Preparation method and application of red camellia source recombinant PDRN with cell-level anti-wrinkle repair effect

Abstract

The application discloses a preparation method and application of a Hongshan tea source recombinant PDRN with cell-level anti-wrinkle repair efficacy, two characteristic fragments CJ-PDRN-1 and CJ-PDRN-2 are screened from a Hongshan tea flower genome, the two characteristic fragments are constructed into recombinant plasmids, and are transformed into Escherichia coli for culture, and are then transferred into Saccharomyces cerevisiae to construct a recombinant engineering bacterium, seed expansion culture and fermentation culture are carried out, the fermentation culture solution is subjected to high-pressure homogenization wall breaking treatment, enzymolysis, and then is separated and purified to obtain the Hongshan tea source recombinant PDRN. The Hongshan tea source recombinant PDRN prepared by the application completely gets rid of dependence on animal source raw materials, does not exist animal protein sensitization and virus pollution risks, can significantly promote collagen synthesis, strengthen skin barrier, promote keratinocyte migration, and accelerate skin damage repair. Compared with conventional PDRN in the prior art, the repair promotion and collagen promotion effect are significantly improved, and the Hongshan tea source recombinant PDRN can be used for preparing anti-wrinkle repair skin care products or cosmetics.

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and cosmetics technology. Specifically, it relates to a method for preparing recombinant PDRN derived from red camellia with cellular-level anti-wrinkle and repair effects and its application. More specifically, it relates to a method for preparing polydeoxyribonucleotides (PDRN) by heterologously expressing camellia genome characteristic sequences using Saccharomyces cerevisiae, and the application of the PDRN obtained thereby in cosmetics. Background Technology

[0002] PDRN (polydeoxyribonucleotide) is a nucleic acid fragment formed by the polymerization of deoxynucleotides. It can promote angiogenesis and collagen synthesis by activating adenosine A2A receptors and nucleic acid rescue pathways, inhibit inflammatory responses, and provide DNA repair raw materials for damaged cells. It is widely used in medical aesthetic repair and anti-aging skin care products.

[0003] Currently, PDRN is mainly extracted and purified from sperm cells of salmon or trout. Although animal-derived PDRN has acceptable activity, it faces many limitations. For example, the long growth cycle and high feeding costs of salmon and other animal-derived raw materials lead to high production costs. Furthermore, animal-derived raw materials are subject to ethical controversies and batch-to-batch variations. In addition, there are risks of viral contamination and allergens during animal extraction. In recent years, the development of plant-derived PDRN has attracted attention. These are mostly extracted from algae and plant tissues, requiring large quantities of plant materials, involving complex purification processes, extremely low extraction yields, and producing PDRN fragments of varying lengths and unstable activity. Microbial-derived PDRN represents a significant breakthrough in biotechnology in recent years. Produced through microbial fermentation or gene recombination technology, it aims to replace traditional animal-derived PDRN. It addresses the long-standing bottlenecks of sustainability, raw material quality fluctuations, and ethical risks associated with traditional animal-derived PDRN, achieving more precise and potent efficacy. Patent application CN121406634A discloses a technology for preparing microbial PDRN by fermentation using Lactobacillus plantarum. This method uses probiotic endogenous nucleic acid as raw material. Compared with traditional salmon-derived PDRN, it does not rely on aquatic raw materials, the fermentation raw materials are cheap and readily available, the production cost is lower, and there is no risk of allergy to animal protein. However, it directly extracts the nucleic acid of Lactobacillus plantarum's own genome without genetic modification. The product is only a fragment of the bacteria's natural nucleic acid, which does not have a unique active nucleic acid sequence. In addition, the intracellular nucleic acid yield is limited, and the fermentation capacity is low.

[0004] To address the limitations of existing technologies, such as limited raw materials, difficulties in mass production, single efficacy, and insufficient purity, this invention constructs a specific red camellia-derived recombinant PDRN-producing yeast strain, optimizes high-density fermentation and fine purification processes, and verifies its skincare activity, thereby achieving efficient, stable, and large-scale preparation and high-end skincare applications of red camellia-derived PDRN. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide a method for preparing recombinant PDRN derived from red camellia and its application, which possesses cellular-level anti-wrinkle and repairing effects. It seeks to solve the technical problems of existing animal-derived PDRN raw materials being scarce, costly, and batch-instantaneous, as well as plant-derived PDRN facing challenges in large-scale mass production, immature processes, and unclear efficacy. The invention provides a method for constructing an engineered Saccharomyces cerevisiae strain of red camellia-derived PDRN, a high-density fermentation preparation process, a separation and purification method, and its application in skin anti-wrinkle and barrier repair, thereby obtaining a high-purity, high-activity, and highly safe red camellia-derived recombinant PDRN product and achieving stable industrial production.

[0006] The objective of this invention is achieved through the following technical solution: In a first aspect, the present invention provides a method for preparing recombinant PDRN derived from red camellia with cellular-level anti-wrinkle and repair effects, comprising the following steps: S1. Target gene screening and recombinant plasmid construction: Two characteristic fragments, CJ-PDRN-1 and CJ-PDRN-2, with G / C island-rich structures and adjacent to DNA repair-related gene clusters were screened from the whole genome of Camellia oleifera. They were ligated to the multiple cloning site of pUC57 plasmid to synthesize recombinant plasmids, transformed into E. coli for culture, and after plasmid extraction, PCR amplification was performed. After verification by agarose gel electrophoresis, linear DNA fragments were obtained by gel recovery and purification. S2. Construction of recombinant Saccharomyces cerevisiae engineered strain: The linear DNA fragment obtained in step S1 was transformed into Saccharomyces cerevisiae W303-1A competent cells, plated on defective YNB plates for culture, and the recombinant engineered strain was obtained by colony PCR and sequencing verification. S3. High-density fermentation to prepare bacterial cells: After the recombinant engineered bacteria obtained in step S2 are expanded in seed culture medium, they are inoculated into fermentation basal culture medium for fermentation culture. When glucose is depleted and dissolved oxygen recovers, feed culture medium is started to feed the bacteria. After fermentation is completed, the wet bacterial cells are collected by centrifugation. S4. Recombinant PDRN isolation and purification: Take the wet bacterial cells collected in step S3, add pre-cooled TE buffer, and perform high-pressure homogenization to disrupt the cell wall. Concentrate the disrupted solution by ultrafiltration and collect the filtrate. Add RNase A and proteinase K to the filtrate in sequence for enzymatic hydrolysis. Treat the hydrolysate with potassium acetate solution and precipitate with anhydrous ethanol, then reconstitute. Treat the reconstituted solution with CTAB solution and centrifuge. Dissolve the precipitate with NaCl and precipitate again with anhydrous ethanol. Wash and dry to obtain the final product.

[0007] As some specific embodiments of the present invention, in step S1, the nucleotide sequences of CJ-PDRN-1 and CJ-PDRN-2 are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively; and the nucleotide sequences of the recombinant plasmid are shown as SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0008] As some specific embodiments of the present invention, in step S1, the Escherichia coli is Escherichia coli DH5α, which is transformed into Escherichia coli and then cultured in LB medium containing ampicillin at 32-37°C with shaking for 16-20 h.

[0009] As some specific embodiments of the present invention, in step S1, the primers used for PCR amplification of the recombinant plasmid containing CJ-PDRN-1 are C1-1-F and Genome-R, whose nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively; And / or, for recombinant plasmids containing CJ-PDRN-2, the primers used for PCR amplification are C2-1-F and Genome-R, whose nucleotide sequences are shown in SEQ ID NO.7 and SEQ ID NO.6, respectively.

[0010] As some specific embodiments of the present invention, in step S1, the concentration of the obtained linear DNA fragment is adjusted to 200~500 ng / μL.

