Application of new mutation site of rice brittle stem gene BC1 in molecular breeding

Abstract

The application provides application of a new mutation site of a rice brittle stem gene BC1 in molecular breeding, and specifically, the application first finds that editing (deletion mutation) of a 1480th base of a coding region (SEQ ID NO. 1) of the BC1 gene or a 160th base of an exon (SEQ ID NO. 2) of the coding region of the BC1 gene in rice cells can significantly improve plant agronomic traits, including one or more selected from the following group: (a) brittle strength is enhanced, and yield-related traits are not affected; (b) the content of hemicellulose components is increased; (c) the content of cellulose in stems is increased, and the content of lignin in stems is decreased; (d) the content of cellulose in leaves is decreased, and the content of lignin in leaves is increased.

Description

Technical Field

[0001] This invention relates to the field of botany, and more specifically to the application of a novel mutation site in the rice brittle stem gene BC1 in molecular breeding. Background Technology

[0002] Cell walls, as an important characteristic structure of plants, are closely related to plant growth and development and their response to external environmental stresses. The mechanical strength of rice stems is the physical basis for rice's lodging resistance and is also an important factor affecting rice yield and quality.

[0003] Plant cell walls are mainly composed of cellulose, hemicellulose, and lignin, and changes in the content and proportion of these components affect the normal morphology of the cell wall. Fragile stem mutations are a common type of mutation, reported in plants such as Arabidopsis thaliana, maize, tomato, and rice. In rice, many brittle stem genes have been identified, located, and cloned, covering multiple pathways of cell wall biosynthesis, including those involved in cellulose catalytic synthesis (e.g., OsCesA4, 7, 9), matrix polysaccharide formation / glycoprotein modification (BC10, BC14), vesicle transport, and cell wall skeleton formation (BC12). Compared to the wild type, brittle stem mutants typically exhibit increased fragility and brittleness in organs such as roots, stems, leaves, and nodes, and generally possess significant characteristics such as decreased cellulose and hemicellulose content, increased lignin content, and altered cell wall structure (irregularly shaped and significantly thinner parenchyma cells). Studies on brittle mutants of barley (Hordeum vulgare L.) have revealed that the cellulose content in brittle barley stalks is only 17.5%–20.3% of that in non-brittle stalks, with brittleness attributed to a lower number of cellulose molecules in the cell wall. Similarly, irregular xylem mutants in Arabidopsis (irx1-irx3) have also been shown to exhibit cellulose defects in the secondary cell wall, resulting in reduced mechanical strength of mature stems. In rice, studies on the endogenous retrotransposon Tos17 insert, as well as bc7 and bc11, have shown defects in members of the cellulose synthase catalytic subunit (CesA) gene family, leading to reduced cellulose content in the secondary cell wall and decreased strength of mature internodes.

[0004] In addition, most mutants also showed alterations in phenotypes such as plant height, heading date, pollen fertility, and root development. For example, mutants of the brittle stem gene OsCesA4 exhibited dwarfism, wilting of the top leaves, low fertility, and delayed heading. Different brittle stem mutants showed varying degrees of dwarfism: bc3 and bc15 showed slightly lower plant heights compared to the wild type, while bc12 showed a greater reduction in plant height, exhibiting a super-dwarf phenotype. Compared to the wild type, some mutants also showed reduced stem cell length and cell number, which may be the cause of the dwarfism. Plant height is closely related to photosynthetic efficiency and lodging resistance. Moderate dwarfing can potentially enhance the lodging resistance of rice, while the decrease in cellulose crystallinity (CrⅠ) and the increase in lignin content have recently been shown to be the main factors determining lodging resistance and biomass enzyme saccharification in rice plants.

[0005] Stem mutants are valuable materials for studying plant cell walls. Research on rice brittle stem mutants helps to further elucidate the structure, function, and synthesis mechanism of cell walls, and also has positive implications for rice straw return to the field and the development of economically viable crops that can utilize both rice straw and rice stalks.

[0006] However, current brittle stem mutants have a certain impact on yield and other related traits. Therefore, there is an urgent need in this field to develop a new mutation site that, compared with the original site, makes rice exhibit a stronger brittleness enhancement phenotype, while also showing dwarfing phenotypes, without affecting yield and other related traits. It can also increase hemicellulose components and reduce lignin content in stems and leaves. Summary of the Invention

[0007] The purpose of this invention is to provide a new mutation site. The mutation at this site, compared with the original site, makes rice exhibit a stronger brittleness enhancement phenotype, and also shows phenotypes such as plant dwarfing, without affecting yield and other related traits. It can also increase hemicellulose components and reduce the content of lignin in stems and leaves.

[0008] In a first aspect of the invention, a method for improving plant traits is provided, comprising:

[0009] Editing the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene in plant cells or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene can improve plant agronomic traits, wherein the improved plant agronomic traits include one or more traits selected from the group consisting of:

[0010] (a) Increased brittleness phenotype, without affecting yield-related traits;

[0011] (b) The content of hemicellulose components increased;

[0012] (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases;

[0013] (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

[0014] In another preferred embodiment, the improved plant agronomic traits also include dwarfing and delayed heading.

[0015] In another preferred embodiment, the brittleness-enhancing phenotype includes a significant decrease in the mechanical strength of the plant stem.

[0016] In another preferred embodiment, a significant decrease in the mechanical strength of the plant stem means that the mechanical strength of the plant stem is reduced by at least 80%, preferably at least 85%, relative to its corresponding wild-type plant.

