Application of rice OsMAPK4 gene in regulating grain length and thousand-grain weight

Abstract

The application provides a rice OsMAPK4 gene in regulating grain length and thousand-grain weight, and the OsMAPK4 nucleotide sequence of the CDS region of the gene is shown in SEQ ID NO:1; the regulation is negative regulation, that is, by reducing the expression amount or knocking out OsMAPK4 the gene in rice OsMAPK4 , the grain length and / or the thousand-grain weight of rice is increased; the OsMAPK4 gene editing system of the gene is a CRISPR / Cas9 system, which targets OsMAPK4 the target sequence of the gene, which includes: a) a first target sequence shown in SEQ ID NO:3; and b) a second target sequence shown in SEQ ID NO:4. The application first discloses OsMAPK4 the biological function of the gene in negatively regulating the grain length and the thousand-grain weight of rice, and provides a new gene resource and an application method for molecular breeding of a new rice variety with high yield; by knocking out or inhibiting the expression of the gene OsMAPK4 , the grain length and the thousand-grain weight of rice can be effectively increased, so that the yield per unit of rice is improved.

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and molecular breeding technology, specifically to a type of rice. OsMAPK4 Application of genes in regulating grain length and thousand-grain weight. Background Technology

[0002] Rice ( Oryza sativa. Rice (L) is one of the most important staple crops in China and even the world, and its yield is directly related to national food security and social stability. Grain size, as a core quantitative trait determining rice yield, is precisely regulated by a complex genetic network. In recent years, although several key genes and signaling pathways regulating grain size have been identified, research shows that these pathways do not operate independently but rather work synergistically through complex cross-talk. Therefore, identifying key genes that simultaneously regulate grain length and thousand-grain weight, analyzing their molecular regulatory networks, and applying them to high-yield and high-quality rice breeding has significant theoretical and practical value.

[0003] The MAPK cascade module, a highly conserved signal transduction module in eukaryotes, has attracted widespread attention for its role in regulating rice grain size. Among them, the MAPK module centered on OsMPK6 has been studied most extensively. On one hand, the OsMKKK10-OsMKK4-OsMPK6 module positively regulates rice grain length and width by influencing glume cell division; on the other hand, OsMPK6 and CLG1 synergistically regulate rice seed size by phosphorylating and ubiquitinizing GW6a protein, respectively. Other genes, such as OsMKKK70 and its homologs OsMKKK62 and OsMKKK55, positively regulate rice grain length through the OsMKK4-OsMPK6 cascade module. Recent studies have found that the OsMPKK3 / 4 / 5-OsMPK5-OsWRKY72 pathway, centered on OsMAPK5, negatively regulates rice grain size. These results indicate that members of the MAPK family play an important role in rice grain size. Currently, the biological functions of OsMAPK4 in grain development, grain length, or thousand-grain weight have not been reported. Therefore, elucidating the biological function and molecular mechanism of this gene in rice grain size is of great importance for high-yield molecular design breeding of rice.

[0004] The inventors discovered that the MAPK family genes OsMAPK4 High expression in young rice panicles suggests it may play an important role in panicle development and grain formation. Currently, no existing technologies have been found regarding... OsMAPK4 Reports on gene regulation of rice grain size. Therefore, the development of [a gene-based]... OsMAPK4 The core functional gene application technology provides new gene resources and practical methods for high-yield molecular breeding of rice. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a rice OsMAPK4 The application of genes in regulating grain length and thousand-grain weight has been revealed for the first time. OsMAPK4 The negative regulation of rice grain length and thousand-grain weight by genes provides new gene resources and application methods for molecular breeding of high-yield rice varieties; through knockout or inhibition... OsMAPK4 Gene expression can effectively increase rice grain length and thousand-grain weight, thereby increasing rice yield per unit area.

[0006] This invention provides a rice OsMAPK4 The application of a gene or a gene-editing system targeting that gene in regulating rice grain length and / or thousand-grain weight, the aforementioned OsMAPK4 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:1; OsMAPK4 The amino acid sequence of the protein expressed by the gene is shown in SEQ ID NO:2.

[0007] Furthermore, the regulation is negative regulation, that is, by reducing the concentration of certain substances in rice. OsMAPK4 Gene expression level or knockout OsMAPK4 Genes to increase grain length and / or thousand-grain weight in rice.

