Application of knocking out SlbHLH10 gene in improving low temperature resistance of tomato

Abstract

The present application relates to knockout SlbHLH10 The present application relates to the application of a gene in improving the low temperature resistance of tomato, and a method for obtaining a tomato variety with high low temperature resistance. The present application first discloses the negative regulation of transcription factor SlbHLH10 (Solyc01g109700) in the response of tomato to low temperature stress, enriches the molecular regulation network of plant response to low temperature stress. And further proves that the knockout can significantly enhance the low temperature resistance, and the overexpression reduces the resistance, which provides a new theoretical basis and gene resources for understanding the regulation mechanism of plant response to low temperature stress. On the basis, the present application also provides a new tomato cold-resistant breeding gene target and specific scheme, which provides important gene resources and editing target for tomato low temperature molecular breeding, and has industrial application prospect.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology, and more specifically, relates to knockout. SlbHLH10 The application of genes in improving the low-temperature resistance of tomatoes, and a method for obtaining tomato varieties with high low-temperature resistance. Background Technology

[0002] tomato( Solanum lycopersicum Tomatoes are an important global economic crop, valued for both fresh consumption and processing. Low-temperature stress, especially extreme cold events (such as late spring frosts and winter cold waves), has a significant impact on crop production. Tomatoes are cold-sensitive plants; low temperatures affect the stability of biomembrane structures, intracellular osmotic potential, antioxidant enzyme activity, and photosynthetic processes, leading to hindered growth and development, reduced photosynthetic efficiency, and consequently, decreased yield. This has a sustained impact on the stability and economic benefits of tomato production systems.

[0003] Therefore, it is necessary to identify key genes that respond to low temperature stress in tomatoes and reveal their specific molecular mechanisms, so as to provide a theoretical basis and genetic resources for improving the low temperature tolerance of tomatoes.

[0004] SlbHLH10 yes bHLH The basic helix-loop-helix (bHLH) gene family is an important family of transcription factors widely distributed in eukaryotes. It plays a crucial role in plant growth and development, signal transduction, secondary metabolite biosynthesis, and plant responses to biotic and abiotic stresses. Currently, there are no specific [targets / treatments] for [specific treatments / treatments]. SlbHLH10 Research reports on whether or not to regulate the response of tomatoes to low temperatures. Summary of the Invention

[0005] During our research, we discovered that transcription factor genes SlbHLH10 When expression is downregulated at low temperatures, the knockout mutants exhibit significantly enhanced low-temperature resistance.

[0006] Based on the above research, the present invention provides SlbHLH10 Application of gene knockout reagents in improving the low-temperature resistance of tomatoes.

[0007] This invention also provides a method for obtaining tomato varieties with high and low temperature resistance, including knocking out the starting tomato variety. SlbHLH10 The steps of gene generation.

[0008] In one specific implementation scheme, the SlbHLH10 The gene sequence is shown in SEQ ID NO:1, or the cDNA sequence is shown in SEQ ID NO:2, or the encoded protein sequence is shown in SEQ ID NO:3.

[0009] In one specific implementation, the [unclear] is knocked out using the CRISPR / Cas9 editing system. SlbHLH10 Gene.

[0010] In one specific embodiment, the editing target of the CRISPR / Cas9 editing system is as shown in SEQ ID NO:4 or 5, and one or more bases are inserted or deleted at the editing target to cause the CRISPR / Cas9 editing system to insert or delete one or more bases at the editing target. SlbHLH10 Premature termination of protein translation of the gene, achieving the desired result. SlbHLH10 Gene knockout.

[0011] In one specific implementation, the CRISPR / Cas9 editing system is transferred into the starting tomato variety via Agrobacterium-mediated transformation to knock out the [insert specific ingredient / process]. SlbHLH10 Gene.

[0012] In one specific implementation scheme, the tomato variety is Ailsa Craig .