[0017] In another preferred embodiment, the yield-related traits include seed setting rate, grain length and grain width.

[0018] In another preferred embodiment, the yield-related traits that do not affect yield include those that do not affect seed setting rate, meaning that the ratio of the seed setting rate of the plant to the seed setting rate of its corresponding wild-type plant is 0.95-1.05.

[0019] In another preferred embodiment, the yield-related traits that do not affect yield include those that do not affect grain length and width, meaning that the ratio of the grain length of the plant to the grain length of its corresponding wild-type plant is 0.95-1.05.

[0020] In another preferred embodiment, the yield-related traits that do not affect yield include those that do not affect grain length and grain width, meaning that the ratio of the grain width of the plant to the grain width of its corresponding wild-type plant is 0.95-1.05.

[0021] In another preferred embodiment, the editing includes knocking out the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene.

[0022] In another preferred embodiment, the base is G.

[0023] In another preferred embodiment, the BC1 gene is derived from rice (Orazy sativa).

[0024] In another preferred embodiment, the plant includes rice.

[0025] In another preferred embodiment, the editing includes:

[0026] Plant cells were modified using gene mutation, gene knockout, gene interruption, T-DNA insertion technology, CRISPR technology, ZFN (zinc finger endonuclease technology), and TALEN (transcription activator effector nuclease) methods, thereby knocking out the 1480th base of the coding region (SEQ ID NO.1) or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene in the plant cells, thereby conditionally reducing or inhibiting the protein translation of the BC1 gene.

[0027] In another preferred embodiment, the editing includes: introducing a gene editing system into the plant cells that targets the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene, thereby conditionally reducing or inhibiting protein translation of the BC1 gene.

[0028] In another preferred embodiment, the gene editing system includes a gene editing tool that edits the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene. Preferably, the editing is performed based on CRISPR / Cas, Talen, and ZFN gene editing methods.

[0029] In another preferred embodiment, the cells are rice cells.

[0030] In another preferred embodiment, the method further includes the step of regenerating plant cells into a plant.

[0031] A second aspect of the present invention provides an engineered cell obtained by processing the cell using the method described in the first aspect of the present invention.

[0032] In another preferred embodiment, the cells are rice cells.

[0033] A third aspect of the present invention provides a plant or its offspring obtained by treating plant cells with the method described in the first aspect of the present invention.

[0034] In another preferred embodiment, the method further includes the step of regenerating plant cells into a plant.

[0035] A fourth aspect of the present invention provides a method for producing plant seeds, comprising hybridizing a plant with plant cells obtained by the method described in the first aspect of the present invention with itself or with another plant of the same crop.

[0036] The fifth aspect of the present invention provides a method for improving plants, the method comprising the steps of:

[0037] (a) Provide a plant cell, plant tissue, or plant part, and edit the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene in the plant cell, plant tissue, or plant part;

[0038] (b) Regenerate the plant cells, plant tissues, and plant parts from step (a) into a plant.

[0039] In another preferred embodiment, in step (a), the plant cells, plant tissues, and plant parts are modified using gene mutation, gene knockout, gene interruption, T-DNA insertion technology, CRISPR technology, ZFN (zinc finger endonuclease technology), or TALEN (transcription activator effector nuclease) methods, thereby reducing or inhibiting the expression or activity of the BC1 gene in the plant cells, plant tissues, and plant parts.

[0040] In another preferred embodiment, the editing includes knocking out the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene.

[0041] In another preferred embodiment, the method is used to improve plant agronomic traits.

[0042] In another preferred embodiment, the improved plant agronomic traits include one or more selected from the group consisting of:

[0043] (a) Increased brittleness phenotype, without affecting yield-related traits;

[0044] (b) The content of hemicellulose components increased;

[0045] (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases;

[0046] (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

[0047] The sixth aspect of this invention provides a method for preparing genetically engineered plant tissues or plant cells, comprising the steps of:

[0048] Editing the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene in the plant tissue or plant cell yields genetically engineered plant tissue or plant cell.

[0049] In another preferred embodiment, the method is used to conditionally reduce or inhibit the expression or activity of the BC1 gene.

[0050] In another preferred embodiment, "reduction or inhibition" means reducing the expression or activity of the BC1 gene to meet the following conditions:

[0051] The ratio of A1 / A0 is ≤80%, preferably ≤60%, more preferably ≤40%, and optimally 0-30%; where A1 represents the expression or activity of the BC1 gene; and A0 represents the expression or activity of the same BC1 gene in wild-type plants of the same species.

[0052] In another preferred embodiment, the reduction or inhibition means that the expression level E1 of the BC1 gene in the plant is 0-80% of that in the wild type, more preferably 0-60%, and even more preferably 0-40%, compared to the expression level E0 of the wild type BC1 gene.

[0053] The seventh aspect of this invention provides a method for preparing genetically engineered plants, comprising the steps of:

[0054] Genetically engineered plant tissues or plant cells prepared by the method described in the sixth aspect of this invention are regenerated into plant bodies, thereby obtaining genetically engineered plants.

[0055] The eighth aspect of the present invention provides a genetically engineered plant, said plant being prepared using the method described in either the sixth or seventh aspect of the present invention.

[0056] The ninth aspect of the present invention provides a BC1 gene exon variant, wherein the mutant has a deletion mutation at position 160 compared with the wild-type BC1 gene exon (the sequence shown in SEQ ID NO.2).