[0008] Furthermore, the gene editing system is a CRISPR / Cas9 system, which targets... OsMAPK4 The target sequences of the gene include: a) The first target sequence as shown in SEQ ID NO:3; and b) The second target sequence as shown in SEQ ID NO:4.

[0009] This invention also provides a method for increasing rice grain length and / or thousand-grain weight, including using gene editing technology, RNA interference technology, or chemical mutagenesis to reduce the length of rice grains and / or the weight of a thousand grains. OsMAPK4 Gene function or expression level; The OsMAPK4 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:1.

[0010] Furthermore, the gene editing technology is CRISPR / Cas9 technology, including targeting... OsMAPK4 The gene was introduced into rice cells via a CRISPR / Cas9 vector, enabling it to... OsMAPK4 Mutations occur in the coding region of a gene, thereby acquiring... OsMAPK4 Mutant plants with missing gene function; Targeted OsMAPK4 The target sequences of the gene include: a) The first target sequence as shown in SEQ ID NO:3; and b) The second target sequence as shown in SEQ ID NO:4.

[0011] Furthermore, a rice breeding method for improving rice grain traits includes: a) The obtained rice OsMAPK4 The mutant with gene loss of function was crossed with the target rice line; b) Selecting offspring that inherited OsMAPK4 Plants with loss-of-function gene mutations and exhibiting long grains and / or high thousand-grain weight traits.

[0012] The present invention has the following advantages: This invention, by constructing a CRISPR / Cas9 knockout mutant, is the first to demonstrate... OsMAPK4 Genes are negative regulators of rice grain length and thousand-grain weight. This discovery fills a gap in current technology regarding... OsMAPK4 This invention fills a gap in our understanding of gene function, adding a new member to the rice yield regulation network. It achieves this by knocking out… OsMAPK4 It can specifically increase grain length and thousand-grain weight, while having no significant effect on grain width and thickness. This provides a more precise molecular target for targeted improvement of rice grain shape and avoidance of rice quality decline due to excessive increase in grain width; at the same time, it provides new gene resources for high-yield molecular breeding of rice. In summary, this invention enriches the molecular mechanism of rice grain size regulation, provides new gene resources and practical methods for high-yield and high-quality molecular breeding of rice, and has important theoretical significance and application prospects. Attached Figure Description

[0013] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0014] Figure 1 As described in the embodiments of the present invention OsMAPK4 Expression analysis diagram in different tissues of rice.

[0015] Figure 2 As described in the embodiments of the present invention OsMAPK4 Subcellular localization map (Bar=10 µm).

[0016] Figure 3 In the embodiment of the present invention, MH86 OsMAPK4 Mutation type diagram, where A: OsMAPK4 A: Schematic diagram of gene structure and the locations of two CRISPR / Cas9 target sites (T1 and T2); B: Three homozygous mutant lines ( osmapk4-1 , osmapk4-2 , osmapk4-3 A diagram of gene mutation types.

[0017] Figure 4 As described in the embodiments of the present invention OsMAPK4Phenotypic analysis of grains in mutant and wild type (MH86), where A: grain length diagram (Bar=0.5 cm), B: grain length statistical analysis diagram, C: grain width diagram (Bar=0.5 cm), D: grain width statistical analysis diagram, E: grain thickness statistical analysis diagram, and F: thousand-grain weight statistical analysis diagram. Detailed Implementation

[0018] The following will be combined with the appendix Figures 1-4 The technical solution of the present invention will be clearly and completely described in detail with specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0019] Example 1: Rice OsMAPK4 Gene cloning and sequence analysis Will OsMAPK4 The genome sequence of gene LOC_Os06g48590 was obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). Primers were designed for amplification at its 5'UTR and 3'UTR using Primer Premier 5 software. Using cDNA from the indica rice variety "Minghui 86" (MH86) as a template, the genome was cloned. OsMAPK4 CDS sequence. Its amplification primers are as follows: OsMAPK4-CDS-F:GCTTCCGCCTCCAGATCC (SEQ ID NO: 5); OsMAPK4-CDS-R:GCTGCAAACCGCCCTAAA (SEQ ID NO:6).

