Application of rice OsMAPK14 gene in regulating grain size

Abstract

This invention provides a rice OsMAPK14 The application of genes in regulating grain size, the OsMAPK14 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:1; the regulation described is positive regulation, i.e., by increasing the concentration of certain substances in rice. OsMAPK14 Gene expression level or overexpression OsMAPK14 Genes are used to increase grain length, grain thickness, and / or thousand-grain weight in rice; by reducing the amount of... OsMAPK14 Gene expression level or knockout OsMAPK14 Genes that reduce grain length, grain thickness, and / or thousand-grain weight in rice. OsMAPK14 The CRISPR / Cas9 knockout target sequence of the gene includes: a) a first target sequence as shown in SEQ ID NO:3; and b) a second target sequence as shown in SEQ ID NO:4. This invention discloses for the first time... OsMAPK14 The gene positively regulates the biological functions of rice grain length, grain thickness, and thousand-grain weight, providing new gene resources and application methods for high-yield molecular breeding of rice; through overexpression OsMAPK14 Genes can effectively increase the size of rice grains and improve the thousand-grain weight, thereby increasing the yield per unit area of ​​rice.

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and molecular breeding technology, specifically to a type of rice. OsMAPK14 The application of genes in regulating grain size. Background Technology

[0002] Rice ( Rice. Rice, as the most important staple crop in China and even the world, feeds more than half of the global population. In recent years, with the reduction of arable land, intensified climate change, and continuous population growth, increasing rice yield has become an urgent need to ensure food security. Rice yield is mainly composed of four factors: effective panicle number, number of grains per panicle, thousand-grain weight, and seed setting rate. Among these, grain size directly determines thousand-grain weight and is a key agronomic trait affecting the final yield. In addition, grain size is not only closely related to yield but also affects the appearance quality and commercial value of rice. Therefore, cloning and identifying key genes that regulate rice grain size and analyzing their molecular regulatory networks are of great significance for improving high-yield and high-quality rice.

[0003] In recent years, through techniques such as genome-wide association study (GWAS) and map-based cloning, several genes related to grain shape have been cloned in rice, including those regulating grain length. GS3 , GL6 , OsSPL13 and GL10 etc.; Adjusting particle width GS5 , GW2 , GW5 and GW5L etc.; control of grain thickness WTG1 , TGW3 , OsBZR1 and OsMADS56 These genes primarily function through mechanisms such as the ubiquitin-proteasome pathway, G protein signaling pathway, mitogen-activated protein kinase (MAPK) cascade pathway, and plant hormone synthesis and signal transduction. However, rice grain development is a complex multi-gene synergistic regulatory process, and the currently identified genes are still insufficient to fully explain the genetic variation in grain size. Furthermore, the effects of different genes differ in different genetic backgrounds, and the number of functional genes available for breeding remains limited. In particular, the specific functions and mechanisms of action of MAPK family members in the regulation of rice grain size remain largely unknown.

[0004] The MAPK cascade, a crucial signal transduction module in eukaryotes, comprises MPKKs-MPKKs-MPKs signaling cascades that utilize sequential phosphorylation to elicit responses to different signals. The rice genome encodes approximately 17 MAPKs, whose cascade signaling pathways are widely involved in rice growth and development, hormone synthesis, signal transduction, immune responses, and abiotic stress. Current research indicates that only two MAPK family members, OsMPK5 and OsMPK6, have been identified in rice grain size regulation. OsMPK6 positively regulates grain size, while OsMPK5 negatively regulates it. The functions of other MAPK family genes in rice grain size regulation remain unreported.

[0005] The inventors discovered that the MAPK family genes OsMAPK14 High expression in young rice panicles suggests it may play an important role in panicle development and grain formation. Currently, no existing technologies have been found regarding... OsMAPK14 There are no reports of gene regulation of rice grain size. Therefore, there is an urgent need to develop [genes that can regulate grain size]. OsMAPK14 The core functional gene application technology provides new gene resources and practical methods for high-yield molecular breeding of rice. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a rice OsMAPK14 The application of genes in regulating grain size has been revealed for the first time. OsMAPK14 The gene positively regulates the biological functions of rice grain length, grain thickness, and thousand-grain weight, providing new gene resources and application methods for molecular breeding of high-yield rice varieties; through overexpression OsMAPK14 Genes can effectively increase the size of rice grains and improve the thousand-grain weight, thereby increasing the yield per unit area of ​​rice.