[0057] The tenth aspect of the present invention provides the use of a BC1 gene exon variant for improving plant agronomic traits or for preparing preparations for improving plant agronomic traits, wherein the BC1 gene exon variant has a deletion mutation at position 160 relative to the wild-type BC1 gene exon (sequence shown in SEQ ID NO.2);

[0058] The improved plant agronomic traits include one or more selected from the group consisting of:

[0059] (a) Increased brittleness phenotype, without affecting yield-related traits;

[0060] (b) The content of hemicellulose components increased;

[0061] (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases;

[0062] (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

[0063] In another preferred embodiment, the plant includes rice.

[0064] The eleventh aspect of this invention provides a method for improving plants, comprising the steps of:

[0065] (i) Genetically modifying plant cells or plant tissues to edit the 1480th base of the coding region of the BC1 gene (SEQ ID NO.1) or the 160th base of the exon of the coding region of the BC1 gene (SEQ ID NO.2);

[0066] (ii) Regenerate plants from genetically engineered plant cells or plant tissues, and test the traits of the regenerated plants, including enhanced fragility phenotype, yield-related traits, content of hemicellulose components, content of cellulose in stems, content of lignin in stems, content of cellulose in leaves, and content of lignin in leaves.

[0067] (iii) Select plants with the desired traits based on the trait test results;

[0068] The desired trait includes one or more selected from the group consisting of:

[0069] (a) Increased brittleness phenotype, without affecting yield-related traits;

[0070] (b) The content of hemicellulose components increased;

[0071] (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases;

[0072] (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

[0073] In another preferred embodiment, the editing of the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene is achieved by means selected from the group consisting of: gene mutation, gene knockout, gene interruption, RNA interference technology, T-DNA insertion technology, CRISPR technology, or a combination thereof.

[0074] In another preferred embodiment, the editing includes knocking out the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene.

[0075] In another preferred embodiment, the BC1 gene is derived from rice (Orazy sativa).

[0076] In another preferred embodiment, the plant includes rice.

[0077] In another preferred embodiment, the genetic engineering includes gene editing of the BC1 gene using one or more sgRNA-mediated Cas9 nucleases.

[0078] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0079] Figure 1 Phenotypic identification of wild-type parents GLA4 and bcm1. (A)(B) Plant height of wild-type parent GLA4 and mutant bcm1 at heading stage, scale bar 10cm; (C) Primary main spike of wild-type parent GLA4 and mutant bcm1, scale bar 5cm; (D) Number of grains per spike; (E) Seed setting rate; (F)(H) Grain length, scale bar 1cm; (G)(I) Grain width, scale bar 1cm; (J)(L) Leaf breaking force at heading stage; (K)(M) Stem breaking force at heading stage; Error bars are expressed as ±SD (n=12, of which breaking force n=20). , *, * indicate significant differences between wild-type and bcm1 plants at the 0.05 and 0.01 levels, respectively.

[0080] Figure 2 Cross-section observation and scanning electron microscopy of the second internode of wild-type GLA4 and bcm1 stems. (A)(B)(D)(E) Microscopic observation of lignin stained with phloroglucinol after cross-section of the second internode of wild-type GLA4 stems; (C)(F) Scanning electron microscopy observation results. SC: Sclerenchyma cells; FP: Basic parenchyma tissue; VB: Vascular bundles. The arrow points to the secondary cell wall of sclerenchyma cells.

[0081] Figure 3 Comparison of the content of major components of internode cell walls between wild-type GLA4 and bcm1. (A) Relative content of hemicellulose, cellulose and lignin in stems and leaves at the heading stage. (B) Relative content of hemicellulose, cellulose and lignin in leaves at the heading stage. Error bars are expressed as ±SD, and ** indicate significant differences between wild-type and bcm1 plants at the 0.05 and 0.01 levels, respectively.

[0082] Figure 4 .T-DNA insertion site map.

[0083] Figure 5Candidate gene prediction and sequencing validation. (A) Mutmap analysis of SNP indices (statistical confidence intervals; green = 95%; yellow = 99%) for candidate genes on chromosome 3. Peaks marked with red circles and arrows represent candidate regions for major genetic loci of the brittle stem trait. Yellow line: 99% confidence interval of simulated SNP index; green line: 95% confidence interval of simulated SNP index; red line: mean SNP index. (B) Sanger sequencing peak plots of wild-type and brittle stem individuals. Red boxes indicate variant codons.

[0084] Figure 6 .BC1 cDNA sequence. The mutant bcm1 has a G base deletion at position 427 of glycine. Note: Numbers on the left indicate nucleotide positions. Green letters indicate the N-terminal signal peptide; yellow letters indicate the conserved CCVS motif; blue letters indicate the C-terminus, including the predicted ω site and hydrophobic tail; gray shading indicates previously reported BC1 mutation sites and those in this study. The predicted cellulose-binding domain is underlined.

[0085] Figure 7 Expression analysis of BC1 and related brittle stem genes. (A) Stem at heading stage (B) Leaf at heading stage. Rice actin gene was used as an internal reference. Error bars are expressed as ±SD, and ** indicate significant differences between wild-type and bcm1 plants at the 0.05 and 0.01 levels, respectively.

