Use of small auxin-up RNA genes in modulating low temperature tolerance in plants

Abstract

The application relates to the field of plant biotechnology and genetic breeding technology, and discloses application of a small auxin up RNA gene in regulating low-temperature tolerance of plants. ZmSAUR57 The application discloses that the small auxin up RNA gene of corn ZmSAUR57 negatively regulates the low-temperature tolerance of plant seeds, and the germination rate of corn seeds under low-temperature conditions can be significantly improved by knocking out the gene. ZmSAUR57 The new function of the gene in low-temperature tolerance provides a new gene target and resource for breeding of a new low-temperature-tolerant plant variety, and has important significance for agricultural production. The breeding method of the low-temperature-tolerant plant provided by the application significantly shortens a breeding cycle and improves breeding efficiency compared with a traditional breeding mode.

Description

Technical Field

[0001] This invention relates to the fields of plant biotechnology and genetic breeding technology, and more specifically, to the application of small auxin-upregulated RNA genes in regulating the low-temperature tolerance of plants. Background Technology

[0002] Corn is one of the most widely distributed food crops in the world, playing a crucial role in food and feed supply. Northeast my country is the largest corn-growing region and the country's largest producer of commercial corn. However, this region frequently experiences late spring frosts during the early spring planting season, leading to widespread seed powdering and rotting, severely threatening corn yields. Low-temperature damage is also one of the most serious agricultural meteorological disasters faced by temperate, tropical, and subtropical corn-growing areas during the planting season.

[0003] If corn encounters temperatures of 6-8℃ during germination, it will cause irreversible damage to tissues and cells, increasing the risk of soil bacteria infecting the seeds and causing seed rot. Even seeds that barely survive under low temperatures will experience a prolonged recovery period, delayed growth period, shortened jointing to tasseling period, reduced corn quality, and severe yield reduction (Liao Changjian et al. 2024; Xu Ting et al. 2023). It has been reported that 10℃ is the lower limit temperature for corn sowing; for every 1℃ decrease in average temperature, corn yield decreases by 10.6 kg / mu (Liu Huizhi 1993; Yang Hao et al. 2023). If corn seeds that can still germinate and grow normally at low temperatures can be cultivated, it will not only allow for earlier sowing and a longer growing season, resulting in greater biomass accumulation and higher yields, but also be of great significance for achieving a bumper corn harvest in years of cold damage.

[0004] Seed germination is a complex physiological process involving water uptake, degradation of stored substances, energy metabolism and respiration, transcription and synthesis, and mitochondrial repair. Low-temperature stress can delay seed germination and induce the production of large amounts of reactive oxygen species (ROS) in plant cells (Marta et al. 2016). Excessive accumulation of ROS can cause damage to proteins, lipids, carbohydrates, and DNA, and even cell death (Cao et al. 2019). To alleviate low-temperature-induced oxidative stress, seed priming using melatonin or chitosan can effectively improve germination potential and rate at low temperatures, and increase the activity of antioxidant enzymes (Cao et al. 2019; Guan et al. 2009). Adding salicylic acid to seed coating agents results in seeds coated with this agent exhibiting higher germination rates, longer root and stem lengths, and enhanced activity of protective enzymes when subjected to low-temperature stress during the seedling stage (Guan et al. 2015). Adding silicon to the culture medium can increase the activity of superoxide dismutase and the content of antioxidants (Moradtalab et al. 2018).

[0005] The above methods can alleviate oxidative stress caused by low temperatures to some extent, allowing seeds to maintain high quality even after encountering low-temperature stress during germination or seedling growth. However, for farmers, this increases their workload in pre-treating seeds, and the purchase of treatment chemicals, and sometimes even specialized treatment equipment, creates a significant economic burden, hindering large-scale field implementation.

[0006] If we can improve the low-temperature germination activity of seeds from a genetic perspective, enabling seeds to germinate and grow normally under low-temperature conditions, it would be a feasible way to fundamentally solve the problem.

[0007] Currently, research on the genetic basis of low-temperature germination tolerance in maize is still in its early stages. Only a few genes involved in low-temperature germination tolerance have been reported (Gao et al. 2024; Jiang et al. 2022; Li et al. 2025; Zhou et al. 2023), and no maize varieties with low-temperature germination tolerance have been developed. Summary of the Invention

[0008] The purpose of this invention is to provide the application of small auxin-upregulated RNA genes in regulating the low-temperature tolerance of plants.

[0009] To achieve the objectives of this invention, in a first aspect, this invention provides the application of small auxin-upregulated RNA genes in regulating the low-temperature tolerance of plants. The regulation is negative regulation, that is, by reducing the expression level and / or activity of the small auxin upregulated RNA gene (including gene inactivation), the plant's low-temperature tolerance is improved.