[0011] As some specific embodiments of the present invention, in step S2, the genotype of the brewer's yeast W303-1A is MATa leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15; And / or, during transformation, add carrier DNA and the linear DNA fragment obtained in step S1, and transform with PEG / LiAc transformation solution; And / or, the defective YNB plate is an SD / -Leu / -Ura / -His / -Trp defective YNB plate; the incubation temperature after coating is 27~30℃, and the time is 48~72h.

[0012] As some specific embodiments of the present invention, in step S3, the seed culture medium formula is: glucose 5~15g / L, yeast powder 2~5g / L, peptone 3~8g / L, malt extract 2~5g / L; And / or, the fermentation basal culture medium is composed of: glucose 15~25 g / L, yeast powder 8~12 g / L, peptone 3~8 g / L, ammonium sulfate 3~8 g / L, potassium dihydrogen phosphate 2~5 g / L, magnesium sulfate heptahydrate 0.3~0.8 g / L, calcium chloride 0.05~0.2 g / L, and defoamer 0.5~2 g / L; And / or, the supplemental culture medium is composed of: glucose 400~600 g / L, ammonium sulfate 100~200 g / L, potassium dihydrogen phosphate 15~25 g / L, and magnesium sulfate heptahydrate 8~15 g / L.

[0013] As some specific embodiments of the present invention, in step S3, the expansion culture includes primary expansion culture and secondary expansion culture, with the primary expansion culture reaching OD. 600 Reaching 5-8, secondary expansion to OD 600 The expansion culture conditions are 27-30 ℃ and 180-220 rpm shaking culture. And / or, when inoculating with the basic fermentation medium for fermentation culture, the inoculum size is 5%~15%; the initial fermentation temperature is 27~30℃, the pH is maintained at 4.8~5.5 (adjusted with 2 mol / L NaOH), the dissolved oxygen is ≥25%, the rotation speed is 200~1200 r / min, the aeration rate is 0.8~2.5 vvm, and the tank pressure is 0.03~0.08 MPa; when the glucose is depleted and the dissolved oxygen recovers to >70%, the feeding program is started, the flow rate of the feeding medium is 1.0~2.0 mL / min, the feeding is continued for 15~24 h, and the total fermentation time is 35~48 h; And / or, the centrifugation conditions are 4~8℃, 8000~10000 r / min, 10~20 min.

[0014] As some specific embodiments of the present invention, in step S4, the pre-cooled TE buffer contains 50 mM Tris-HCl, 0.1 M EDTA, and has a pH of 8.0; the pressure of the high-pressure homogenization and cell disruption treatment is 800~1200 bar, and the cycle is 5 times at 4℃; the cell disruption liquid is concentrated 8~10 times by tangential flow through a hollow fiber ultrafiltration membrane with a molecular weight cutoff of 50~150 kDa and the filtrate is collected.

[0015] As some specific embodiments of the present invention, in step S4, the enzymatic hydrolysis includes first adding RNase A to the filtrate to 50-100 μg / mL, incubating at 35-45°C for 60-120 min; then adding proteinase K to 50-150 μg / mL, and supplementing with CaCl2 to 5-10 mM, EDTA to 0.01-0.03 M, and SDS to 35-55 mM, and incubating at 60-65°C for 1-2 h for enzymatic hydrolysis.

[0016] As some specific embodiments of the present invention, in step S4, after the enzymatic hydrolysate is cooled, an equal volume of 2-3 M potassium acetate solution is added, the mixture is placed in an ice bath for 30-60 min, the supernatant is collected by centrifugation, 2 times the volume of anhydrous ethanol is added to precipitate the precipitate, the supernatant is discarded by centrifugation, the precipitate is washed twice with 70% ethanol and then reconstituted with pure water.

[0017] As some specific embodiments of the present invention, in step S4, an equal volume of 3%~5% (w / v) CTAB solution is added to the complex solution, the CTAB solution is dissolved in NaCl, the mixture is stirred at room temperature for 30~60 min, allowed to stand at 4~6℃ for 30~60 min, the supernatant is discarded by centrifugation, and the precipitate is dissolved in 1.3~1.7 M NaCl; after dissolving, 2 volumes of pre-cooled anhydrous ethanol are added to precipitate PDRN, the mixture is allowed to stand at 4~6℃ for 1~2 h, the precipitate is collected by centrifugation, washed 1~3 times with 70% ethanol, and dried under vacuum.

[0018] As some specific embodiments of the present invention, step S4 further includes: dissolving the purified recombinant PDRN in sterile pure water, pre-freezing, and vacuum lyophilizing to obtain PDRN lyophilized powder.

[0019] Furthermore, the pre-freezing temperature is -45~-55℃, and the time is 4~6 h; the vacuum freeze drying includes drying at a vacuum of 20 Pa, first at -15~-20℃ for 22~26 h, and then at 25~28℃ for 8~16 h, to obtain white flocculent PDRN freeze-dried powder; the purity identification results of the PDRN freeze-dried powder are: OD260 / OD280 is 1.8-2.0, OD260 / OD230 ≥ 2.0.

[0020] Secondly, the present invention provides a recombinant PDRN derived from red camellia with cell-level anti-wrinkle and repair effects, which is prepared by the preparation method described in any of the above claims.

[0021] Thirdly, the present invention provides the application of the red camellia-derived PDRN or red camellia-derived recombinant PDRN as described above in the preparation of skin care products or cosmetics with anti-wrinkle and firming, skin barrier repair, and photodamage repair effects.

[0022] As some specific embodiments of the present invention, the dosage form of the skin care product or cosmetic is selected from serum, toner, lotion, cream or mask; in the skin care product or cosmetic, the mass fraction of camellia PDRN or camellia recombinant PDRN is 0.05-0.2%.

[0023] Fourthly, the present invention provides an anti-wrinkle and firming essence containing recombinant PDRN derived from red camellia, comprising, by weight percentage: 0.05-0.2% recombinant PDRN derived from red camellia, 3.0-5.0% butylene glycol, 2.0-4.0% glycerin, 0.05-0.15% sodium hyaluronate, 0.1-0.3% xanthan gum, 0.3-0.5% p-hydroxyacetophenone, 0.4-0.6% 1,2-hexanediol, and the balance being deionized water.

[0024] As some specific embodiments of the present invention, the preparation method of the anti-wrinkle and firming essence includes: mixing deionized water, butylene glycol, glycerin, sodium hyaluronate and xanthan gum, heating to 80-85℃ and stirring until well mixed; cooling to 45-50℃, adding red camellia-derived recombinant PDRN, p-hydroxyacetophenone and 1,2-hexanediol, stirring until uniform, and discharging to obtain the finished product.

[0025] In a UVA-induced photoaging model of human skin fibroblasts, the recombinant PDRN derived from Camellia sinensis prepared in this invention can significantly upregulate the expression of Collagen I and Collagen III genes. At a concentration of 0.20%, the upregulation rate of Collagen I reached 91%–95%, and the upregulation rate of Collagen III reached 135%–139%, which is better than or equivalent to the TGF-β1 positive control.

[0026] In a keratinocyte model, this PDRN significantly upregulated the expression of the barrier-associated protein FLG gene, with an upregulation rate of 202%–207% at a concentration of 0.20%, which was superior to the EGCG positive control. In the cell scratch assay, the cell migration rate at a concentration of 0.20% reached 25.39%–26.39%, comparable to the HEGF positive control, and significantly superior to all other control ratios.