[0007] This invention provides a rice OsMAPK14 The application of genes or gene editing systems targeting these genes in regulating rice grain size, the aforementioned OsMAPK14 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:1; OsMAPK14 The amino acid sequence of the protein expressed by the gene is shown in SEQ ID NO:2.

[0008] Furthermore, the regulation is positive regulation, that is, by increasing the concentration of certain substances in rice. OsMAPK14 The expression level of genes can be increased to enhance rice grain length, grain thickness, and / or thousand-grain weight, thereby increasing rice yield; this can be achieved by reducing the expression level of genes in rice. OsMAPK14 Gene expression level or knockout OsMAPK14 Genes were used to obtain small-grain rice mutants.

[0009] Furthermore, the gene editing system is a CRISPR / Cas9 system, which targets... OsMAPK14 The target sequences of the gene include: a) The first target sequence as shown in SEQ ID NO:3; and b) The second target sequence as shown in SEQ ID NO:4.

[0010] This invention also provides a method for regulating rice grain size, including using gene overexpression technology, gene editing technology, RNA interference technology, or chemical mutagenesis to increase or decrease the size of rice grains. OsMAPK14 Gene function or expression level; The OsMAPK14 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:1.

[0011] Furthermore, the gene overexpression technology includes... OsMAPK14 An overexpression vector containing the complete CDS sequence of the gene was introduced into rice cells to obtain... OsMAPK14 Transgenic plants with overexpressed genes are used to increase the size of rice grains, improve the thousand-grain weight, and increase yield. The gene editing technology mentioned is CRISPR / Cas9 technology, which includes targeting... OsMAPK14 The gene was introduced into rice cells via a CRISPR / Cas9 vector, allowing it to... OsMAPK14 Mutations occur in the coding region of a gene, thereby acquiring... OsMAPK14 Small-particle mutant plants with gene loss of function; Targeted OsMAPK14 The target sequences of the gene include: a) The first target sequence as shown in SEQ ID NO:3; and b) The second target sequence as shown in SEQ ID NO:4.

[0012] This invention also provides a rice breeding method for improving rice grain traits, comprising: a) Rice OsMAPK14 Gene overexpression plants or OsMAPK14 The mutant with gene loss of function was crossed with the target rice line; b) Selecting offspring that inherited OsMAPK14 Plants exhibiting gene overexpression traits and large grain size with high thousand-grain weight, or those that have inherited these traits, are considered to have inherited these traits. OsMAPK14Plants with loss-of-function gene mutations and small grain characteristics.

[0013] The present invention has the following advantages: This invention, by constructing a CRISPR / Cas9 knockout mutant, is the first to demonstrate... OsMAPK14 Genes are positive regulators of rice grain length, grain thickness, and thousand-grain weight. This discovery fills a gap in current technology regarding... OsMAPK14 This invention fills a gap in our understanding of gene function, adding a new member to the rice yield regulation network. It achieves this by knocking out… OsMAPK14 This gene can specifically reduce grain length and thickness without significantly affecting grain width, while overexpression can increase grain size, providing a precise molecular target for targeted improvement of rice grain shape and increased yield. In summary, this invention enriches the molecular mechanism of rice grain size regulation, provides new gene resources and practical methods for molecular breeding of high-yield and high-quality rice, and has significant theoretical significance and application prospects. Attached Figure Description

[0014] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0015] Figure 1 shows an embodiment of the present invention. OsMAPK14 Two SNP sites differ between indica and japonica rice; A is a CDS sequence difference, and B is an amino acid sequence difference.

[0016] Figure 2 shows an embodiment of the present invention. OsMAPK14 Expression analysis in different tissues of rice.

[0017] Figure 3 shows an embodiment of the present invention. OsMAPK14 Subcellular localization map, Bar=10 µm.