[0010] In this invention, the protein encoded by the small auxin-upregulated RNA gene has any of the amino acid sequences shown in (a) to (c) below: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2 or 4; or, (b) Proteins derived from (a) with one or more amino acids substituted, deleted or added to the sequence shown in SEQ ID NO:2 or 4 and having the same function; (c) A protein derived from (a) having at least 80%, preferably at least 90%, more preferably at least 95% homology with the amino acid sequence shown in SEQ ID NO:2 or 4 and having equivalent function.

[0011] The protein with the sequence shown in SEQ ID NO:2 is derived from the maize inbred line B73 and is denoted as... ZmSAUR57 B73 The protein with the sequence shown in SEQ ID NO:4 is derived from the maize backbone inbred line Jing724, denoted as ZmSAUR57 J724 .

[0012] Furthermore, the low-temperature resistance refers to the germination ability of plant seeds under low-temperature conditions.

[0013] Furthermore, the method of reducing the expression level and / or activity of small auxin-upregulated RNA genes is gene editing, or it can be achieved by using an inhibitor that reduces the expression level and / or activity of the small auxin-upregulated RNA genes in the plant, wherein the inhibitor includes, but is not limited to, interfering RNA, proteins, compounds, or combinations thereof.

[0014] Furthermore, the plant is a monocotyledonous or dicotyledonous plant, preferably corn, rice, or wheat, and more preferably corn.

[0015] In a second aspect, the present invention provides a method for breeding cold-resistant plants, the method comprising: improving the cold resistance of the plant by reducing the expression level and / or activity (including gene inactivation) of RNA genes by reducing the endogenous small auxin in the plant.

[0016] Thirdly, the present invention provides a method for improving the germination rate of plant seeds under low temperature conditions, the method comprising: improving the germination rate of plant seeds under low temperature conditions by reducing the expression level and / or activity (including gene inactivation) of small endogenous auxins in plants.

[0017] Furthermore, the small auxin-upregulated RNA gene was knocked out using CRISPR / Cas9 technology.

[0018] The gRNA used in CRISPR / Cas9 technology has a target sequence that is preferably selected from at least one of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9.

[0019] Fourthly, the present invention provides the application of transgenic plants obtained according to the method in plant breeding.

[0020] Breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0021] Fifthly, the present invention provides a gene editing tool for carrying out the method, the gene editing tool comprising gRNA targeting small auxin-upregulated RNA genes, wherein the binding target sequence of the gRNA is selected from at least one of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9.

[0022] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: (i) This invention is the first to discover that auxin upregulates RNA genes in small maize plants. ZmSAUR57 Negative regulation of plant seed tolerance to low temperatures, through knockout ZmSAUR57 Genes can significantly improve the germination rate of corn seeds under low temperature conditions.

[0023] (II) This invention utilizes CRISPR / Cas9 technology to knock out the corn kernels. ZmSAUR57 The gene, through offspring segregation, removes the introduced Cas9 protein gene and gRNA, yielding only the Cas9 gene. ZmSAUR57 Cold-resistant maize plants whose gene sequence undergoes a frameshift mutation without introducing any other foreign sequence.

[0024] (III) This invention demonstrates through real-time quantitative PCR (qRT-PCR) that... ZmSAUR57 Gene expression is upregulated in the early stages of auxin induction.

[0025] (iv) The invention provides ZmSAUR57 The discovery of novel gene functions related to low-temperature tolerance provides new gene targets and resources for breeding new cold-tolerant plant varieties, which is of great significance to agricultural production. The breeding method for cold-tolerant plants provided by this invention significantly shortens the breeding cycle and improves breeding efficiency compared to traditional breeding methods. Attached Figure Description

[0026] Figure 1 In the preferred embodiment of the present invention ZmSAUR57 Schematic diagram of the construction strategy of the CRISPR / Cas9 knockout vector for the gene.

[0027] Figure 2 In the preferred embodiment of the present invention, for the B73 genotype ZmSAUR57 Gene( ZmSAUR57 B73 ) Edited material sequence and germination rate analysis at normal temperature and low temperature. Wherein, A represents maize ZmSAUR57 B73 Sequence and its targets, the blue font represents the two target sequences, and the arrow indicates the direction of the target sequence; B represents ZmSAUR57 B73 Schematic diagram of the coding region (the black rectangular box with an arrow represents the coding region, the arrow indicates the coding direction, and the blue rectangular box represents the target), sequence comparison between B73 and the edited homozygous material zmsaur57 B73 , zmsaur57 B73 Sequencing peak map near the target; C represents the phenotype and statistics of germination rate at each time point for B73 and zmsaur57 B73 Under normal temperature (25℃) and low temperature (10℃) conditions.