[0027] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention uses the characteristic genome fragment of Camellia zeaxanthin from Zhejiang as the target sequence to construct a genetically engineered Saccharomyces cerevisiae strain. It utilizes Saccharomyces cerevisiae to heterologously synthesize recombinant PDRN derived from Camellia zeaxanthin, completely eliminating dependence on animal-derived raw materials and avoiding the risks of animal protein sensitization and viral contamination, thus avoiding animal ethics issues. Compared with directly extracting endogenous nucleic acids from plants and microorganisms, the product possesses the characteristic active nucleic acid sequence of Camellia zeaxanthin, resulting in stronger efficacy.

[0028] 2. This invention is equipped with a 50L tank high-density fermentation process, a DO-stat feeding strategy, and controllable fermentation parameters, enabling large-scale industrial production; the complete separation and purification process can obtain recombinant PDRN lyophilized powder with a purity of ≥90%, extremely low endotoxin levels, and good batch stability.

[0029] 3. In vitro cell experiments confirmed that the recombinant PDRN derived from red camellia can dose-dependently upregulate the expression of Collagen I and Collagen III genes in fibroblasts, promote collagen synthesis, and exert anti-wrinkle and firming effects; it also upregulates the expression of FLG filaggrin in keratinocytes, strengthening the skin barrier; cell scratch assays confirmed that it can promote keratinocyte migration and accelerate skin damage repair; under the same concentration conditions, its repair and collagen-promoting effects are significantly better than those of salmon-derived PDRN, common yeast endogenous nucleic acid, and Lactobacillus plantarum-derived nucleic acid.

[0030] 4. The recombinant PDRN of this invention has good compatibility and can be applied to various skin care formulas. It can be used to develop anti-wrinkle and repair skin care products, and has broad prospects for industrial application. Attached Figure Description

[0031] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 The plasmid map of the recombinant plasmid PUC-CJ-RDRN; Figure 2 Electrophoresis images of recombinant Saccharomyces cerevisiae colony-derived strains for colony identification using PCR and ITS. Detailed Implementation

[0032] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0033] Unless otherwise specified, the experimental procedures described in the following examples are standard practices in the art. Unless otherwise specified, all materials and reagents used in the examples are commercially available.

[0034] Example 1: Obtaining the target gene sequence of PDRN from Camellia sinensis and constructing recombinant plasmids 1.1 Target gene screening and synthesis The whole genome sequence of Camellia japonica L. was obtained from the NCBI database. Through bioinformatics analysis, two characteristic genomic fragments with typical G / C island-rich structures and adjacent to DNA repair-related gene clusters were screened and named CJ-PDRN-1 and CJ-PDRN-2, respectively. Their nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively (131 bp and 500 bp in length).

[0035] SEQ ID NO.1 (5'→3'): ggagaaggagaagtatgcaaatgaccatgattctggaaatattcaagggtatggaagtaagttggctaataatgctagtggtcaacttgagtgggaagactatttcttccaccttgtcttccctgaagaca SEQ ID NO.2 (5'→3'): gggcaaatggatcactgccaaatgcgtccccaactccattatcatgcacattggtgacacggtagaaattctcagtaaccgcaagtacaagagcattctccatcgtggactcgttaataaggaaa aaatgaggatttcgtgggcggttttctgcgaaccacccaaggagaagatcattctgcagccactcccggagacagtgacggaggaggagccgccgctcttcccgccgaggacttttgctcaacat attcagcataagttgttcaggaagactcaggtgcttggaggaaaatgaatgaatgaatgaagaggagtgtgtgggggtggtggtggtttgattaataataataattaatcatcccttttttttttttt tttaactgtgacgatgatgatgttatcatttttatggtatttcttaattaaaggtttgattattatgttgttatatgttaggctataatctgtatttgtctcttgaggtattgtgtcttgatct The two sequences were ligated to the multiple cloning site of the pUC57 plasmid, and Beijing Kangwei Century Biotechnology Co., Ltd. was commissioned to perform whole-genome synthesis and sequencing verification to obtain the recombinant plasmid PUC-CJ-RDRN (plasmid map shown below). Figure 1 As shown in the figure, it includes pUC57-CJ-PDRN-1 (C1-1) and pUC57-CJ-PDRN-2 (C2-1), the sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0036] 1.2 Escherichia coli amplification and linearized fragment preparation The recombinant plasmid was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing ampicillin (100 μg / mL) and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium (containing 100 μg / mL ampicillin) and cultured at 37°C with shaking at 220 rpm for 16 h. The recombinant plasmid was extracted using the Novizan plasmid extraction kit DC201-1.

[0037] Using the extracted plasmid as a template, PCR amplification was performed with primers C1-1-F / Genome-R (SEQ ID NO.5 and SEQ ID NO.6) and C2-1-F / Genome-R (SEQ ID NO.7 and SEQ ID NO.6).

[0038] Amplification system (50 μL): 25 μL of 2×Phanta Max Buffer, 2 μL each of 10 mM dNTP Mix, 2 μL each of forward and reverse primers (10 μM), 1 μL of template DNA, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and ddH2O to a final volume of 50 μL.

[0039] Amplification program: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 1 min / kb, 35 cycles; 72℃ for 5 min.

[0040] After the PCR products were verified by 1% agarose gel electrophoresis, they were purified by gel recovery to obtain linear DNA fragments, and the concentration was adjusted to 200-500 ng / μL for later use.

[0041] Table 1 Primer sequence listing

[0042] Example 2: Construction and Identification of Recombinant Saccharomyces cerevisiae Engineered Strains 2.1 Preparation and Transformation of Competent Cells The host strain was *Saccharomyces cerevisiae* W303-1A (Beijing Cooler Master Technology Co., Ltd., genotype: MATa leu2-3,112trp1-1 can1-100 ura3-1 ade2-1 his3-11,15). *Saccharomyces cerevisiae* W303-1A was inoculated into YPD liquid medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose) and cultured at 28℃ with shaking at 220 rpm until OD500 reached. 600 ≈0.8, centrifuge to collect bacterial cells, wash sequentially with sterile water and LiAc / TE buffer, and finally resuspend in LiAc / TE buffer-15% glycerol, aliquot and freeze at -80℃ for later use.

[0043] Thaw 100 μL of W303-1A competent cells on ice, add 5 μL of carrier DNA (salmon sperm DNA, Beijing Coolplay Technology Co., Ltd., catalog number CC316, boiled at 95°C for 5 min before use, then immediately placed on ice, repeated once), and 0.5-1 μg of the linear target DNA fragment prepared in Example 1 (boiled at 95°C for 5 min, then immediately placed on ice, repeated once), mix well, then add 500 μL of pre-cooled PEG / LiAc transformation buffer (40% PEG3350, 0.1 M LiAc, 1×TE, pH 7.5), and mix by pipetting; incubate at 30°C for 30 min (invert and mix at 15 min); then heat shock at 42°C for 15 min (invert and mix at 7.5 min), immediately place on ice for 2 min; 4°C, 10,000 Centrifuge at 30 rpm for 30 s and discard the supernatant. Resuspend the cells in 400 μL of sterile water, centrifuge again and discard the supernatant, and finally resuspend in 100 μL of sterile water. Spread evenly on SD / -Leu / -Ura / -His / -Trp-deficient YNB solid plates (0.67% YNB purchased from BD Difco™ 291940, 2% glucose, corresponding amino acid deficiency, 2% agar). Incubate upside down at 29℃ for 48-72 h. Pick single colonies to perform PCR and sequencing verification. Positive clones are recombinant Saccharomyces cerevisiae engineered strains C1-1 / W303-1A and C2-1 / W303-1A.

[0044] 2.2 PCR and sequencing verification of positive clones Single colonies were picked from the screening plates and inoculated into 3 mL of YPD liquid medium, and cultured at 29℃ and 220 r / min for 24 h with shaking. 1 mL of the bacterial culture was collected by centrifugation, and genomic DNA was extracted using a yeast genomic DNA rapid extraction kit for use as a PCR template.