[0086] Figure 8 Hygromycin marker screening. Note: The brittle stem mutant bcm1 was used as a positive control. Detailed Implementation

[0087] Through extensive and in-depth research, the inventors have discovered for the first time that editing (deletion mutation) the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene in rice cells or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene can significantly improve plant agronomic traits, including one or more selected from the group consisting of: (a) enhanced fragility phenotype without affecting yield-related traits; (b) increased hemicellulose content; (c) increased cellulose content in stems and decreased lignin content in stems; and (d) decreased cellulose content in leaves and increased lignin content in leaves. Based on this, the inventors completed this invention.

[0088] the term

[0089] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0090] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “made of”.

[0091] As used in this article, "isolated" means that a substance has been separated from its original environment (in the case of a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their natural state.

[0092] As used herein, "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids. Except for glycine, all are L-α-amino acids (proline is an L-α-imino acid), and their general structural formula is [insert structural formula here]. (R group is a variable group).

[0093] As used herein, the term "cell" refers to any living cell. The cell can be a prokaryotic or eukaryotic cell. The cell can be isolated. The cell may or may not be able to regenerate an organism. The cell can be in the context of a tissue, callus, culture, organ, or part. In some embodiments, the cell can be a plant cell. The plant cell of the present invention can be in isolated single-cell form, or can be a cultured cell, or can be part of a higher-level tissue unit (e.g., plant tissue or plant organ). The plant cell can be derived from angiosperms or gymnosperms, or a portion thereof. In other embodiments, the plant cell can be a monocotyledonous plant cell or a dicotyledonous plant cell. The monocotyledonous plant cell can be, for example, corn, rice, sorghum, sugarcane, barley, wheat, oats, turf, or ornamental grass cells. The dicotyledonous plant cell can be, for example, rice, tobacco, pepper, eggplant, sunflower, cruciferous plants, flax, potato, cotton, soybean, sugar beet, or rapeseed cells.

[0094] As used herein, the term "plant part" includes, but is not limited to: embryo, pollen, ovule, seed, leaf, stem, bud, flower, branch, fruit, kernel, spike, rachis, pericarp, stem, root, root tip, anther, plant cell (including intact plant cells in the plant and / or parts of the plant), plant protoplast, plant tissue, plant cell tissue culture, plant callus, plant mass, etc. As used herein, "bud" refers to the above-ground part including leaves and stems. Furthermore, as used herein, "plant cell" refers to the structural and physiological unit of a plant, including the cell wall and may also refer to the protoplast.

[0095] In the context of cells, prokaryotic cells, bacterial cells, eukaryotic cells, plant cells, plants, and / or plant parts, the term "introducing" or "introduce" means bringing a nucleic acid molecule into contact with the cell, eukaryotic cell, plant, plant part, and / or plant cell in such a way that the nucleic acid molecule enters the interior of the cell, eukaryotic cell, plant cell, and / or plant part. In the case of introducing more than one nucleic acid molecule, these nucleic acid molecules can be assembled into a single polynucleotide or part of a nucleic acid construct, or assembled into separate polynucleotides or nucleic acid constructs, and can be located on the same or different nucleic acid constructs. Therefore, these polynucleotides can be introduced into plant cells in a single transformation event, in separate transformation events, or, for example, as part of a breeding program via conventional hybridization.

[0096] BC1 gene

[0097] The BC1 gene, located on chromosome 3, encodes an Arabidopsis thaliana COBL4 homolog, a putative GPI-anchored protein located at the cell wall plasma membrane interface. The coding region is 1407 bases long and contains three exons. BC1 is predicted to contain an N-terminal sequence (CBM) for carbohydrate binding, a CCVS motif (a conserved feature of the COBRA family), a highly hydrophobic C-terminal sequence, and an ω-site required for deanchoring after glycosylphosphatidylinositol (GPI) modification. Figure 6 In vitro binding experiments showed that BC1 regulates cellulose assembly by interacting with cellulose and influencing microfibril crystallinity.

[0098] In this invention, the sequence of the coding region of the BC1 gene is shown in SEQ ID NO.1:

[0099]

[0100] BC1 gene exon variants

[0101] As used in this article, the “BC1 gene exon variant” has a mutation (e.g., deletion) at position 160 of the exon of the wild-type BC1 gene (exon 3 shown in SEQ ID NO. 2).

[0102] Furthermore, BC1 gene exon variants can be used to improve plant agronomic traits, including one or more selected from the group consisting of: (a) enhanced brittleness phenotype without affecting yield-related traits; (b) increased hemicellulose content; (c) increased cellulose content in stems and decreased lignin content in stems; and (d) decreased cellulose content in leaves and increased lignin content in leaves.

[0103] In this study, a new mutation site was discovered in the coding region of BC1, a gene encoding a COBRA-like protein (a deletion of base G at position 1480 in the coding region). The mutation at this site caused rice to exhibit a stronger brittleness phenotype compared to the original site, and also showed phenotypes such as dwarfing and delayed heading.

[0104] The sequence of exon 3 (exon 3) (SEQ ID NO.2):

[0105] ACGACACCGGCATGTTCTACGGGCTCAAGTTCTACAACGACCTGCTCATGGAGGCAGGGCCGTTCGGCAACGTGCAGTCGGAGGTGCTGATGCGAAAGGACTACAACACCTTCACCTTCAGCCAGGGCTGGGCGTTCCCGCGCA AGATCTACTTCAACGGCGACGAGTGCAAGATGCCGCCGCCGGACTCCTACCCCTACCTACCCAACTCCGCTCCGATCGGGCCGCCGCGTTCCGTGGCCGCCGCCGCCTCGGCGATCTTGGTGGTGCTCCTCCTGGTGGCATGA.