[0013] This invention reveals for the first time the negative regulatory role of transcription factor SlbHLH10 (Solyc01g109700) in the tomato's response to low-temperature stress, enriching the molecular regulatory network of plant low-temperature stress response. Furthermore, it demonstrates that knockout of SlbHLH10 significantly enhances low-temperature resistance, while overexpression reduces resistance, providing new theoretical basis and gene resources for understanding the regulatory mechanisms of plant low-temperature stress response. Based on this, this invention also provides new gene targets and specific schemes for tomato cold-resistance breeding, offering important gene resources and editing targets for molecular breeding of tomato with low-temperature resistance, and has promising prospects for industrial application. Attached Figure Description

[0014] Figure 1 for SlbHLH10 Expression levels at different time points (0 h, 3 h, 6 h, 9 h, 12 h, 24 h) after low-temperature treatment (4 °C) and after 48 h of recovery. Data are presented as mean ± SD from three biological replicates (n = 3).

[0015] Figure 2 for SlbHLH10 A schematic diagram of the gene structure and the CRISPR editing method. The upper part of the diagram shows... SlbHLH10 The diagram shows the gene structure and the method of editing its sequence using CRISPR knockout technology.

[0016] Figure 3 for SlbHLH10 Identification of positive families for overexpression materials.

[0017] Figure 4 for SlbHLH10 Identification of knockout mutant families.

[0018] Figure 5 for SlbHLH10 Negative regulation of tomato response to low temperature stress. Where A represents WT (AC). SlbHLH10 Overexpression ( OE10 )and slbhlh10 Phenotypic statistics of mutant materials before and after low-temperature treatment; B represents the survival rate statistics of the above materials after low-temperature treatment.

[0019] Figure 6 This study measured the electrical conductivity of plants under normal conditions and low-temperature treatment. WT (AC) SlbHLH10 Overexpression ( OE10 )and slbhlh10 The conductivity of mutant materials was measured under normal conditions and after 6 h of low-temperature stress (4°C). Detailed Implementation

[0020] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0021] 1. Tomato transcription factor genes SlbHLH10 (Solyc01g109700) We isolated transcription factor genes from tomatoes. SlbHLH10 Its full-length gene is 3162 bp, and its sequence is shown in SEQ ID NO:1. The cDNA sequence is 1305 bp long, and its sequence is shown in SEQ ID NO:2. The encoded protein sequence is shown in SEQ ID NO:3.

[0022] The study investigated whether low-temperature stress induced SlbHLH10 Transcriptional expression was detected. AC leaf tissues were collected at different time points after low-temperature treatment (4℃) and after recovery (n=3, with a total of 6 samples at each time point), and the transcriptional level was detected by RT-PCR.

[0023] The results are as follows Figure 1 As shown, low temperature stress (4℃) significantly induced bHLH010 The downregulation of its expression suggests that it may be involved in regulating the tomato's response to low-temperature stress, but the specific role of this gene in the tomato's low-temperature response process remains unclear.

[0024] 2. Tomato SlbHLH10 Gene knockout and overexpression 1) Tomato SlbHLH10 gene knockout like Figure 2 As shown, according to SlbHLH10The gene sequence was used to design two knockout target sites as follows: slbhlh10 -target 1: 5'-GCTTGATAGAACGAAATGGC-3' (SEQ ID NO:4) slbhlh10 -target 2: 5'-GTCTTAATGAGCTTGTGACT-3' (SEQ ID NO: 5).

[0025] The target site was fused into the promoter sequence of pCXUN via homologous recombination and amplified to obtain a promoter sequence containing the target site. The amplified fragment was digested with the corresponding restriction endonuclease, and the knockout vector pCXUN was simultaneously digested with the corresponding restriction endonuclease. The resulting fragment was then ligated with a homologous recombinase and heat-shocked into competent Trnas5α cells to obtain the knockout transformation vector. pCXUN-slbhlh10 The vector was introduced into tomato varieties using an Agrobacterium-mediated transgenic method. Ailsa Craig In (AC), the corresponding transformed plants were obtained.

[0026] 2) Tomato SlbHLH10 overexpression of genes according to SlbHLH10 Gene sequence, design SlbHLH10 The primers for the overexpression vector have the following sequences: SlbHLH10 -F:agagaacacgggggacgagctcATGCTCTCAAGAGTTAACAGTATGC (SEQ ID NO:6) SlbHLH10 -R:tttactccatatcaactctaga TATCATCCCATGGCAACCAGC (SEQ ID NO:7).