[0045] Colony PCR verification was performed using extracted genomic DNA as a template. The verification involved two aspects: firstly, amplification was performed using primers C1-1-F / Genome-R (SEQ ID NO.5 and SEQ ID NO.6) and C2-1-F / Genome-R (SEQ ID NO.7 and SEQ ID NO.6) to verify homologous recombination frames; secondly, amplification was performed using universal fungal ITS primers ITS1 and ITS4 to confirm that the positive clone was *Saccharomyces cerevisiae* and free from contamination.

[0046] The amplification system uses standard Taq Mix, as shown in Table 2 below: Table 2 Amplification System

[0047] The amplification reaction conditions were: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 30 cycles; and 72℃ final extension for 10 min.

[0048] After the reaction, 5 μL of the PCR product was taken for 1% agarose gel electrophoresis. The results are shown in the figure below. Figure 2 Lanes 3 and 8 contain DNA Marker (DL2000); lanes 1 and 6 contain amplified products of the C1-1 / W303-1A homologous recombination frame; lanes 2 and 7 contain amplified products of the C2-1 / W303-1A homologous recombination frame; lanes 4 and 9 contain amplified products of the ITS identification sequence of C1-1 / W303-1A; and lanes 5 and 10 contain amplified products of the ITS identification sequence of C2-1 / W303-1A.

[0049] As can be seen, lanes 1 and 6 showed specific bands at approximately 1600 bp (C1-1 integration identification), and lanes 2 and 7 showed specific bands at approximately 2000 bp (C2-1 integration identification), all consistent with the theoretically designed molecular weight. Lanes 4 and 9, and lanes 5 and 10 amplified approximately 800 bp bands using universal ITS1 / ITS4 primers (sequences shown in SEQ ID NO.8 and SEQ ID NO.9, respectively), which were confirmed as Saccharomyces cerevisiae by NCBI comparison. Each lane showed a single specific band with no non-specific amplification, proving that the target fragment was successfully integrated and there was no contamination from other microorganisms.

[0050] The ITS1 primer sequence is: TCCGTAGGTGAACCTGCGG (SEQ ID NO.8); The ITS4 primer sequence is: TCCTCCGCTTATTGATATGC (SEQ ID NO.9).

[0051] Positive PCR products (lanes 1, 6; 2, 7) were sequenced by Anhui General Biotechnology Co., Ltd. The sequencing results showed a similarity of ≥99.9% with SEQ ID NO:1 (C1-1) and SEQ ID NO:2 (C2-1), confirming that the target fragment had been stably integrated into the yeast genome. A single colony that had been verified was selected, and 800 μL of the bacterial culture was mixed with 800 μL of 50% glycerol, aliquoted, and stored at -80℃. These colonies were named C1-1 / W303-1A and C2-1 / W303-1A, respectively.

[0052] Example 3 High-density fermentation of recombinant brewing yeast (50L fermenter) 3.1 Preparation of culture medium (1) Seed culture medium: glucose 10g / L, yeast powder 3g / L, peptone 5g / L, malt extract (Angel Yeast Co., Ltd.) 3g / L; (2) Fermentation basal culture medium: glucose 20g / L, yeast powder 10g / L, peptone 5g / L, ammonium sulfate 5g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate heptahydrate 0.5g / L, calcium chloride 0.1g / L, BAPE nitrogen-containing polyether defoamer (Hangzhou Kenming Fine Chemical Co., Ltd.) 1g / L; (3) Feeding medium: glucose 500 g / L, ammonium sulfate 150 g / L, potassium dihydrogen phosphate 20 g / L, magnesium sulfate heptahydrate 10 g / L.

[0053] 3.2 Seed liquid preparation (1) Take 1 mL of glycerol tubes of recombinant Saccharomyces cerevisiae C1-1 / W303-1A and C2-1 / W303-1A stored at -80℃ in an ultra-low temperature freezer, inoculate them into 50 mL of liquid seed culture medium, and culture them in a shaker at 28℃ and 220 r / min for 24 h. The cell density (OD600) reaches 6, and the first-grade seed is obtained. (2) Transfer 5% inoculum to 500mL liquid seed culture medium and culture under the same conditions for 18h. The cell density (OD600) reaches more than 10 and is used as secondary fermentation seed liquid.

[0054] 3.3 Fermentation (1) Initial fermentation: 10% inoculum was added to the fermentation medium. The initial fermentation temperature was 28℃. 2 mol / L NaOH solution was added via an online pH-linked peristaltic pump. The pH was maintained at 5.0±0.2 throughout the process. Dissolved oxygen (DO) was controlled by a forward stirring speed-aeration linkage. The initial stirring speed was 200 r / min, with a maximum of 1200 r / min. The initial aeration rate was 1.0 vvm, with a maximum of 2 vvm. The tank pressure was 0.05 MPa throughout the process. The dissolved oxygen saturation was maintained stably at ≥30% throughout the process. Samples were taken every 4 hours to test for glucose residue and OD. 600 1. Measure the dry weight of the bacterial cells; until glucose is completely depleted and dissolved oxygen rapidly rises to over 70%, then initiate the feeding program.

[0055] (2) High-density fed-batch proliferation: The DO-stat feedback feeding strategy was adopted. When the dissolved oxygen level rose to >70%, the peristaltic pump added high-concentration feeding medium at a constant rate of 1.5 mL / min. When the dissolved oxygen level was <30%, feeding was stopped and the stirring speed was increased simultaneously to increase dissolved oxygen and avoid excessive glucose production of ethanol that inhibits cell growth. The feeding culture was continued for 18 h, and the total fermentation time was 40 h.

[0056] (3) Cell collection: The fermentation broth was centrifuged at 4℃ and 8000 r / min for 15 min, the supernatant was discarded, and the cells were washed twice with sterile PBS buffer (pH 7.4) for later use. The fermentation process parameters of strains C1-1 / W303-1A and C1-2 / W303-1A were the same.

[0057] Example 4: Isolation and purification of recombinant PDRN 4.1. Cell disruption Wet bacterial cells of C1-1 / W303-1A and C1-2 / W303-1A prepared in Example 3 were taken and added to each with an equal volume of pre-cooled TE buffer (50 mM Tris-HCl, 0.1 M EDTA, pH 8.0). After mixing, the mixture was filtered through a 0.45 μm microporous membrane to remove large particles of residue. The cells were then homogenized using a high-pressure homogenizer: pressure 1000 bar, temperature controlled at 4 ℃, homogenization cycle 5 times, and the cell disruption rate was ≥95% as observed under a microscope.

[0058] 4.2 Ultrafiltration Concentration The cell wall-breaking liquid was concentrated by tangential flow filtration using a hollow fiber ultrafiltration membrane with a molecular weight cutoff of 100 kDa, with a concentration factor of approximately 8 times. The filtrate (PDRN crude extract) was collected, with a concentration factor of approximately 10 times the original volume.

[0059] 4.3 Enzymatic Decontamination Add RNase A to the crude extract to a final concentration of 80 μg / mL and incubate at 37 °C for 60 min to degrade RNA. Then add proteinase K to a final concentration of 100 μg / mL, and supplement with CaCl2 to 5 mM, EDTA to 0.01 M, and SDS to 35 mM. Incubate at 60 °C for 2 h, cool to room temperature, add an equal volume of 3M potassium acetate solution, incubate on ice for 30 min, centrifuge at 8000 r / min for 10 min, take the supernatant, add 2 volumes of anhydrous ethanol for precipitation, centrifuge at 8000 r / min for 10 min and discard the supernatant. Wash the lower precipitate twice with 70% ethanol and reconstitute with pure water.