[0106] Methods of Plant Improvement

[0107] In this invention, a method for improving plants is also provided, comprising the steps of:

[0108] (i) Genetically modifying plant cells or plant tissues to edit the 1480th base of the coding region of the BC1 gene (SEQ ID NO.1) or the 160th base of the exon of the coding region of the BC1 gene (SEQ ID NO.2);

[0109] (ii) Regenerate plants from genetically engineered plant cells or plant tissues, and test the traits of the regenerated plants, including enhanced fragility phenotype, yield-related traits, content of hemicellulose components, content of cellulose in stems, content of lignin in stems, content of cellulose in leaves, and content of lignin in leaves.

[0110] (iii) Select plants with the desired traits based on the trait test results;

[0111] The desired trait includes one or more selected from the group consisting of:

[0112] (a) Increased brittleness phenotype, without affecting yield-related traits;

[0113] (b) The content of hemicellulose components increased;

[0114] (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases;

[0115] (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

[0116] In a preferred embodiment, the present invention also provides a method for improving plant traits, comprising:

[0117] Editing the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene in plant cells or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene to improve plant agronomic traits, wherein the improved plant agronomic traits include one or more selected from the group consisting of:

[0118] (a) Increased brittleness phenotype, without affecting yield-related traits;

[0119] (b) The content of hemicellulose components increased;

[0120] (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases;

[0121] (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

[0122] The main advantages of this invention include:

[0123] (1) This invention is the first to discover that editing (deletion mutation) the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene in rice cells or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene can significantly improve plant agronomic traits, including one or more selected from the group consisting of: (a) enhanced fragility phenotype without affecting yield-related traits; (b) increased content of hemicellulose components; (c) increased cellulose content in stems and decreased lignin content in stems; (d) decreased cellulose content in leaves and increased lignin content in leaves.

[0124] (2) In this invention, we discovered a novel homozygous recessive rice mutant, bcm1, which exhibits decreased overall plant mechanical strength, significant brittleness, and minimal impact on agronomic traits such as yield, grain length, and grain width. Microscopic observation revealed a decrease in the thickness of the secondary cell walls in the second internode of the stem and a reduction in the number of sclerenchyma cells, suggesting that the mutation was generated during tissue culture or that the phenotype was caused by T-DNA insertion disrupting the original gene structure. Tail-PCR detection and whole-genome sequencing confirmed that this mutant has only one insertion, located in a non-coding region of chromosome 2. We used the nearest downstream gene BBX3 (Os02g0178100) as a prediction gene, and knocked out the same upstream region of this gene using CRISPR, but the brittle stem phenotype did not appear. By backcrossing the brittle stem mutant with the parents and then self-crossing, the F2 generation was sequenced using MutMap to analyze the segregating population. SNP-index sliding window mapping located the gene in the third exon of the BC1 gene on chromosome 3. Sequencing and complementation experiments were performed in brittle stem individuals to verify this finding, demonstrating that the brittleness mutation in this study is caused by a frameshift mutation resulting from a single-base G deletion at CDS1280 in the BC1 gene. Therefore, this novel mutant may provide new information about the regulatory mechanisms of cell wall component deposition and assembly in rice, as well as the highly ordered structure of the secondary cell wall. It holds promise for applications in rice breeding, such as developing a dual-purpose crop that allows for straw return to the field and improves the palatability of livestock feed.

[0125] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0126] Unless otherwise specified, the reagents and materials used in the embodiments of this invention are all commercially available products.

[0127] Materials and methods

[0128] 1.1 Construction of the brittle stem mutant material bcm1

[0129] Using the indica rice variety Guanglu Dwarf 4 (GLA4) (bred by the Rice Research Institute of Guangdong Academy of Agricultural Sciences) as a background, during transgenic complementation experiments using T-DNA (pCAMBIA1300 vector, commercially available), a homozygous transgenic line with a different complementary trait than expected was unexpectedly isolated. The stems were abnormally brittle, but this did not affect the growth and development of the plant. The phenotype of its parallel transgenic sister line was different. The inventors named it bcm1 (Brittle culm mutant 1).

[0130] 1.2 Phenotypic Identification of Brittle Stem Mutants

[0131] (1) Tensile tester to test the brittleness of stems and leaves

[0132] Rice stalks and leaves at the heading stage were placed flat on a table, and both ends were secured with clips. An Istar tension gauge (DS2-20N, DS2-200N) was used to record the maximum force at the moment the stalks and leaves were pulled off. The mean and variance were calculated per panicle.

[0133] (2) Scanning electron microscopy observation of the cross section of the second internode of the stem

[0134] 1. Sampling and fixation: Select the same section of the second internode of rice stems during the heading stage, cut off the material of appropriate length, wash it several times with ddH2O, fix it in FAA fixative, vacuum it 3-4 times to ensure that the fixative penetrates the tissue, and place it at 4℃ for more than 24 hours for later use.

[0135] 2. Alcohol gradient dehydration: Alcohol concentrations were successively set at 70%-85%-95%-100%-100%, and each concentration was maintained for 30 minutes.

[0136] 3. Drying: Dry using the carbon dioxide critical point method for 24 hours;

[0137] 4. Sample preparation and observation: The material is attached to the copper stage with the observation side facing up using double-sided tape. After vacuum gold sputtering, it is observed by scanning electron microscopy using a Shimadzu JSM-6360LV scanning electron microscope.