[0028] Figure 3 In the preferred embodiment of the present invention, for the Jing 724 genotype ZmSAUR57 Gene( ZmSAUR57 J724 ) Edited material sequence and germination rate analysis at normal temperature and low temperature. Wherein, A represents maize ZmSAUR57 J724 Sequence and its targets, the blue font represents 3 target sequences, and the arrow indicates the direction of the target sequence; B represents ZmSAUR57 J724 Schematic diagram of the coding region (the black rectangular box with an arrow represents the coding region, the arrow indicates the coding direction, and the blue rectangular box represents the target), sequence comparison between Jing 724 and 2 homozygous edited materials zmsaur57-1 J724 zmsaur57-2 J724 , zmsaur57-1 J724 zmsaur57-2 J724 Sequencing peak map near the target. C represents the phenotype and statistics of germination rate at each time point for Jing 724 and zmsaur57-1 J724 zmsaur57-2 J724 Under normal temperature (25℃) and low temperature (10℃) conditions, the red arrow indicates the germinated seeds.

[0029] Figure 4qRT-PCR identification is a preferred embodiment of the present invention. ZmSAUR57 IAA-induced upregulation of expression.

[0030] Figure 5 In a preferred embodiment of the present invention, SNPs significantly associated with low-temperature germination, obtained through GWAS analysis, were linked to another gene. ZmHAO ( h istone a cetyltransferase o (rthologue) Editing material sequences and germination rate analysis at room temperature and low temperature. Where A represents the maize gene. ZmHAO The sequence and its target points are shown in blue, with three target point sequences represented in blue and arrows indicating the direction of the target sequence; B represents... ZmHAO Schematic diagram of the coding area (black rectangles with arrows represent coding areas, arrows indicate coding direction, blue rectangles represent target points), Beijing 724 and pure synthetic editing materials zmhao Sequence comparison, zmhao Sequencing peaks near the target site. C represents Jing724 and... zmhao Statistical analysis of germination rates at various time points under normal temperature (25℃) and low temperature (10℃) conditions. Detailed Implementation

[0031] This invention aims to provide the application of small auxin-upregulated RNA genes in regulating the low-temperature tolerance of plants.

[0032] The inventors of this invention used maize gene knockout mutants to study small auxin-upregulated RNA genes. ZmSAUR57 When examining its function, an improved low-temperature germination ability was discovered. ZmSAUR57 Gene knockout materials indicate ZmSAUR57 This may be related to the low-temperature tolerance of maize. Based on this, the present invention provides a method for upregulating RNA genes by knocking out small auxin molecules. ZmSAUR57 Methods to improve corn's tolerance to low temperatures.

[0033] B73 is a maize model inbred line, but it is rarely used as a parent in breeding programs. This invention not only creates a B73 genotype... ZmSAUR57 Gene( ZmSAUR57 B73 The editing materials also created the superior backbone inbred line Jing 724 genotype used in breeding. ZmSAUR57 Gene( ZmSAUR57 J724 (Editing materials)

[0034] ZmSAUR57 B73The coding region nucleotide sequence is shown in SEQ ID NO:1, which encodes a small auxin upregulated RNA gene (amino acid sequence is shown in SEQ ID NO:2).

[0035] ZmSAUR57 J724 The coding region nucleotide sequence is shown in SEQ ID NO:3, which encodes a small auxin upregulated RNA gene (amino acid sequence is shown in SEQ ID NO:4).

[0036] This invention uses the model inbred line B73 and the backbone inbred line Jing724 as experimental materials, and utilizes CRISPR / Cas9 technology to knock out the auxin-upregulated RNA gene in maize. ZmSAUR57 This proves ZmSAUR57 Knockout can significantly improve the germination rate of B73 and Jing724 under low temperature conditions.

[0037] The present invention adopts the following technical solution: In a first aspect, the present invention provides the application of biomaterials of small auxin-upregulated RNA genes in regulating plant tolerance to low temperature stress.

[0038] Preferably, the plant's tolerance to low-temperature stress is the tolerance of the plant's seeds to low-temperature stress.

[0039] Secondly, this invention provides the application of small auxin-upregulated RNA genes in regulating the germination ability of plants under low-temperature conditions.

[0040] The germination ability can be expressed as the germination rate of seeds.

[0041] Thirdly, this invention demonstrates through real-time quantitative PCR experiments that small auxins upregulate RNA genes. ZmSAUR57 Its expression is upregulated by early induction of auxin (indole-3-acetic acid, IAA).

[0042] In this invention, the plant's small auxin upregulates RNA genes. ZmSAUR57 The protein having an amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:4, or a homologous protein of the small auxin upregulated RNA gene family in plants other than maize having an amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:4.

[0043] Specifically, the plant's small auxin-upregulated RNA gene has any of the following amino acid sequences: (1) An amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:4; (2) The amino acid sequence of a plant small auxin upregulated RNA gene family homologous protein obtained by substituting, inserting or deleting one or more amino acids of the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4. (3) An amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4 and being a homologous protein of the small auxin upregulated RNA gene family; preferably, the homology is at least 90%; more preferably 95%.