[0020] Amplification was performed using the PCR amplification enzyme KOD FX DNA Polymerase provided by TOYOBO. The PCR amplification system consisted of: Primer Star 10 μL, ddH2O 7 μL, OsMAPK4-CDS-F 0.5 μL, OsMAPK4-CDS-R 0.5 μL, and template cDNA 2 μL. After adding the sample, the mixture was mixed and centrifuged. The PCR amplification program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 65℃ annealing for 30 s, 72℃ extension for 90 s, for a total of 35 cycles; 72℃ extension for 5 min; and isothermal at 4℃. This yielded the OsMAPK4 gene CDS from MH86. The PCR products were detected by agarose gel electrophoresis. The amplified products were recovered from the gel and ligated into a cloning vector. Three single clones were selected and sent to the company for sequencing to obtain the desired DNA.OsMAPK4 The gene CDS, whose nucleotide sequence is shown in SEQ ID NO:1.

[0021] OsMAPK4 The full-length CDS of the gene is 1110 bp, encoding a protein composed of 369 amino acids, the amino acid sequence of which is shown in SEQ ID NO:2.

[0022] Example 2: OsMAPK4 Tissue expression profile and subcellular localization analysis of genes (1) Organizational Expression Analysis RNA was extracted from the roots, stems, leaves, leaf sheaths, leaf pulvinus, and young panicles of rice MH86. The RNA was reverse transcribed into cDNA and then analyzed by real-time quantitative PCR (RT-qPCR). The results are as follows: Figure 1 As shown, the RT-qPCR results indicate... OsMAPK4 It was expressed in all tissues examined, with the highest expression level observed in early-developing spikelets, suggesting a potential important role in spike and grain development. The RT-qPCR primers are as follows: OsMAPK4-qPCR-F:ATAGATGTCTGGTCTGTTG (SEQ ID NO:7); OsMAPK4-qPCR-R:TTGTCAATGAACTCAATGTC (SEQ ID NO:8).

[0023] (2) OsMAPK4 Subcellular localization analysis Will OsMAPK4 The coding sequence was fused with the GFP protein to obtain the OsMAPK4-GFP fusion expression plasmid. The recombinant plasmid was then transformed into rice protoplasts, with an empty GFP vector used as a control. Results are as follows: Figure 2 As shown, observation of the green fluorescence signal revealed that... OsMAPK4 The localization was basically consistent with that of the empty GFP protein, and its green light signal completely overlapped with the red light of the nuclear marker (H2B-RFP), indicating that... OsMAPK4 It is located in the cell nucleus and cytoplasm.

[0024] Example 3: OsMAPK4 Creation and phenotypic analysis of gene knockout mutants (1) Construction of CRISPR / Cas9 vectors, genetic transformation and screening and identification of mutants Will OsMAPK4The gene accession number LOC_Os06g48590 was accessed on the CRISPR-GE website (http: / / skl.scau.edu.cn / home / ) to predict CRISPR / Cas9 knockout targets. Suitable target sequences were selected from the early coding region and conserved protein kinase regions as gRNA targets. Figure 3 A), and then the target sequence was entered into the CRISPRRGEN Tools website (http: / / www.rgenome.net / cas-offinder / ) for off-target analysis. Then the following targets were selected: OsMAPK4-Cas9-T1:AATAATGGTCTCTGGCGGAAGCATTACTACACAATGGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 3); OsMAPK4-Cas9-T2:ATTATTGGTCTCTAAACGCTGAATGGAGGTACTTCAGGCTTCTTGGTGCC (SEQ ID NO: 4).

[0025] Then, PCR amplification was performed to introduce the target site. Finally, a CRISPR / Cas9 knockout vector for the pHUE411 gene was constructed using the Golden Gate cloning method. After correct sequencing, the recombinant plasmid was transformed into Agrobacterium (EHA105) competent cells using a freeze-thaw method. Using MH86 as background material, transgenic rice was obtained through Agrobacterium-mediated genetic transformation. DNA was extracted from the obtained T0 generation transgenic plants, and CRISPR / Cas9 vector-specific primers were used to detect whether they were positive plants. The primer sequences are as follows: OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3' (SEQ ID NO: 9); TaU3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3' (SEQ ID NO: 10).

[0026] Positive plants were planted in the experimental field. After harvesting individual T1 generation seedlings and extracting DNA from their leaves, primers were designed near the two target sites to detect the knockout. The primer sequences are as follows: OsMAPK4-Cas9-T1-F: ATGTGGCTGTAAACAGCAAGC (SEQ ID NO: 11); OsMAPK4-Cas9-T1-R:ATTTTCATGGCGCAAGTGTC (SEQ ID NO:12); OsMAPK4-Cas9-T2-F:GCTTCCTAGTCAATCTGCCTTTT (SEQ ID NO:13); OsMAPK4-Cas9-T2-R: CAGCTCAGGAGCCCTATACCA (SEQ ID NO: 14).