[0138] (3) Analysis of the content of major cell wall components in stems and leaves

[0139] Leaves and stems of the mutant and parent GLA4 were randomly selected and blanched at 105 degrees Celsius for half an hour, then dried at 60-80 degrees Celsius to constant weight. The cell wall polysaccharide (cellulose, hemicellulose and lignin) content was analyzed by Nanjing Cavendish, a third-party testing institution.

[0140] 1.3, tail-pcr

[0141] High-purity and intact genomic DNA was extracted (using the Tiangen DP305 plant genomic DNA extraction kit). After testing the integrity of both arms of the vector in the mutant, three specific primers with high annealing temperatures (around 62℃) were designed for each of the LB and RB terminal sequences (tggcaggatatattgtggtgtaaac tgacaggatatattggcgggtaaac) in the vector (pCAMBIA1300 vector): SP1, SP2, and SP3 (LB-SP1 ctgtcgatcgacaagctcgagtttct, LB-SP2 cctatagggtttcgctcatgtgttgagc, LB-SP3...).

[0142] cagatcccccgaattaattcggcg, RB-SP1 tggcactggccgtcgttttac, RB-SP2tggcgttacccaacttaatcgccttg, RB-SP3 gccagctggcgtaatagcgaag), the design direction is from the known sequence region to the unknown sequence region, and the distance between each pair of primers should be 60-100 bp. Subsequent steps refer to the KX GenomeWalking Kit (ZT601, Beijing).

[0143] 1.4 Plant RNA extraction, reverse transcription and real-time quantitative PCR

[0144] 1. RNA extraction using the Trizol method

[0145] ①. Preheat mortar, pestle, spoon and other utensils in a 220℃ oven for 9 hours, and wipe the table with RNA-Zap to avoid subsequent RNA degradation;

[0146] ②. Add 1 ml of Trizol to a 1.5 ml RNase-free centrifuge tube, grind 0.15 g of leaf material into powder using liquid nitrogen and add it to the tube, shake vigorously for 30 seconds, and let stand at room temperature for at least 5 minutes.

[0147] ③. Add 200 μL of chloroform to the fume hood, shake vigorously, and let stand at room temperature for 5 minutes;

[0148] ④. Centrifuge at 13000 rpm and 4℃ for 10 min. Add 500 μL of isopropanol to a new centrifuge tube, transfer the aqueous phase to the new tube, invert and mix well, and place on ice for 10 min.

[0149] ⑤. Centrifuge again at 13000 rpm, 4℃ for 10 min, and discard the supernatant;

[0150] ⑥. Add 1 ml of 75% ethanol to the tube to wash the precipitate, centrifuge at 13000 rpm for 10 min, discard the supernatant, and repeat this step;

[0151] ⑦ Centrifuge at 13000 rpm for 2 min, carefully aspirate the supernatant with a pipette, and air dry for 20 min until the precipitate becomes transparent;

[0152] ⑧ Add 50 μL of DEPC water to dissolve the precipitate;

[0153] ⑨ Prepare a 1% nucleic acid gel, take 2 μL of RNA solution and electrophoresis at 150V for 20 min to check the integrity of the RNA bands and detect the RNA concentration.

[0154] 2. RNA reverse transcription (refer to the ReverTra Ace qPCR RT Master Mix with gDNA Remover kit)

[0155] ①. Add 8.8 μL of gDNA Remover to the 4×DN Master Mix and mix by inverting.

[0156] ② Place the RNA in a PCR instrument at 65°C for 5 minutes to denature it, and then immediately place it on ice;

[0157] ③ Prepare the reaction system for removing genomic DNA on ice:

[0158]

[0159] ④ After mixing, react at 37℃ for 5 minutes.

[0160] ⑤ Prepare the reverse transcription reaction solution on ice:

[0161]

[0162] ⑥ Perform PCR reaction under the following conditions

[0163] 37℃, 15 min (reverse transcription reaction);

[0164] 50℃, 5min;

[0165] 98℃, 5 min (enzyme inactivation reaction);

[0166] 10℃, hold;

[0167] ⑦ After the reaction is complete, subsequent experiments can be conducted or the product can be stored at -80 degrees Celsius.

[0168] 3. Real-time quantitative PCR (refer to THUNDERBIRD) qPCR Mix kit)

[0169] ① Using Actin or UBQ as internal controls, three parallel sets were set up for each sample, and the reaction solution was prepared:

[0170]

[0171]

[0172] ②Reaction system

[0173] 95℃, 1 min;

[0174] 95℃15s, 60℃1min, 40cycles;

[0175] 95℃ for 15 seconds;

[0176] 60℃, 1 min;

[0177] ③ After the reaction is complete, export the data for further analysis.

[0178] Example 1: Phenotypic Identification of Mutant bcm1

[0179] We backcrossed the brittle stem mutant bcm1 with the parent GLA4 and then selfcrossed to construct a backcross population BC1F2. Among 80 individuals, we found 15 mutant individuals (extremely brittle throughout) and 65 wild-type individuals (no brittleness throughout). Chi-square analysis showed a 3:1 segregation ratio between wild-type and mutant individuals (Xg). 2 =1.6667 < 3.84), indicating that this phenotype is controlled by a recessive single gene. Subsequently, we examined the phenotypes of the wild-type parent GLA4 and the mutant bcm1, including plant height, number of grains per ear, seed setting rate, grain type, heading date, and maximum breaking force of stems and leaves. Statistical analysis showed that the plant height of the brittle stem mutant was slightly lower than that of GLA4, but the difference was not statistically significant. Figure 1 (A, B) Single column yield and seed setting rate did not change significantly. Figure 1 (C, D, E), and the grain length and width of the brittle stem mutant were not affected. Figure 1 ,FI).