[0018] Figure 4 shows MH86 in an embodiment of the present invention. OsMAPK14 Mutation type; where A is OsMAPK14 A schematic diagram of the gene structure and the locations of the two CRISPR / Cas9 target sites (T1 and T2). B shows the mutation types of the three homozygous mutant lines.

[0019] Figure 5 shows an embodiment of the present invention. OsMAPK14 Phenotypic analysis of grains in mutant and wild type (MH86); where A is a schematic diagram of grain length (Bar=0.5 cm), B is a schematic diagram of grain width (Bar=0.5 cm), C is the statistical results of grain length, D is the statistical analysis of grain width, E is the statistical analysis of grain thickness, and F is the statistical analysis of thousand-grain weight. Detailed Implementation

[0020] The following will be combined with the appendix Figure 1-5The technical solution of the present invention will be clearly and completely described in detail with specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0021] Example 1: Rice OsMAPK14 Gene cloning and sequence analysis Will OsMAPK14 The genome sequence of rice MH86 (genotype LOC_Os02g05480) was obtained by logging into the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). Primers were designed for amplification at its 5'UTR and 3'UTR using Primer Premier 5 software. Using indica rice MH86 cDNA as a template, the genome was cloned. OsMAPK14 CDS sequence. Amplification primer sequences are as follows: MAPK14-CDS-F: GCGGTGTCTCGGGTAGGA (SEQ ID NO: 5); MAPK14-CDS-R: GCGATAATCGCCGTAGGCT (SEQ ID NO: 6).

[0022] Amplification was performed using the PCR amplification enzyme KOD FX DNA Polymerase provided by TOYOBO. The PCR amplification system consisted of: Primer Star 10 μL, ddH2O 7 μL, MAPK14-CDS-F 0.5 μL, MAPK14-CDS-R 0.5 μL, and template cDNA 2 μL. After adding the sample, the mixture was mixed and centrifuged. The PCR amplification program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 65℃ annealing for 30 s, 72℃ extension for 90 s, for a total of 35 cycles; 72℃ extension for 5 min; and storage at 4℃. This was obtained from MH86. OsMAPK14 Gene CDS. After amplification, the PCR products were detected by agarose gel electrophoresis. The amplified products were recovered from the gel and ligated into a cloning vector. Three single clones were selected and sent to the company for sequencing to obtain the gene CDS. OsMAPK14 The gene CDS, whose nucleotide sequence is shown in SEQ ID NO:1.

[0023] OsMAPK14 The full-length CDS of the gene is 1113 bp, encoding a protein composed of 370 amino acids, the amino acid sequence of which is shown in SEQ ID NO:2.

[0024] Example 2: OsMAPK14 CDS polymorphic site (SNP) analysis MH86 obtained from sequencing OsMAPK14 Comparison of the CDS sequence with that of the japonica rice variety Nipponbare (NIP) revealed two differences at SNP sites, namely SNP... 49(T / C) and SNP 561(T / C) Further analysis of CDS sequences of indica rice 9311, Minghui 63 (MH63), Shuhui 498 (R498), Zhenshan 97 (ZS97), and japonica rice Kitaake (Kit) using rice databases showed that these two SNP sites exhibited significant subspecies specificity among indica and japonica varieties (Figure 1A).

[0025] Amino acid sequence analysis showed that SNP 49(T / C) The variation at the site results in the corresponding amino acid changing from tyrosine (Y) to histidine (H), while SNPs 561(T / C) No changes in amino acids were observed (Figure 1B).

[0026] Example 3: OsMAPK14 Organizational expression analysis Total RNA was extracted from the roots, stems, leaves, leaf sheaths, leaf pulvinus, and young panicles of rice MH86, and cDNA was synthesized via reverse transcription. Real-time quantitative PCR (RT-qPCR) analysis was then performed. Results are shown below. Figure 2 As shown, the RT-qPCR results indicate... OsMAPK4 It was expressed in all tissues examined, with the highest expression level observed in early-developing spikelets, suggesting a potential important role in spike and grain development. The RT-qPCR primers are as follows: OsMAPK14-qPCR-F:AAGGATATAATGATGCCAGTA (SEQ ID NO:7); OsMAPK14-qPCR-R: GGTCTCTGTGGAGTATCT (SEQ ID NO: 8).