[0060] 4.4 Selective precipitation of CTAB Add an equal volume of 4% (w / v) CTAB solution (dissolved in 0.14M NaCl) to the compound solution, stir slowly at room temperature for 30 min, let stand at 4℃ for 30 min, centrifuge at 10,000 r / min for 20 min (4℃), discard the supernatant, and fully dissociate the precipitate with 1.5M NaCl solution.

[0061] 4.5 Ethanol precipitation and washing Slowly add 2 volumes of pre-cooled anhydrous ethanol to the dissociated PDRN solution, mix gently, and let stand at 4°C for 2 hours to allow PDRN to precipitate completely. Centrifuge at 12,000 r / min for 20 min at 4°C and collect the precipitate. Wash the precipitate three times with 70% ethanol, and remove the residual ethanol under vacuum to obtain purified PDRN.

[0062] 4.6 Freeze-drying The purified PDRN was dissolved in sterile pure water, spread in a tray (liquid layer thickness 8 mm), and pre-frozen at -45℃ for 4 h. Transfer to a freeze dryer, vacuum degree 20Pa, temperature program: -20℃ main drying for 22 h → 25℃ analytical drying for 8 h.

[0063] After the freeze-drying process was completed, the vacuum was replaced with high-purity nitrogen and the mixture was sealed to obtain white flocculent PDRN freeze-dried powder, which was named C1-1 / PDRN and C2-1 / PDRN.

[0064] Purity identification: Take appropriate amounts of freeze-dried C1-1 / PDRN and C2-1 / PDRN lyophilized powders, dissolve them separately in sterile water, dilute to the working curve range, and use ultraviolet spectrophotometry to determine the purity based on the absorbance at wavelengths of 260nm, 230nm, and 280nm. 260 / OD 280 and OD 260 / OD 230 The ratio was used to determine PDRN purity; the measurement was repeated three times and the average value was taken. The results showed that the OD of the C1-1 / PDRN lyophilized powder... 260 / OD 280 =1.85, OD 260 / OD 230 =2.11; C2-1 / PDRN lyophilized powder OD260 / OD280=1.88, OD260 / OD230=2.20 (OD260 / OD280: 1.8-2.0, OD260 / OD230: >2.0 are qualified), the purity indicators of the two are similar.

[0065] Comparative Example 1: PDRN Extraction from Non-Recombinant Saccharomyces cerevisiae Saccharomyces cerevisiae W303-1A (without integrated target gene) was purchased from Beijing Cooler Technology Co., Ltd. and fermented, PDRN extracted and dried according to the same process as in Examples 3 and 4.

[0066] Comparative Example 2: Endogenous Nucleic Acid Extraction Method of Lactobacillus plantarum Referring to the method in the embodiment of patent application CN121406634A, total intracellular nucleic acid was directly extracted after fermentation with Lactobacillus plantarum to obtain PDRN derived from Lactobacillus plantarum.

[0067] Comparative Example 3: Direct Extraction Method of PDRN from Camellia Plant Source Referring to the method in Example 1 of the published patent CN121378361A, fresh camellia flowers were used as raw materials. The process involved blanching, pulverizing, ultrasonic extraction, enzymatic decontamination, ethanol precipitation, and gel chromatography purification to obtain PN derived from camellia plants.

[0068] Comparative Example 4: Direct Extraction Process of PDRN from Salmon (Conventional Method) Referring to existing conventional processes for extracting PDRN from salmon (Salmo salar) testes / sperm (such as the salmon testis extraction routes disclosed in CN115074357B "An Extraction Method for Polydeoxyribonucleic Acids", CN112315836A (Runhui Biotechnology) "A Highly Efficient Preparation Method for External PDRN and Its Application", and the industry-standard salmon semen PDRN preparation process), the specific preparation steps are as follows: (1) Take frozen salmon testes, remove blood vessels and fascia, and homogenize them in pre-cooled 10 mM Tris-HCl, 5 mM EDTA, 100 mM NaCl buffer (pH 7.8); (2) Add complex protease (trypsin 150 μg / ml, proteinase K 100 μg / ml) and enzymatically hydrolyze at 37℃ for 20 h to degrade protamine and membrane proteins; (3) Add SDS to a final concentration of 1% (w / v) and NaCl to 1.5 M, centrifuge at 4°C to discard the protein precipitate, and further remove the protein by salting out the supernatant with saturated NaCl. (4) Add 2 times the volume of pre-cooled anhydrous ethanol to the supernatant to precipitate long-chain DNA, wash with 70% ethanol, and freeze dry to obtain DNA sample.

[0069] Test Example 1: Quality Comparison of Recombinant PDRN from Camellia sinensis and the Control Group The quality of the recombinant PDRN freeze-dried powders C1-1 / PDRN and C2-1 / PDRN obtained from the above examples, as well as the PDRN obtained from each comparative example, was compared. The results are shown in Table 3 below. Endotoxins were detected using the "Bacterial Endotoxin Test Method" in General Chapter 1143 of the Chinese Pharmacopoeia; animal-derived residues were detected according to SN / T 3589.3-2013 "Identification Methods for Common Fish and Their Products in Exported Foods Part 3: Real-time Fluorescent PCR Method for Detection of Salmon Components".

[0070] Table 3 Comparison of PDRN quality from different sources

[0071] The above results show that the PDRN (C1-1 / PDRN, C2-1 / PDRN) derived from Camellia sinensis obtained by the recombinant expression and purification process established in this invention exhibits excellent performance in all key quality attributes. The purity of the product is consistently above 90%, and the residual protein, small organic molecules and polysaccharides are controlled at extremely low levels. There are no endotoxins or any animal-derived components remaining, which is significantly better than the comparative example.

[0072] Test Example 2: Anti-wrinkle and firming efficacy testing (Collagen I, Collagen III) When skin is exposed to ultraviolet (UVA / UVB) radiation, the effects occur on the epidermis and dermis, respectively. UVB primarily affects epidermal keratinocytes, causing cell damage, inflammation, and decreased barrier function. UVA can penetrate the dermis, acting on skin fibroblasts and inducing oxidative stress damage, leading to decreased collagen synthesis and increased collagen degradation. This results in signs of aging such as sagging and wrinkles. Type I collagen is the most abundant collagen in human skin and a major component of the dermal extracellular matrix. It provides structural and mechanical support to surrounding tissues, maintaining skin firmness and elasticity. Type III collagen is another major component of the skin, primarily found in the superficial dermis. It provides elasticity and firmness, and due to its crucial role in the skin, it is widely used to improve skin elasticity, reduce wrinkles, and repair the skin barrier.

[0073] This experiment established a damage model by irradiating human skin fibroblasts with UVA. The gene expression levels of Collagen I and Collagen III in fibroblasts were detected by real-time quantitative PCR (RT-qPCR) to evaluate the effects of recombinant PDRN obtained in the examples and PDRN samples of each comparative ratio on skin firming and anti-wrinkle efficacy.

[0074] Experimental method: Cryopreserved HSF cells (human skin fibroblasts) were thawed and seeded into cell culture flasks, 2 × 10⁶ cells per flask. 5 HSF cells were cultured in DMEM medium (10% FBS) at 37°C with 5% CO2. HSF cells in logarithmic growth phase were washed twice with PBS, then trypsinized for 2 min. After terminating digestion with DMEM medium (10% FBS), the cells were centrifuged, the supernatant was discarded, and DMEM medium (10% FBS) was added to prepare a cell suspension. 2 mL of the cell suspension was added to each well of a small dish with coverslips and incubated overnight in a cell culture incubator.

[0075] A blank control group, a negative control group, a positive control group, and a sample group were set up: the blank control group contained only cell suspension (culture medium) and did not undergo UVA irradiation treatment; the negative control group underwent UVA irradiation treatment of the cell suspension; the positive control group and the sample group were first irradiated with UVA light, then the culture medium was discarded, and DMEM medium (containing 10% FBS) containing 50 ng / mL TGF-β1 and different concentrations of samples (derived from the PDRN in the examples and comparative examples) was added respectively, and the cells were cultured for 24 h at 37°C in a 5% CO2 cell culture incubator. The culture medium was discarded, and the cells were washed twice with PBS.