[0180] To further characterize the mechanical properties of the bcm1 mutant, the maximum breaking forces of its stems and leaves were measured. Furthermore, compared to the wild-type parent, the breaking forces of the leaves and stems in the bcm1 mutant decreased by 86% and 88%, respectively. Figure 1 (JM). This significant difference indicates a sharp decrease in the mechanical strength of the stem.

[0181] Example 2: Changes in cell wall structure of bcm1 mutant

[0182] To investigate the cellular defects of the bcm1 mutant, lignin was observed by staining the second internode of GLA4 and bcm1 stems with phloroglucinol. The results showed that the lignin content of bcm1 was reduced compared to GLA4. Scanning electron microscopy further confirmed that the mutant cells were significantly thinner, resulting in a looser structure, while GLA4 cells were relatively denser. These results suggest that the reduced mechanical strength of the bcm1 mutant may be caused by histological changes. Figure 2 ,AF).

[0183] Example 3: The bcm1 mutant cell wall has reduced cellulose content.

[0184] Since stems and leaves provide the main mechanical support for plants, changes in cell wall components have a significant impact on their structure. Analysis of cell wall polysaccharide content in the stems and leaves of bcm1 and GLA4 plants revealed that the content of hemicellulose, one of the three main cell wall polysaccharides tested, consistently increased in both the stems and leaves of bcm1 (increasing by 5.8% and 6.1% respectively compared to the wild type). However, the trends in cellulose and lignin changes were inconsistent between the two tissues; in the stems, cellulose content increased by 1.4%, while lignin content decreased by 5.3%. Figure 3 A), consistent with the staining observation results; in the leaves, the cellulose content decreased by 5.7%, and the lignin content increased by 3.9% (A). Figure 3 B).

[0185] Example 4: Localization of the insertion site in the bcm1 mutant

[0186] To verify whether this mutant phenotype was caused by exogenous insertion disrupting the original gene function, we amplified the flanking genomic sequence of the T-DNA insertion site using tail-PCR. Alignment analysis with the rice annotation database (https: / / rapdb.dna.affrc.go.jp / ) revealed that the T-DNA insertion was not within the gene itself, but rather located in a non-coding region on chromosome 2 (Chr2:4314856-4314872), with the nearest open reading frame 519 bp downstream. Figure 4 ).

[0187] Example 5: MutMap Location of Mutation Sites and Sequencing Verification

[0188] The bcm1 mutant was crossed with the parent GLA4, and the resulting F1 strain was self-crossed to obtain the F2 strain. Fifty brittle-stemmed plants were randomly selected, and their genomic DNA was mixed in equal amounts for high-throughput sequencing. DNA was extracted separately, mixed in equal amounts, and used to construct a progeny DNA pool before library construction and sequencing. Initial gene localization was performed using a combination of high-throughput sequencing and MutMap.

[0189] After performing sliding window plotting on the SNP-index, although the results did not show the expected peak trending towards SNP index = 1, we noticed a significant fluctuation around 20M on chromosome 3, which was identified as a candidate interval. Figure 5 A). After screening for points with high peak values, we found one point located in the coding region of the known brittle stem gene BC1. Sequencing of 20 brittle-stemmed individuals and 20 non-brittle individuals from BC1F2, as well as bcm1 and GLA4, revealed a single G deletion at this site in all brittle-stemmed individuals, while this base change was not observed in GLA4 or in non-brittle progeny. Figure 5 B).

[0190] Previously, the BC1 gene was reported to be located on chromosome 3, encoding an Arabidopsis thaliana COBL4 homologous protein, a putative GPI-anchored protein located at the cell wall plasma membrane interface, with a coding region of 1407 bases and three exons. BC1 is predicted to contain an N-terminal sequence (CBM) for binding carbohydrates, a CCVS motif (a conserved feature of the COBRA family), a highly hydrophobic C-terminal sequence, and an ω-site required for deanchoring after glycosylphosphatidylinositol (GPI) modification. Figure 6 In vitro binding experiments showed that BC1 regulates cellulose assembly by interacting with cellulose and influencing microfibril crystallinity.

[0191] We found that the bcm1 mutant has a single G deletion at amino acid position 427 (glycine). Figure 6 This can lead to a similar frameshift mutation, causing the highly hydrophobic C-terminus and a specific region around the ω-site required for GPI anchoring to become untranslatable. This may disrupt the localization of the BC1 protein, preventing it from being released into the cell wall and thus losing its normal function.

[0192] Example 6: Expression Level Detection and Complementation Validation

[0193]

[0194] In addition, we extracted RNA from the same segment of stem and leaf tissues of GLA4 and bcm1 during the heading stage when the phenotype was most significant. After reverse transcription, we used Actin as an internal reference and qRT-PCR to assess the relative expression levels of BC1 and related brittle stem genes.

[0195] As expected, the expression level of the OsBC1 gene in the mutant bcm1 was downregulated in both stems and leaves during the heading stage. Figure 7 Figures A and B show that the BC1 deletion mutation in bcm1 resulted in less transcript production. Among the related brittle stem genes examined, the expression of all genes except OsBC10 (encoding a type II membrane protein) was affected to varying degrees. Specifically, CesA4 (encoding the catalytic subunit of cellulose synthase), BC3 (dynein-associated protein DRP2B), and OsBC12 (kinesin-4) were significantly upregulated in both tissues. These findings indicate that the loss of function of the OsBC1 gene affects the alteration of expression levels of related functional genes, suggesting an intrinsic regulatory relationship among these genes in the cell wall construction process.