[0044] The amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4 is the amino acid sequence of the small auxin-upregulated RNA gene ZmSAUR57. Those skilled in the art can obtain small auxin-upregulated RNA genes from other plants besides maize through homology comparison based on the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4. ZmSAUR57 Homologous small auxin upregulates RNA gene family proteins.

[0045] Small auxin upregulates RNA genes ZmSAUR57 The coding region nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:3. Considering codon degeneracy, all genes capable of encoding the maize small auxin-upregulated RNA gene are included. ZmSAUR57 All nucleotide sequences are within the protection scope of this invention.

[0046] In this invention, the inhibitory factor for the auxin-upregulated RNA gene of plant microbes includes nucleic acids, proteins, compounds, or compositions capable of reducing the expression level and / or activity of the auxin-upregulated RNA gene of plant microbes.

[0047] Preferably, the nucleic acid is gRNA or interfering RNA.

[0048] As one embodiment of the present invention, the binding target sequence of the gRNA is shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9.

[0049] In this invention, the biological material is an expression cassette, a vector, or a host cell.

[0050] Fourthly, this invention provides a method for knocking out auxin-upregulated RNA genes in maize. ZmSAUR57 The gRNA, wherein the binding target sequence of the gRNA is shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9.

[0051] Fifthly, the present invention provides a method for breeding cold-resistant plants, comprising: reducing the expression level and / or activity of a small auxin-upregulated RNA gene in the plant by means of gene editing, hybridization, backcrossing, self-pollination, or asexual reproduction. The small auxin-upregulated RNA gene has an amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:4, or is a homologous protein of the small auxin-upregulated RNA gene family in the plant having an amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:4.

[0052] Preferably, the small auxin-upregulated RNA gene in the plant is knocked out using CRISPR / Cas9 technology to select cold-resistant plants.

[0053] This invention utilizes CRISPR / Cas9 technology, with SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9 as knockout targets, to obtain small auxin-upregulated RNA genes in maize. ZmSAU57 Knockout lines were obtained, and CRISPR / Cas9 background-free strains were isolated from progeny. ZmSAUR57 Gene knockout maize material.

[0054] As one embodiment of the present invention, the ZmSAUR57 The preparation method of gene knockout maize material includes the following steps: (1) Using the sequences shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9 as knockout targets, construct a CRISPR / Cas9 gene knockout vector; (2) Transform the CRISPR / Cas9 gene knockout vector constructed in step (1) into Agrobacterium to construct recombinant Agrobacterium; (3) The recombinant Agrobacterium obtained in step (2) was used to infect maize embryos, and the resulting embryos were screened to obtain... ZmSAUR57 Gene knockout corn plants.

[0055] In this invention, the plant is a monocotyledonous or dicotyledonous plant. Preferably, the plant is corn, rice, or wheat. More preferably, it is corn.

[0056] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0057] Example 1: Construction of CRISPR / Cas9 knockout vector pCXB053-ZmSAUR57 To knock out the small auxin-upregulated RNA gene (encoding the protein with the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4 and the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:3) in maize, this embodiment constructs a knockout mechanism using CRISPR / Cas9 technology. ZmSAUR57 The gene knockout vector pCXB053-ZmSAUR57 (construction strategy as follows) Figure 1 (As shown).

[0058] First, the design was performed using the CRISPR-P website of South China Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Targets with high scores, low miss rates, and suitable locations were selected and screened. ZmSAUR57 For sequences containing NGG target sites in genes, the target design principles are as follows: 1) The knockout site is located in the coding (CDS) region and preferably at the protein front or in an important functional region; 2) It should cover a higher proportion of transcripts; 3) There should be no off-target effects or the off-target effects should be located in the intergenic region; 4) Target sites with higher editing efficiency should be preferred; 5) The sequence should have a relatively balanced GC content and should not easily form secondary structures.

[0059] ZmSAUR57 B73 The target sequences are located at 62 bp of the coding region sequence, namely CCGGACCCGCCGCCCAGCGA (antisense chain) (SEQ ID NO:5) and 114 bp, namely GGGCGGCGGCCATAAGGAGG (sense chain) (SEQ ID NO:6).

[0060] ZmSAUR57 J724 The target sequences are located at 85 bp of the coding region sequence, TGTATGGCGGTGCGCGTGGT (positive chain) (SEQ ID NO:7), 149 bp, AGCGGTTCGTGGTCCCCGTG (positive chain) (SEQ ID NO:8), and 205 bp, TGAGCAGCGCCACGAAGAGC (antisense chain) (SEQ ID NO:9).