[0076] RNA was extracted from cells in each group, and after purity testing, cDNA was synthesized via reverse transcription. RT-qPCR (real-time quantitative PCR) was then performed to detect the expression levels of Collagen I and Collagen III genes in each group of cells. Specifically, this included: (1) Extraction of total RNA: Total RNA was extracted from cells in each group (Universal RNA extraction kit, Adamas-life, G8037-0050-PKG). After extraction, the RNA concentration and purity were determined by an ultra-micro spectrophotometer (A260 / A280 between 1.8 and 2.0 was considered acceptable), and the integrity of RNA was verified by 1% agarose gel electrophoresis.

[0077] (2) cDNA synthesis: Take 1 μg of total RNA and use the HiScript III RT SuperMix for qPCR reverse transcription kit (Vazyme, R323-01) to reverse transcribe and synthesize cDNA. The reaction system contains 4 μL of 4×gDNA wiper Mix, 1 μg of total RNA, and nuclease-free water to a final volume of 16 μL. Incubate at 42°C for 2 min to remove genomic DNA. Then add 4 μL of 5×HiScriptIII RT SuperMix, mix thoroughly, and incubate at 37°C for 15 min, followed by incubation at 85°C for 5 s to inactivate reverse transcriptase. Store the obtained cDNA at -20°C for later use.

[0078] (3) Real-time quantitative PCR (RT-qPCR): Using cDNA as a template, amplification was performed on a QuantStudio 5 real-time quantitative PCR instrument using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02). The total reaction volume was 20 μL, containing 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.4 μL each of 10 μM forward and reverse primers, 2 μL of cDNA template, and 7.2 μL of nuclease-free water. The amplification program was 40 cycles of 95℃ pre-denaturation for 30 s, followed by 95℃ denaturation for 10 s and 60℃ annealing and extension for 30 s. After the cycles, melting curve analysis was performed at 95℃ to 60℃ and then back to 95℃ to confirm the amplification specificity. The primer sequences used are as follows: Collagen I (COL1A1) gene: Upstream primer (SEQ ID NO.10): 5'-ATGTTCAGCTTTGTGGACCTC-3', Downstream primer (SEQ ID NO.11): 5'-CTGTACGCAGGTGATTGGTG-3'; Collagen III (COL3A1) gene: Upstream primer (SEQ ID NO.12): 5'-CACTGGGGAATGGAGCAAAAC-3', Downstream primer (SEQ ID NO.13): 5'-ATCAGGACCACCAATGTCATAGG-3'; Internal reference gene GAPDH: Upstream primer (SEQ ID NO.14): 5'-AGGTCGGTGTGAACGGATTTG-3', Downstream primer (SEQ ID NO.15): 5'-TGTAGACCATGTAGTTGAGGTCA-3'; Each sample was prepared in 3 replicates and a template-free negative control was also provided.

[0079] Gene expression levels to be tested: CT (treatment group) = CT (test gene) - CT (mean value of internal reference gene) CT (negative control group) = CT (test gene) - CT (mean value of internal reference gene) CT= CT (treatment group) - CT scan (negative control group) Relative expression level of the gene to be tested = 2 - CT Take 2 - CT The mean.

[0080] The results are shown in Tables 4 and 5 below: Table 4. Relative Collagen I expression levels in each group (Mean ± SD)

[0081] Note: "ns" indicates no significant difference, P≥0.05; This indicates that the difference was statistically significant compared with the negative control group (0.01≤P<0.05); This indicates a highly significant difference compared to the negative control group (P<0.01).

[0082] Conclusion: As shown in Table 4 above, in the UVA-induced photoaging cell model, at the same concentration, the expression level and upregulation rate of Collagen I gene by red camellia-derived PDRN (C1-1 / PDRN and C2-1 / PDRN) were significantly higher than those of the three comparative examples (1, 2, 3, 4), indicating that the red camellia-derived recombinant PDRN of the present invention has a significantly better effect on promoting collagen synthesis under the same conditions.

[0083] Table 5. Relative expression levels of Collagen III in each group (Mean ± SD)

[0084] Note: "ns" indicates no significant difference, P≥0.05; This indicates that the difference was statistically significant compared with the negative control group (0.01≤P<0.05); This indicates a highly significant difference compared to the negative control group (P<0.01).

[0085] Conclusion: As shown in Table 5 above, in the UVA-induced photoaging cell model, camellia-derived PDRN (C1-1 / PDRN and C2-1 / PDRN) exhibited a significant concentration-dependent enhancement effect in promoting Collagen III gene expression. At high concentrations, their effects were comparable to those of the TGF-β1 positive control and significantly superior to each control group. Among them, C2-1 / PDRN showed the best performance at a concentration of 0.20% (upregulation rate of 139%), suggesting that recombinant camellia-derived PDRN has significant potential to promote skin collagen synthesis and repair photoaging damage.

[0086] Test Example 3: Repair Efficacy Test (FLG) Natural moisturizing factor (NMF) is a water-soluble, absorbent substance found in the stratum corneum of the skin that helps retain moisture. NMF is primarily present in keratinocytes and plays a crucial role in preventing moisture loss from the stratum corneum. A lack of NMF can cause the stratum corneum to lose its ability to absorb moisture, leading to dryness and even cracking of the skin. The amino acid components of NMF mainly originate from the degradation of filaggrin (FLG) in the stratum corneum and are key sources for maintaining the skin's moisturizing and repairing functions.

[0087] This experiment established a damage model using UVB irradiation of human keratinocytes. The relative expression level of FLG mRNA was detected using quantitative real-time PCR (RT-qPCR) as the endpoint to evaluate the regulatory effect of the test substance on FLG. This can serve as one piece of evidence for its repair efficacy.

[0088] Test method: Cryopreserved keratinocytes were thawed and seeded into cell culture flasks (2 × 10⁶ cells per flask). 5 Keratinocytes in logarithmic growth phase were cultured in DMEM medium (10% FBS) at 37°C and 5% CO2. After washing twice with PBS, keratinocytes were trypsinized for 2 min, and the digestion was stopped by adding DMEM medium (10% FBS). The cells were then centrifuged, the supernatant was discarded, and DMEM medium (10% FBS) was added to prepare a cell suspension. 2 mL of the cell suspension was added to each well of a small dish with a coverslip and incubated overnight in a cell culture incubator.

[0089] A blank control group, a positive control group, and a sample group were set up: the blank control group was treated with UVB irradiation only; the positive control group and the sample group were first treated with UVB irradiation of the cell culture medium, then the culture medium was discarded, and DMEM medium (10% FBS) containing 25 μg / mL EGCG and different concentrations of samples (derived from the PDRN in the examples and comparative examples) was added respectively, and the cells were cultured for 24 h at 37°C and 5% CO2. The culture medium was discarded, and the cells were washed twice with PBS.

[0090] RNA was extracted from cells in each group, and after purity testing, cDNA was synthesized via reverse transcription. RT-qPCR (real-time quantitative PCR) was then performed to detect the expression level of the FLG gene in each group of cells. Specifically, this included: (1) Extraction of total RNA: Total RNA was extracted from cells in each group (Universal RNA extraction kit, Adamas-life, G8037-0050-PKG). After extraction, the RNA concentration and purity were determined by an ultra-micro spectrophotometer (A260 / A280 between 1.8 and 2.0 was considered acceptable), and the integrity of RNA was verified by 1% agarose gel electrophoresis.