[0196] Example 7: Screening and Breeding of Crisp-Stem Varieties

[0197] To eliminate the influence of transgenic insertion, hygromycin marker testing was performed on the F2 progeny of brittle-stemmed individuals who exhibited phenotypic segregation after crossing the parental line GLA4 with the mutant bcm1 and then self-crossing. Unmarked brittle-stemmed progeny were selected and continued to be planted for multiple generations to ensure phenotypic stability and absence of transgenic markers, thus obtaining a brittle-stemmed line with a genetic background free of transgenic insertion. Figure 8 ).

[0198] Summarize:

[0199] In this invention, we discovered a novel homozygous recessive rice mutant, bcm1, which exhibits decreased overall plant mechanical strength, significant brittleness, and minimal impact on agronomic traits such as yield, grain length, and grain width. Microscopic observation revealed a decrease in the thickness of the secondary cell walls and a reduction in the number of thick-walled cells in the second internode of the stem, suggesting a mutation generated during tissue culture or a phenotype resulting from T-DNA insertion disrupting the original gene structure. Tail-PCR and whole-genome sequencing confirmed that this mutant contains only one insertion, located in a non-coding region of chromosome 2. By backcrossing the brittle stem mutant with the parents and then self-crossing, and sequencing the segregating population using MutMap in the F2 generation, and performing sliding window mapping on the SNP-index, the gene was located in the third exon of the BC1 gene on chromosome 3. Sequencing and complementation experiments were conducted in brittle stem individuals to verify this finding, demonstrating that the brittleness mutation in this study is caused by a frameshift mutation resulting from a single-base G deletion at CDS1480 or at position 160 of the third exon of CDS in the BC1 gene. Therefore, this new mutant may provide new information on the regulatory mechanisms of cell wall component deposition and assembly in rice, as well as the highly ordered structure of the secondary cell wall. It holds promise for applications in rice breeding, enabling the development of economically viable crops that can be used for both grain and straw return, and also improving the palatability of livestock feed.

[0200] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A method for improving plant traits, characterized in that, include: Editing the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene in plant cells or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene can improve plant agronomic traits, wherein the improved plant agronomic traits include one or more traits selected from the group consisting of: (a) Increased brittleness phenotype, without affecting yield-related traits; (b) The content of hemicellulose components increased; (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases; (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

2. An engineered cell, characterized in that, The cells are obtained by processing them using the method described in claim 1.

3. A plant or its offspring, characterized in that, Obtained by treating plant cells with the method described in claim 1.

4. A method for producing plant seeds, characterized in that, This includes hybridizing the plant with plant cells obtained by the method of claim 1 with itself or with another plant of the same crop.

5. A method for improving plants, characterized in that, The method includes the following steps: (a) Provide a plant cell, plant tissue, or plant part, and edit the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene in the plant cell, plant tissue, or plant part; (b) Regenerate the plant cells, plant tissues, and plant parts from step (a) into a plant.

6. A method for preparing genetically engineered plant tissues or plant cells, characterized in that, Including the following steps: Editing the 1480th base of the coding region (SEQ ID NO.1) of the BC1 gene or the 160th base of the exon (SEQ ID NO.2) of the coding region of the BC1 gene in the plant tissue or plant cell yields genetically engineered plant tissue or plant cell.

7. A method for preparing genetically engineered plants, characterized in that, Including the following steps: Genetically engineered plant tissues or plant cells prepared by the method described in claim 6 are regenerated into plant bodies to obtain genetically engineered plants.

8. A BC1 gene exon variant, characterized in that, Compared to the wild-type BC1 gene exon (the sequence shown in SEQ ID NO.2), the mutant has a deletion mutation at position 160.

9. The use of a BC1 gene exon variant, characterized in that, For improving plant agronomic traits, or for preparing preparations for improving plant agronomic traits, the BC1 gene exon variant has a deletion mutation at position 160 relative to the wild-type BC1 gene exon (sequence shown in SEQ ID NO. 2); The improved plant agronomic traits include one or more selected from the group consisting of: (a) Increased brittleness phenotype, without affecting yield-related traits; (b) The content of hemicellulose components increased; (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases; (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

10. A method for improving plants, characterized in that, Including the following steps: (i) Genetically modifying plant cells or plant tissues to edit the 1480th base of the coding region of the BC1 gene (SEQ ID NO.1) or the 160th base of the exon of the coding region of the BC1 gene (SEQ ID NO.2); (ii) Regenerate plants from genetically engineered plant cells or plant tissues, and test the traits of the regenerated plants, including enhanced fragility phenotype, yield-related traits, content of hemicellulose components, content of cellulose in stems, content of lignin in stems, content of cellulose in leaves, and content of lignin in leaves. (iii) Select plants with the desired traits based on the trait test results; The desired trait includes one or more selected from the group consisting of: (a) Increased brittleness phenotype, without affecting yield-related traits; (b) The content of hemicellulose components increased; (c) The content of cellulose in the stem increases, while the content of lignin in the stem decreases; (d) The content of cellulose in the leaves decreased, while the content of lignin in the leaves increased.

Images