[0061] The following primers were designed based on the target site sequence (protective base + bsal + target 1 + partial sequence of PSG-ZMU6 plasmid template): ZmSAUR57 B73sgRNA1 F: CAATGTCTCAATTGCGGACCCGCCGCCCAGCGAGTTTTAGAGCTAGAAATAG ZmSAUR57 B73 sgRNA2 R:TTGGGGTCCTAAACCCTCCTTATGGCCGCCGCCCAATTCGGTGCTTGCGGCTC ZmSAUR57 J724 sgRNA1 F:CAATGGTCTCAATTGGTATGGCGGTGCGCGTGGTGTTTTAGAGCTAGAAATAG ZmSAUR57 J724 sgRNA2 R:TTGGGGTCTCTAACCACGGGGACCACGAACCGCCAATTCGGTGCTTGCGGCTC ZmSAUR57 J724 sgRNA2 F: CAATGTCTCAATTGGCGGTTCGTGGTCCCCGTGGTTTTAGAGCTAGAAATAG ZmSAUR57 J724 sgRNA3 R: TTGGGGTCTCTAAACGCTCTTCGTGGCGCTGCTCCAATTCGGTGCTTGCGGCTC Using pSG-ZMU6 plasmid (purchased from Weimi Biotechnology Co., Ltd.) as a template, ZmSAUR57 was used. B73 sgRNA1 F and ZmSAUR57 B73 sgRNA2R pairing amplification was performed using primers at a concentration of 10 µM. The amplification conditions were as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 sec, 58°C annealing for 30 sec, 72°C extension for 1 min, for 36 cycles; and a final extension at 72°C for 5 min. The amplified target fragment contained two sgRNAs, approximately 600 bp in size. The PCR product and vector pCXB053 (purchased from Weimi Biotechnology Co., Ltd.) (Liu et al. 2020) were digested with BsaI enzyme. The target fragment was ligated to the vector using T4 DNA ligase. Figure 1 Then, it was transformed into E. coli competent cells DH5α, and the pCXB053-ZmSAUR57 was identified by sequencing. B73 The vector was constructed correctly. The primer ZmSAUR57 was used in the same manner. J724 sgRNA1 F and ZmSAUR57 J724sgRNA2R pairing, constructing ZmSAUR57 J724 sgRNA1 and ZmSAUR57 J724 pCXB053-ZmSAUR57 of sgRNA2 J724 (sg12), using primer ZmSAUR57 J724 sgRNA2 F and ZmSAUR57 J724 sgRNA3 R pairing, amplification including ZmSAUR57 J724 sgRNA2 and ZmSAUR57 J724 pCXB053-ZmSAUR57 of sgRNA3 J724 (sg23).

[0062] The correct plasmid pCXB053-ZmSAUR57 will be constructed. B73 pCXB053-ZmSAUR57 J724 (sg12), pCXB053-ZmSAUR57 J724 (sg23) Agrobacterium EHA105 (Huang and Wei 2005) was transformed for genetic transformation of maize. Agrobacterium transformation was performed using standard methods in the art. Plasmids were transferred into Agrobacterium EHA105 via electroporation, and identified by PCR. Using freshly peeled maize embryos approximately 1 mm in size, the embryos were placed in 2 ml plastic centrifuge tubes containing 1.8 ml of suspension. Approximately 150 immature embryos were processed within 30 min. The suspension was removed, leaving the remaining maize embryos in the tubes. 1.0 ml of Agrobacterium suspension was added, and the tubes were incubated for 5 min. The embryos in the centrifuge tubes were then resuspended and transferred to a co-culture medium. Excess Agrobacterium suspension was removed using a pipette, and the tubes were co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to resting medium and incubated in the dark at 28°C for 6 days. They were then transferred to selection medium containing diammonium phosphate for two weeks of selection culture, followed by two weeks of selection culture on a new selection medium. The resistant callus was transferred to differentiation medium and cultured at 25°C, 5000 lx, under light for 3 weeks. The differentiated seedlings were transferred to rooting medium and cultured at 25°C, 5000 lx, under light until rooting. The seedlings were then transferred to small pots for growth. After a certain growth stage, they were transplanted into a greenhouse and the offspring seeds were harvested after 3-4 months.

[0063] After transplanting into seedling trays, the bar gene (SEQ ID NO:10) of T0 plants was detected. The primer sequences were: bar F: CCATCGTCAACCACTACATCGAGACA; bar R: CTTCAGCAGGTGGGTGTAGAGCGT. The amplified product size was 269bp.

[0064] For lines testing positive for bar, perform ZmSAUR57 sequence detection near the gene target, with the primer sequences used as follows: ZmSAUR57 target F: TGCCTCATATACACGGGCAC ZmSAUR57 target R: GACGAGCATGGTTGGATTGC PCR is performed using genomic DNA as template, with an amplified length of approximately 660bp The primer concentration in the amplification reaction system is 10µM, and the amplification conditions are as follows: pre-denaturation at 95°C for 5min; denaturation at 95°C for 30sec, annealing at 60°C for 45sec, extension at 72°C for 1min, for 35 amplification cycles; final extension at 72°C for 10min.