[0027] Example 4: OsMAPK14 Subcellular localization analysis Will OsMAPK14 The coding sequence was fused with the GFP protein to obtain the OsMAPK14-GFP fusion expression plasmid. The recombinant plasmid was then transformed into rice protoplasts, with an empty GFP vector used as a control. Results are as follows: Figure 3 As shown, observation of the green fluorescence signal revealed that... OsMAPK14The localization was basically consistent with that of the empty GFP protein, and its green light signal completely overlapped with the red light of the nuclear marker (H2B-RFP), indicating that... OsMAPK14 It is located in the cell nucleus and cytoplasm.

[0028] Example 5: OsMAPK14 Creation and phenotypic analysis of mutant materials (1) Construction of CRISPR / Cas9 vectors, genetic transformation, and screening and identification of mutants Will OsMAPK14 The gene accession number LOC_Os02g05480 was logged into the CRISPR-GE website (http: / / skl.scau.edu.cn / home / ) to predict CRISPR / Cas9 knockout targets. Suitable target sequences were selected as gRNA targets from the early coding region and conserved protein kinase regions. Figure 4 A), and then the target sequence is entered into the CRISPR RGEN Tools website (http: / / www.rgenome.net / cas-offinder / ) for off-target analysis.

[0029] The selected target sequences are as follows: OsMAPK14-Cas9-T1:AATAATGGTCTCTGGCGGTGGATCCTCCAAATGGGAGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 3); OsMAPK14-Cas9-T2: ATTATTGGTCTCTAAACGCATCAGATAATCAAGTCACGCTTCTTGGTGCC (SEQ ID NO: 4).

[0030] The target sequence was introduced via PCR amplification. A CRISPR / Cas9 knockout vector for the pHUE411 gene was constructed using the Golden Gate cloning method. After successful sequencing, the recombinant plasmid was transformed into Agrobacterium (EHA105) competent cells using a freeze-thaw method. Using MH86 as background material, transgenic rice was obtained through Agrobacterium-mediated genetic transformation. DNA was extracted from the obtained T0 generation transgenic plants, and CRISPR / Cas9 vector-specific primers were used to detect whether they were positive plants. The primer sequences are as follows: OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3' (SEQ ID NO: 9); TaU3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3' (SEQ ID NO: 10).

[0031] Positive plants were planted in an experimental field. T1 generation seedlings were harvested individually, and leaf DNA was extracted. Primers were designed near the two target sites for PCR amplification and sequencing to detect the knockout status. The primer sequences are as follows: K14-Cas9-T1-F:TCAGAACCATAGCCGAGCAA (SEQ ID NO:11); K14-Cas9-T1-R:GTCTCACGATTTATGGATGAACAA (SEQ ID NO: 12); K14-Cas9-T2-F: CGTGAGACCAACGAGAAAGTAGC (SEQ ID NO: 13); K14-Cas9-T2-R: ACCATTCAAGTTAAGATTGTGCC (SEQ ID NO: 14).

[0032] Sequencing and identification ultimately yielded three homozygous mutant lines. osmapk14-1 , osmapk14-2 and osmapk14-3 (As shown in Figure 4B). Seeds of the homozygous mutant were planted in the experimental field, and the phenotypic analysis of the T2 generation plants was performed.

[0033] (2) Analysis of agronomic traits of mutants Wild-type MH86 and three homozygous mutants were planted in the field. After maturity, seeds were harvested for grain shape (grain length, grain width, grain thickness) and thousand-grain weight determination. The results are as follows: Figure 5 As shown in Table 1-4, compared to the wild type of MH86, osmapk14 mutant ( osmapk14-1 , osmapk14-2 , osmapk14-3 Grain length, grain thickness, and thousand-grain weight were significantly reduced, while grain width was not different from the wild type. This result indicates... OsMAPK14 Genes positively regulate rice grain length, grain thickness, and thousand-grain weight, but have no significant effect on grain width.