[0027] Three homozygous lines were obtained through testing and named as follows: osmapk4-1 , osmapk4-2 , osmapk4-3 (like Figure 3 B). Then, homozygous seeds were planted in the experimental field, and phenotypic analysis was performed on the T2 generation plants.

[0028] (2) Analysis of agronomic traits of mutants Wild-type MH86 and three homozygous mutants were planted in the field. After maturity, seeds were harvested for grain shape (grain length, grain width, grain thickness) and thousand-grain weight determination. The results are as follows: Figure 4 As shown in Tables 1-4, compared to the wild type of MH86, all osmapk4 mutant ( osmapk4-1 , osmapk4-2 , osmapk4-3 ) grain length ( Figure 4 A, 4C) and thousand-grain weight ( Figure 4 F) all increased significantly (P<0.01), while the particle width ( Figure 4 B, 4D) and particle thickness ( Figure 4 E) No difference. This result indicates that... OsMAPK4 It is a negative regulator of rice grain length and thousand-grain weight; knocking out this gene can specifically increase grain length and thousand-grain weight.

[0029] Table 1 MH86 and osmapk4 Mutant Particle Length (in mm) Data Statistics

[0030] Table 2 MH86 and osmapk4 Mutant Particle Width (in mm) Data Statistics

[0031] Table 3 MH86 and osmapk4 Mutant Particle Thickness (in mm) Data Statistics

[0032] Table 4 MH86 and osmapk4 Mutant 1000-grain weight (in g) data statistics

[0033] In summary, the inventors' research revealed that the MAPK family genes OsMAPK4 High expression in young rice panicles suggests that it may play an important role in panicle development and grain formation. Therefore, cloning from indica rice Minghui 86 into rice... OsMAPK4 Using MH86 as background material, three homozygous mutant lines were obtained through CRISPR / Cas9 technology and Agrobacterium-mediated genetic transformation of rice. osmapk4-1 , osmapk4-2 , and osmapk4-3 Phenotypic analysis revealed that, compared to WT, osmapk4 The mutant lines showed significantly increased grain length and thousand-grain weight, while grain width and thickness were not different from WT. Therefore, the development of... OsMAPK4 The core functional gene application technology is used to improve rice grain shape and yield, providing new gene resources and practical methods for high-yield molecular breeding of rice.

[0034] While specific embodiments of the present invention have been described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and not intended to limit the scope of the present invention. Equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. Rice OsMAPK4 The application of a gene or a gene editing system targeting that gene in regulating rice grain length and / or thousand-grain weight, characterized by: The OsMAPK4 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:1; OsMAPK4 The amino acid sequence of the protein expressed by the gene is shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that: The regulation mentioned is negative regulation, that is, by reducing the concentration of certain substances in rice. OsMAPK4 Gene expression level or knockout OsMAPK4 Genes to increase grain length and / or thousand-grain weight in rice.

3. The application according to claim 1, characterized in that: The gene editing system is the CRISPR / Cas9 system, which targets... OsMAPK4 The target sequences of the gene include: a) The first target sequence as shown in SEQ ID NO:3; and b) The second target sequence as shown in SEQ ID NO:

4.

4. A method for increasing rice grain length and / or thousand-grain weight, characterized in that: This includes using gene editing technology, RNA interference technology, or chemical mutagenesis to reduce the amount of bacteria in the rice genome. OsMAPK4 Gene function or expression level; The OsMAPK4 The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO:

1.

5. The method according to claim 4, characterized in that: The gene editing technology mentioned is CRISPR / Cas9 technology, which includes targeting... OsMAPK4 The gene was introduced into rice cells via a CRISPR / Cas9 vector, enabling it to... OsMAPK4 Mutations occur in the coding region of a gene, thereby acquiring... OsMAPK4 Mutant plants with missing gene function; Targeted OsMAPK4 The target sequences of the gene include: a) The first target sequence as shown in SEQ ID NO:3; and b) The second target sequence as shown in SEQ ID NO:

4.

6. A rice breeding method for improving rice grain traits, characterized in that: include: a) The rice obtained according to claim 5 OsMAPK4 The mutant with gene loss of function was crossed with the target rice line; b) Selecting offspring that inherited OsMAPK4 Plants with loss-of-function gene mutations and exhibiting long grains and / or high thousand-grain weight traits.

Images