[0065] Materials with edits at and near the target site are propagated, and Cas9 protein detection is performed, to finally screen for Cas9-free homozygous seeds with edits.

[0066] Using B73 as the transformation receptor, Cas9-free maize seeds that are editing homozygotes with an 85bp deletion between target 1 and target 2 were screened out zmsaur57 B73 。

[0067] Using Jing 724 as the transformation receptor, Cas9-free maize seeds that are editing homozygotes with a 14bp deletion at each of target 1 and target 2 were screened out zmsaur57-1 J724 and Cas9-free maize seeds that are editing homozygotes with a 14bp deletion at target 2 and a 20bp deletion at target 3 zmsaur57-2 J724 .

[0068] B73, zmsaur57 B73 , Jing 724, zmsaur57-1 J724 , zmsaur-2 J724 maize seeds sown and harvested at the same time are disinfected with 1% sodium hypochlorite for 10 minutes, rinsed 5 times with sterilized water, placed in 9cm diameter round glass dishes lined with 2 layers of wet filter paper, and placed at 25°C and 10°C respectively. Radicle breaking through the seed coat is taken as the marker of germination (Ma et al. 2023). For seeds cultured at 25°C, the germination rate is recorded at 12 hours (h), 24h, 36h, 48h, 60h, 72h, 4 days (d), 5d, 6d, and 7d after placement. For seeds placed at 10°C, the germination rate recording starts on the 4th day, and the germination rate is recorded every 1 day until the 20th day.

[0069] Statistical results showed that there was no significant difference in the germination rate of B73 and zmsaur57 B73 at various time points (12, 24, 36, 48, 60, 72 h, 4, 5, 6, 7 d) under normal temperature (25°C), but after low-temperature treatment at 10°C for 8, 10, 12, 14, 16, 18, 20 d, zmsaur57 B73 had a higher germination rate than B73 ( Figure 2 Panel C), indicating that ZmSAUR57 the mutation increased the germination rate of B73 under low-temperature conditions.

[0070] Under 25°C, only at the 24 h time point, Jing 724 had a higher germination rate than zmsaur57-1 J724 , zmsaur57-2 J724 while at 36 h and subsequent time points, including 48, 60, 72 h, 4, 5, 6, 7 d, the germination rates of zmsaur57-1 J724 and zmsaur57- 2 J724 were all higher than that of Jing 724. After low-temperature treatment at 10°C for 6, 8, 10, 12, 14, 16, 18, 20 d, the germination rates of the two edited lines were both higher than that of Jing 724 ( Figure 3 Panel C). This indicates that the ZmSAUR57 mutation can increase the germination rate of Jing 724 under both normal temperature and low-temperature conditions, zmsaur57-1 J724 and zmsaur57-2 J724 have stronger low-temperature germination tolerance than Jing 724.

[0071] The above experimental data show that the ZmSAUR57 mutation can increase the germination rate of the model inbred line B73 and the elite inbred line Jing 724 under low-temperature conditions. It is speculated that the ZmSAUR57 mutation can also improve the low-temperature germination tolerance of other inbred lines, enabling maize to germinate and grow normally after encountering low-temperature stress, which can provide gene and material resources for breeding maize varieties with low-temperature germination tolerance.

[0072] B73 seeds were germinated at 25°C for 48 h (hours), seeds with a radicle length of 1-2 mm were selected, and treated with 30 µM indole-3-acetic acid (IAA) for 10 m (minutes), 1 h, and 3 h. The qRT-PCR gene amplification primer ZmSAUR57 B73 qRTF: ATCACCATCCCCTGCGGCG; ZmSAUR57 B73qRT-PCR primer R: AGCCGGCGATGTGGAAGTGG. Internal control primers: beta tubulin 7 F: CTACCTCACGGCATCTGCTATGT; beta tubulin 7 R: GTCACACACACTCGACTTCACG. qRT-PCR conditions: hold stage: 95℃ for 30 sec; PCR stage: 95℃ for 10 sec, 60℃ for 20 sec, 40 cycles; melt curve stage: 95℃ for 15 sec, 60℃ for 1 min, 95℃ for 15 sec.

[0073] The results showed that IAA treatment at 10 m... ZmSAUR57 The expression of auxin-responsive genes was significantly upregulated, consistent with previously reported expression patterns (Jain et al. 2006), and continued to show an upregulation trend until 3 hours later. Figure 4 ),illustrate ZmSAUR57 During the germination period, its expression is upregulated by early induction of auxin.