[0034] Table 1 MH86 and osmapk14 Mutant Particle Length (in mm) Data Statistics

[0035] Table 2 MH86 and osmapk14 Mutant Particle Width (in mm) Data Statistics

[0036] Table 3 MH86 and osmapk14 Mutant Particle Thickness (in mm) Data Statistics

[0037] Table 4 MH86 and osmapk14 Mutant 1000-grain weight (in g) data statistics

[0038] In summary, the inventors' research revealed that the MAPK family genes OsMAPK14 High expression in young rice panicles suggests that it may play an important role in panicle development and grain formation. Therefore, cloning from indica rice Minghui 86 into rice... OsMAPK14 Sequence alignment analysis of the CDS gene revealed two SNP differences between indica and japonica rice. Using MH86 as the background material, three homozygous mutant lines were obtained through CRISPR / Cas9 technology and Agrobacterium-mediated transformation of rice. osmapk14-1 , osmapk14-2 , and osmapk14-3 Phenotypic analysis revealed that, compared to WT, osmapk14 The mutant lines showed significantly reduced grain length, grain thickness, and thousand-grain weight, while grain width was not different from the WT. Therefore, the development of... OsMAPK14 The core functional gene application technology can provide new gene resources and practical methods for high-yield molecular breeding of rice.

[0039] While specific embodiments of the present invention have been described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and not intended to limit the scope of the present invention. Equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. Rice OsMAPK14 The application of a gene or a gene-editing system targeting that gene in regulating rice grain size is characterized by: The OsMAPK14 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:1; OsMAPK14 The amino acid sequence of the protein expressed by the gene is shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that: The regulation mentioned is positive regulation, that is, by increasing the concentration of amino acids in rice. OsMAPK14 The expression level of genes can be increased to enhance rice grain length, grain thickness, and / or thousand-grain weight, thereby increasing rice yield; this can be achieved by reducing the expression level of genes in rice. OsMAPK14 Gene expression level or knockout OsMAPK14 Genes were used to obtain small-grain rice mutants.

3. The application according to claim 1, characterized in that: The gene editing system is the CRISPR / Cas9 system, which targets... OsMAPK14 The target sequences of the gene include: a) The first target sequence as shown in SEQ ID NO:3; and b) The second target sequence as shown in SEQ ID NO:

4.

4. A method for regulating rice grain size, characterized in that: This includes using gene overexpression technology, gene editing technology, RNA interference technology, or chemical mutagenesis to increase or decrease the expression level in the rice genome. OsMAPK14 Gene function or expression level; The OsMAPK14 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:

1.

5. The method according to claim 4, characterized in that: The gene overexpression technology includes [a process] comprising [a method] containing [a gene overexpression technology]. OsMAPK14 An overexpression vector containing the complete CDS sequence of the gene was introduced into rice cells to obtain... OsMAPK14 Transgenic plants with overexpressed genes are used to increase the size of rice grains, improve the thousand-grain weight, and increase yield. The gene editing technology mentioned is CRISPR / Cas9 technology, which includes targeting... OsMAPK14 The gene was introduced into rice cells via a CRISPR / Cas9 vector, allowing it to... OsMAPK14 Mutations occur in the coding region of a gene, thereby acquiring... OsMAPK14 Small-particle mutant plants with gene loss of function; Targeted OsMAPK14 The target sequences of the gene include: a) The first target sequence as shown in SEQ ID NO:3; and b) The second target sequence as shown in SEQ ID NO:

4.

6. A rice breeding method for improving rice grain traits, characterized in that: include: a) The rice obtained according to claim 5 OsMAPK14 Gene overexpression plants or OsMAPK14 The mutant with gene loss of function was crossed with the target rice line; b) Selecting offspring that inherited OsMAPK14 Plants exhibiting gene overexpression traits and large grain size with high thousand-grain weight, or those that have inherited these traits, are considered to have inherited these traits. OsMAPK14 Plants with loss-of-function gene mutations and small grain characteristics.

Images