene editing, a final concentration of sucrose was added to the system of 5 wt%.

7. The method for multi-round gene editing and plasmid removal based on E. coli CRISPR-Cas9 according to claim 1, characterized in that, The host of Escherichia coli is Escherichia coli strain K-12, MG1655, BL21 or DH5α.

8. A system for multi-round gene editing and plasmid removal based on Escherichia coli CRISPR-Cas9, characterized in that, It includes an sgRNA expression plasmid and a Cas9 expression plasmid; the sgRNA expression plasmid contains an sgRNA expression cassette driven by a constitutive promoter, and a SacB anti-selection marker gene containing constitutive expression. The Cas9 expression plasmid contains a SacB gene expression cassette controlled by a thermosensitive promoter.

9. The application of the system for multi-round gene editing and plasmid removal based on E. coli CRISPR-Cas9 as described in claim 8, characterized in that, It can be used to construct E. coli gene editing libraries, or to perform metabolic engineering of E. coli, or to produce recombinant proteins using engineered E. coli bacteria.

10. An Escherichia coli host cell, characterized in that, The method described in any one of claims 1-7, or the system described in claim 8, is used to obtain the gene after multiple rounds of gene editing and plasmid removal.

Images