[0074] In addition, SNPs significantly associated with low-temperature germination obtained through GWAS analysis, besides being linked to genes... ZmSAUR57 It is also related to another gene. ZmHAO ( h istone a cetyltransferase o rthologue). Regarding Beijing 724 ZmHAO Editing was performed, resulting in homozygous edited material with a 20bp deletion at target site 1 and a 110bp deletion between target sites 2 and 3. The edited material sequence and germination rate analysis at room temperature and low temperature are shown in the following figures. Figure 5 As shown in the figure, under 25℃ conditions, at the 24h and 36h time points, the temperature of Beijing 724 was higher than that of other products. zmhao High germination rate; at all time points from 48 hours onwards, Beijing 724 and... zmhao The germination rates were comparable, therefore, under normal temperature conditions, Jing 724 germinated faster. After treatment at 10℃ for 6, 8, and 10 days, Jing 724 germinated faster than... zmhao High germination rate; at all time points of 12 days and above, Jing 724 and... zmhao The germination rates were comparable, indicating that under low-temperature conditions, Jing 724 still germinated faster. Figure 5 (C). Generally, comparing the low-temperature germination ability of two different seed genotypes requires that the germination rates of these two genotypes are not significantly different under normal temperature conditions, and that the seed that germinates faster under low temperature conditions has a stronger low-temperature germination tolerance. However, at 25℃, zmhao It germinates more slowly than the Jing 724, so under 10℃ conditions, zmhao The slow germination may not be due to... zmhao The cause was not a mutation, but rather the seed's inherently lower viability compared to Jing 724 under normal temperature conditions, thus ruling out other possibilities. ZmHAO Genes are directly related to seed tolerance to low-temperature germination.

[0075] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0076] References: [1]Cao Q, Li G, Cui Z, Yang F, Jiang X, Diallo L, Kong F (2019) SeedPriming with Melatonin Improves the Seed Germination of Waxy Maize underChilling Stress via Promoting the Antioxidant System and Starch Metabolism. Scientific reports 9:15044. [2]Gao L, Pan L, Shi Y, Zeng R, Li M, Li Z, Zhang X, Zhao X, Gong X,Huang W, Yang X, Lai J, Zuo J, Gong Z, Wang [3]Guan Y, Li Z, He F, Huang Y, Song W, Hu J (2015) "On-off"thermoresponsive coating agent containing salicylic acid applied to maizeseeds for chilling tolerance. PloS one 10:e0120695. [4]Guan YJ, Hu J, Wang XJ, Shao CX (2009) Seed priming with chitosanimproves maize germination and seedling growth in relation to physiologicalchanges under low temperature stress. Journal of Zhejiang University ScienceB 10:427-433. [5]Huang X, Wei Z (2005) Successful Agrobacterium-Mediated GeneticTransformation of Maize Elite Inbred lines. Plant Cell, Tissue and OrganCulture 83:187-200. [6]Jain M, Tyagi AK, Khurana JP (2006) Genome-wide analysis,evolutionary expansion, and expression of early auxin-responsive SAUR genefamily in rice (Oryza sativa). Genomics 88:360-371. [7]Jiang H, Shi Y, Liu J, Li Z, Fu D, Wu S, Li M, Yang Z, Lai J, YangX, Gong Z, Hua J, Yang S (2022) Natural polymorphism of ZmICE1 contributes toamino acid metabolism that impacts cold tolerance in maize. Nature plants 8:1176-1190. [8]Li D, Zhang C, Dong Z, Yang L, Wang H, Wang X, Dirk LMA, DownieAB, Zhao T (2025) ZmDREB1A Regulates myo-Inositol-1-phosphate Synthase 2Controlling Maize Germination at Low Temperatures. Journal of agriculturaland food chemistry 73:7562-7573. [9]Liu HJ, Jian L, Xu J, Zhang Q, Zhang M, Jin M, Peng Y, Yan J, HanB, Liu J, Gao F, Liu X, Huang L, Wei W, Ding Y, Yang X, Li Z, Sun J, Bai M,Song W, Chen H, Sun X, Li W, Lu Y, Liu Y, Zhao Y, Fernie D, Jackson YAR (2020) High-Throughput CRISPR / Cas9 Mutagenesis Streamlines Trait GeneIdentification in Maize. The Plant cell 32:1397-1413.

[10] Ma Y, Yao L, Zhang L, Su A, Wang R, Song W, Li Z, Zhao J (2023)Genome‐wide association analysis of chilling‐tolerant germination in a newmaize association mapping panel. Food and Energy Security 12:e445.

[11] Marta B, Szafranska K, Posmyk MM (2016) Exogenous MelatoninImproves Antioxidant Defense in Cucumber Seeds (Cucumis sativus L.)Germinated under Chilling Stress. Frontiers in plant science 7:575.

[12] Moradtalab N, Weinmann M, Walker F, Hoglinger B, Ludewig U,Neumann G (2018) Silicon Improves Chilling Tolerance During Early Growth ofMaize by Effects on Micronutrient Homeostasis and Hormonal Balances.Frontiers in plant science 9:420.