[0091] (2) cDNA synthesis: Take 1 μg of total RNA and use the HiScript III RT SuperMix for qPCR reverse transcription kit (Vazyme, R323-01) to reverse transcribe and synthesize cDNA. The reaction system contains 4 μL of 4×gDNA wiper Mix, 1 μg of total RNA, and nuclease-free water to a final volume of 16 μL. Incubate at 42°C for 2 min to remove genomic DNA. Then add 4 μL of 5×HiScriptIII RT SuperMix, mix thoroughly, and incubate at 37°C for 15 min, followed by incubation at 85°C for 5 s to inactivate reverse transcriptase. Store the obtained cDNA at -20°C for later use.

[0092] (3) Real-time quantitative PCR (RT-qPCR): Using cDNA as a template, amplification was performed on a QuantStudio 5 real-time quantitative PCR instrument using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02). The total reaction volume was 20 μL, containing 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.4 μL each of 10 μM forward and reverse primers, 2 μL of cDNA template, and 7.2 μL of nuclease-free water. The amplification program consisted of 40 cycles: 95℃ pre-denaturation for 30 s, followed by 95℃ denaturation for 10 s and 60℃ annealing and extension for 30 s. After the cycles, melting curve analysis was performed at 95℃ to 60℃ and then back to 95℃ to confirm amplification specificity. The primer sequences used are as follows: Filagrin (FLG) gene: Upstream primer (SEQ ID NO.16): 5'-TGAAGCCTATGACACCACTGA-3', Downstream primer (SEQ ID NO.17): 5'-TCCCCTACGCTTTCTTGTCCT-3'; Internal reference gene GAPDH: Upstream primer (SEQ ID NO.14): 5'-AGGTCGGTGTGAACGGATTTG-3', Downstream primer (SEQ ID NO.15): 5'-TGTAGACCATGTAGTTGAGGTCA-3'.

[0093] Each sample was prepared in 3 replicates and a template-free negative control was also provided.

[0094] Gene expression levels to be tested: CT (treatment group) = CT (test gene) - CT (mean value of internal reference gene) CT (blank control group) = CT (test gene) - CT (mean value of internal reference gene) CT= CT (treatment group) - CT scan (blank control group) Relative expression level of the gene to be tested = 2 - CT Take 2 - CT The mean.

[0095] The results are shown in Table 6 below: Table 6. Relative FLG expression levels (Mean ± SD) in each group

[0096] Note: "ns" indicates no significant difference, P≥0.05; This indicates that the difference was statistically significant compared with the blank control group (0.01≤P<0.05); This indicates a significant difference compared to the blank control group (P<0.01).

[0097] Conclusion: As shown in Table 6, the recombinant PDRN C1-1 / PDRN and C2-1 / PDRN derived from Camellia sinensis exhibited a significant concentration-dependent enhancement effect in promoting FLG expression, and their effects exceeded those of the EGCG positive control at concentrations of 0.10% and above. Among them, C1-1 / PDRN showed the best performance at a concentration of 0.20% (upregulation rate of 207%). The FLG expression-promoting effects of each control group were inferior to those of the Camellia sinensis PDRN sample, further validating the superior potential of Camellia sinensis PDRN in promoting skin barrier protein synthesis and repairing skin barrier function.

[0098] Test Example 4: Repair Efficacy Test (Cellular Scratch) Epidermal keratinocytes are essential cells that make up the epidermal layer. When the skin surface is damaged, keratinocytes are stimulated to migrate and repair the damaged area. When cells grow to a monolayer in vitro, an artificially created blank area is formed on the monolayer. Cells at the edge of the scratch gradually enter the blank area, causing the scratch to heal, which to some extent simulates the in vivo cell migration process. This test case evaluates the repair efficacy of the test substance by measuring the cell migration rate after treatment of the example and comparative sample.

[0099] Cryopreserved keratinocytes were thawed and seeded into cell culture flasks (2 × 10⁶ cells per flask). 5 (100 μL of cells) were added to DMEM complete medium and cultured in a cell culture incubator at 37°C and 5% CO2. After digestion, the cultured cells were seeded into 96-well cell culture plates, 100 μL per well, and cultured in an incubator at 37°C and 5% CO2.

[0100] Cell scratch assay was performed: Cells were scratched with a 10 μL pipette tip, washed twice with PBS, and then 2 mL of serum-free DMEM basal medium containing different concentrations of the sample was added to each well of the sample group. The positive control group was treated with 2 mL of serum-free DMEM medium containing 10 ng / mL HEGF. A blank control group was also provided using DMEM basal medium. After 24 h of culture, images were taken of the same field of view for each group.

[0101] The scratch spacing (d) at three locations at each time point was measured, and the cell migration rate was calculated.

[0102] Cell migration rate (%) = (d 0h -d 24h ) / d 0h 100%.

[0103] The results are shown in Table 7 below: Table 7. Effects of cell migration rate on each group

[0104] Note: Compared with the blank control group p<0.05, p<0.01, p<0.001.

[0105] The results in the table above show that after human epidermal keratinocytes were treated with recombinant PDRN C1-1 / PDRN and C2-1 / PDRN derived from camellia and the control groups (0.05%, 0.1%, and 0.2%), and cultured for 24 h, all groups showed a significant concentration-dependent enhancement effect. Among them, C2-1 / PDRN showed the best performance at a concentration of 0.20% (migration rate of 26.39%), indicating that camellia-derived PDRN has a good potential to promote skin cell migration and accelerate wound repair.

[0106] Application example: Anti-wrinkle and firming serum containing recombinant PDRN derived from red camellia. This application example provides an anti-wrinkle and firming serum containing recombinant PDRN derived from red camellia seed prepared in Example 3, the serum comprising the following components by weight percentage: Table 8. Formula of Anti-wrinkle and Firming Essence Containing Recombinant PDRN from Camellia Sinica

[0107] Preparation method: Mix deionized water, butylene glycol, glycerin, sodium hyaluronate and xanthan gum, heat to 80-85℃, stir evenly, cool to 45-50℃, add red camellia-derived recombinant PDRN, p-hydroxyacetophenone and 1,2-hexanediol, stir evenly to obtain the final product.

[0108] The serum prepared in this application example, by adding an effective amount of recombinant PDRN derived from red camellia, can significantly upregulate the expression of Collagen I and Collagen III genes in the skin, promote collagen synthesis, improve skin laxity and wrinkles, and achieve anti-wrinkle and firming effects.

[0109] This invention successfully prepared high-purity, high-activity lyophilized powder of recombinant PDRN from camellia seed by constructing an engineered Saccharomyces cerevisiae strain derived from camellia, combined with an optimized high-density fermentation process and efficient separation and purification procedures. In vitro cell experiments demonstrated that this recombinant PDRN exhibited significant dose-dependent efficacy in promoting collagen synthesis in human dermal fibroblasts, upregulating the expression of genes related to the keratinocyte barrier, and accelerating cell migration and repair. The preparation method described in this invention is stable, controllable, and suitable for large-scale production. The resulting product possesses multiple effects including anti-wrinkle firming, moisturizing, repairing, and damage repair, demonstrating promising industrialization prospects and application value in high-end skincare products.