[13] Zhou Y, Zhang H, Zhang S, Zhang J, Di H, Zhang L, Dong L, Lu Q,Zeng X, Liu X, Zhang N, Wang Z (2023) The G protein-coupled receptor COLD1promotes chilling tolerance in maize during germination. Internationaljournal of biological macromolecules 253:126877.

[14] Liao Changjian, Zhan Penglin, Zhang Yang, Lu Heding, Xu Jing, Zhuang Wei, Chen Shanhu, Lin Jianxin (2024) Study on seed germination and seedling resistance of high-quality sweet maize backbone lines under low temperature. Journal of Nuclear Agricultural Sciences 38:1258-1267.

[15] Liu Huizhi (1993) Effects of low temperature on maize growth and yield. Liaoning Agricultural Sciences 2:42-43.

[16] Xu T, Wang JQ, Han YH, Zhou C, Qu ZHONG, Gao P, Ding XY (2023) Effects of low temperature chilling injury on germination and α-amylase activity of different maize seeds. Heilongjiang Agricultural Sciences 10:1-5.

[17] Yang Hao, Cao Qingjun, Yang Fentuan, Kong Fanli, Su Deyue, Li Gang (2023) Physiological response of different maize varieties to low temperature stress. Maize Science 31:74-82.

Claims

1. Application of small auxin-upregulated RNA genes in regulating plant cold tolerance; The regulation is negative regulation, that is, by reducing the expression level and / or activity of the small auxin upregulating RNA genes, the plant's low-temperature tolerance is improved. The protein encoded by the small auxin-upregulated RNA gene has any of the amino acid sequences shown in (a) to (c) below: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2 or 4; or, (b) Proteins derived from (a) with one or more amino acids substituted, deleted or added to the sequence shown in SEQ ID NO:2 or 4 and having the same function; (c) A protein derived from (a) having at least 80%, preferably at least 90%, more preferably at least 95% homology with the amino acid sequence shown in SEQ ID NO:2 or 4 and having equivalent function.

2. The application according to claim 1, characterized in that, The low-temperature resistance refers to the germination ability of plant seeds under low-temperature conditions.

3. The application according to claim 1, characterized in that, The method of reducing the expression level and / or activity of small auxin-upregulated RNA genes is gene editing, or it can be achieved by using an inhibitor that reduces the expression level and / or activity of small auxin-upregulated RNA genes in the plant, said inhibitor including interfering RNA, protein, compound, or combination thereof.

4. The application according to any one of claims 1-3, characterized in that, The plant is a monocotyledonous or dicotyledonous plant, preferably corn, rice, or wheat, and more preferably corn.

5. A method for breeding cold-resistant plants, characterized in that, The method includes: improving the low-temperature tolerance of the plant by upregulating the expression level and / or activity of RNA genes by reducing the amount of small auxins endogenous in the plant; The protein encoded by the small auxin-upregulated RNA gene has any of the amino acid sequences shown in (a) to (c) below: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2 or 4; or, (b) Proteins derived from (a) with one or more amino acids substituted, deleted or added to the sequence shown in SEQ ID NO:2 or 4 and having the same function; (c) A protein derived from (a) having at least 80%, preferably at least 90%, more preferably at least 95% homology to the amino acid sequence shown in SEQ ID NO:2 or 4 and having the same function; The plant is a monocotyledonous or dicotyledonous plant, preferably corn, rice, or wheat, and more preferably corn.

6. A method for improving the germination rate of plant seeds under low temperature conditions, characterized in that, The method includes: improving the germination rate of plant seeds under low temperature conditions by upregulating the expression level and / or activity of RNA genes by reducing the small endogenous auxin in plants. The protein encoded by the small auxin-upregulated RNA gene has any of the amino acid sequences shown in (a) to (c) below: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2 or 4; or, (b) Proteins derived from (a) with one or more amino acids substituted, deleted or added to the sequence shown in SEQ ID NO:2 or 4 and having the same function; (c) A protein derived from (a) having at least 80%, preferably at least 90%, more preferably at least 95% homology to the amino acid sequence shown in SEQ ID NO:2 or 4 and having the same function; The plant is a monocotyledonous or dicotyledonous plant, preferably corn, rice, or wheat, and more preferably corn.

7. The method according to claim 5 or 6, characterized in that, The small auxin-upregulated RNA gene was knocked out using CRISPR / Cas9 technology. The gRNA used in CRISPR / Cas9 technology binds to a target sequence selected from at least one of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:

9.

8. The use of transgenic plants obtained by the method according to any one of claims 5-7 in plant breeding.

9. The application according to claim 8, characterized in that, Breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

10. A gene-editing tool for implementing the method according to any one of claims 5-7, characterized in that, The gene editing tool comprises a gRNA that targets small auxin-upregulated RNA genes, wherein the binding target sequence of the gRNA is selected from at least one of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9.

Images