[0110] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for preparing recombinant PDRN derived from Camellia sinensis with cellular-level anti-wrinkle and repairing effects, characterized in that, Includes the following steps: S1. Target gene screening and recombinant plasmid construction: Two characteristic fragments, CJ-PDRN-1 and CJ-PDRN-2, with G / C island-rich structures and adjacent to DNA repair-related gene clusters were screened from the whole genome of Camellia oleifera. They were ligated to the multiple cloning site of pUC57 plasmid to synthesize recombinant plasmids, transformed into E. coli for culture, and after plasmid extraction, PCR amplification was performed. After verification by agarose gel electrophoresis, linear DNA fragments were obtained by gel recovery and purification. S2. Construction of recombinant Saccharomyces cerevisiae engineered strain: The linear DNA fragment obtained in step S1 was transformed into Saccharomyces cerevisiae W303-1A competent cells, plated on defective YNB plates for culture, and the recombinant engineered strain was obtained by colony PCR and sequencing verification. S3. High-density fermentation to prepare bacterial cells: After the recombinant engineered bacteria obtained in step S2 are expanded in seed culture medium, they are inoculated into fermentation basal culture medium for fermentation culture. When glucose is depleted and dissolved oxygen recovers, feed culture medium is started to feed the bacteria. After fermentation is completed, the wet bacterial cells are collected by centrifugation. S4. Isolation and purification of recombinant PDRN: Take the wet bacterial cells collected in step S3, add pre-cooled TE buffer, and perform high-pressure homogenization to disrupt the cell wall. Concentrate the disrupted solution by ultrafiltration and collect the filtrate. Add RNase A and proteinase K to the filtrate in sequence for enzymatic digestion. Treat the enzymatic digest with potassium acetate solution and precipitate with anhydrous ethanol, then reconstitute. Treat the reconstituted solution with CTAB solution and centrifuge. Dissolve the precipitate with NaCl and precipitate again with anhydrous ethanol. After washing and drying, the purified recombinant PDRN is obtained.

2. The preparation method according to claim 1, characterized in that, In step S1, the nucleotide sequences of CJ-PDRN-1 and CJ-PDRN-2 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; the nucleotide sequences of the recombinant plasmid are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

3. The preparation method according to claim 2, characterized in that, In step S1, for the recombinant plasmid containing CJ-PDRN-1, the primers used for PCR amplification are C1-1-F and Genome-R, whose nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. And / or, for recombinant plasmids containing CJ-PDRN-2, the primers used for PCR amplification are C2-1-F and Genome-R, whose nucleotide sequences are shown in SEQ ID NO.7 and SEQ ID NO.6, respectively.

4. The preparation method according to claim 1, characterized in that, In step S2, the genotype of the brewer's yeast W303-1A is MATa leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15; And / or, during transformation, add carrier DNA and the linear DNA fragment obtained in step S1, and transform with PEG / LiAc transformation solution; And / or, the defective YNB plate is an SD / -Leu / -Ura / -His / -Trp defective YNB plate; the incubation temperature after coating is 27~30℃, and the time is 48~72h.

5. The preparation method according to claim 1, characterized in that, In step S3, the seed culture medium formula is: glucose 5-15g / L, yeast powder 2-5g / L, peptone 3-8g / L, and malt extract 2-5g / L; And / or, the fermentation basal culture medium is composed of: glucose 15-25 g / L, yeast extract 8-12 g / L, peptone 3-8 g / L, ammonium sulfate 3-8 g / L, potassium dihydrogen phosphate 2-5 g / L, magnesium sulfate heptahydrate 0.3-0.8 g / L, calcium chloride 0.05-0.2 g / L, and defoamer 0.5-2 g / L; And / or, the supplemental culture medium is composed of: glucose 400-600 g / L, ammonium sulfate 100-200 g / L, potassium dihydrogen phosphate 15-25 g / L, and magnesium sulfate heptahydrate 8-15 g / L.

6. The preparation method according to claim 1 or 5, characterized in that, In step S3, the expansion culture includes primary expansion culture and secondary expansion culture, with the primary expansion culture reaching OD. 600 Reaching 5-8, secondary expansion to OD 600 The expansion culture conditions are 27-30℃ with shaking culture at 180-220 rpm; And / or, when inoculating with the basic fermentation medium for fermentation culture, the inoculum size is 5%-15%; the initial fermentation temperature is 27-30℃, the pH is maintained at 4.8-5.2, the dissolved oxygen is ≥25%, the rotation speed is 200-1200 r / min, the aeration rate is 0.8-2.5 vvm, and the tank pressure is 0.03-0.08MPa; when the glucose is depleted and the dissolved oxygen recovers to >70%, the feeding program is started, the flow rate of the feeding medium is 1.0-2.0 mL / min, the feeding is continued for 15-24 h, and the total fermentation time is 35-48 h; And / or, the centrifugation conditions are 4~8℃, 8000~10000 r / min, 10~20 min.

7. The preparation method according to claim 1, characterized in that, In step S4, the pre-cooled TE buffer contains 50 mM Tris-HCl and 0.1 M EDTA, with a pH of 8.0; the high-pressure homogenization and cell disruption treatment is carried out at a pressure of 800~1200 bar, cyclically 5 times at 4℃; the cell disruption solution is concentrated 8~10 times by tangential flow through a hollow fiber ultrafiltration membrane with a molecular weight cutoff of 50~150 kDa, and the filtrate is collected. And / or, the enzymatic hydrolysis includes first adding RNase A to the filtrate to 50-100 μg / mL, incubating at 35-45°C for 60-120 min; then adding proteinase K to 50-150 μg / mL, and supplementing with CaCl2 to 5-10 mM, EDTA to 0.01-0.03 M, and SDS to 35-55 mM, and incubating at 60-65°C for 1-2 h for enzymatic hydrolysis; And / or, after cooling the enzymatic hydrolysate, add an equal volume of 2-3 M potassium acetate solution, incubate on ice for 30-60 min, centrifuge and collect the supernatant, add 2 times the volume of anhydrous ethanol to precipitate, centrifuge and discard the supernatant, wash the precipitate twice with 70% ethanol and then reconstitute it with pure water; And / or, add an equal volume of 3%~5% CTAB solution to the complex solution, wherein the CTAB solution is dissolved in NaCl, stir at room temperature for 30~60 min, let stand at 4~6℃ for 30~60 min, centrifuge and discard the supernatant, dissolve the precipitate with 1.3~1.7 M NaCl; add 2 volumes of pre-cooled anhydrous ethanol to the dissolved precipitate to precipitate PDRN, let stand at 4~6℃ for 1~2 h, centrifuge to collect the precipitate, wash 1~3 times with 70% ethanol, and vacuum dry; And / or, step S4 further includes: dissolving the purified recombinant PDRN in sterile pure water, pre-freezing, and vacuum lyophilizing to obtain PDRN lyophilized powder; The pre-freezing temperature is -45~-55℃ and the time is 4~6 h; the vacuum freeze drying includes primary drying at -15~-20℃ for 22~26 h under a vacuum of 20 Pa, followed by desorption drying at 25~28℃ for 8~16 h, to obtain white flocculent PDRN freeze-dried powder.

8. A recombinant PDRN derived from red camellia with cellular-level anti-wrinkle and repairing effects, characterized in that, It is prepared by the preparation method described in any one of claims 1-7.

9. The application of the recombinant PDRN derived from camellia as described in claim 8 in the preparation of skin care products or cosmetics with anti-wrinkle, firming, skin barrier repair, and photodamage repair effects.

10. A wrinkle-reducing and firming serum containing recombinant PDRN derived from red camellia, characterized in that, By weight percentage, it contains: 0.05-0.2% recombinant PDRN from Camellia sinensis, 3.0-5.0% butylene glycol, 2.0-4.0% glycerin, 0.05-0.15% sodium hyaluronate, 0.1-0.3% xanthan gum, 0.3-0.5% p-hydroxyacetophenone, 0.4-0.6% 1,2-hexanediol, and the balance being deionized water; The preparation method of the anti-wrinkle and firming essence includes: mixing deionized water, butylene glycol, glycerin, sodium hyaluronate and xanthan gum, heating to 80-85℃ and stirring until well mixed; cooling to 45-50℃, adding red camellia-derived recombinant PDRN, p-hydroxyacetophenone and 1,2-hexanediol, stirring until uniform, and discharging to obtain the finished product.

Images