[0027] The target sequence was amplified using the primers described above. The amplified fragment was digested with the corresponding restriction endonuclease, and the knockout vector was simultaneously cleaved with the corresponding restriction endonuclease. The fragment was then ligated with homologous recombinase and heat-shocked into competent Trnas5α cells to obtain the transformation vector. pCAMBIA1300-35S-EGFP The vector was introduced into tomato receptor AC using Agrobacterium-mediated transgenic methods, resulting in the acquisition of corresponding positive transformed plants. Figure 3 ).

[0028] 3. Transgenic methods The specific steps for genetic modification are as follows: (1) Seed surface sterilization: ① Place the required tomato AC seeds into a conical flask and soak them in water for 10 minutes; ② Pour out the water from the bottle, and wash the seeds with 75% alcohol for 30-60 seconds without stirring during the washing process; ③ Discard the alcohol and wash the seeds with 15% sodium hypochlorite solution for 15 minutes. During this process, transfer the seeds to a sterilized triangular conical flask in a clean bench, seal the flask, and shake (manually or on a 28°C shaker). ④ Discard the sodium hypochlorite solution, wash the seeds 4-6 times with sterile water, and filter out the seeds that float on the surface of the water (discard any unripe seeds, and keep any seeds that have not been completely pectin removed).

[0029] (2) Seed inoculation / germination: Inoculate the surface-sterilized seeds onto the inoculation medium (a conical flask containing 1 / 2 MS medium), place it in the tissue culture room, and culture for 6-8 days (25℃, 16 h light / 8 h dark) until the two cotyledons are fully expanded.

[0030] (3) Preparation of inoculated bacterial solution: ① Pour 30 ml of liquid LB medium into an Erlenmeyer flask. Scrape as much Agrobacterium as possible from the solid LB plate and place it in the liquid LB. Add an appropriate amount of antibiotic, seal the flask, and place it on a shaker to activate for about 14-20 hours (28℃, about 200 rpm). ② Pour the activated bacterial culture into a 50 ml centrifuge tube, centrifuge at 3000 rpm for 5 minutes, discard the supernatant, add an appropriate amount of suspension, and centrifuge until OD reaches 50%. 600 Approximately 0.8-1.0 (This concludes the preparation of the inoculation solution).

[0031] (4) Infection: ① Transfer the pre-cultured explants to a sterile culture dish and inject an appropriate amount of suspension into the dish; ② Add an appropriate amount of inoculation solution (about 2 drops) to the explant and soak for 4 minutes. If the infection efficiency is low, the soaking time can be extended to 8 minutes. (Use a spoon to lift the plant out, place it on sterile filter paper, let it dry slightly, with the back of the leaf facing up.) ③ Discard the suspension and use sterile filter paper to absorb the staining solution from the surface of the explants; return the stained explants to KCMS medium and incubate in the dark for 2 days.

[0032] (5) Transfer the explants that have been co-cultured (referring to co-culture with Agrobacterium) to 2Z medium, with the leaf surface facing up, and culture at 25°C with a photoperiod of 16 h / 8 h. Change the medium every two weeks (for one month) until the number of differentiated shoots reaches the required amount. Wait for the callus tissue to redifferentiate into adventitious shoots.

[0033] (6) Subgeneration: ① The selected explants grown on 2Z medium were transferred to 0.2Z medium and subcultured for about 15 days. ② For explants that are growing well in subculture, cut off the leaf parts, leaving only the callus tissue and adventitious buds, and place them in a new 0.2Z medium for subculture for about 15 days.

[0034] (7) Rooting and transplanting: When the adventitious buds grow to 23 cm, cut them off from the base of the root and transfer them to the rooting medium to induce rooting; when the adventitious roots of the seedlings grow well, take out the transformed seedlings, clean the root medium, transplant them into small flower pots filled with vermiculite, cover them with a transparent plastic cover to keep them moist for about a week, and transplant them after hardening off for 2-3 weeks.

[0035] 4. Knockout mutant SlbHLH10 Genotyping The obtained transgenic plants were subjected to genotyping, and the results were as follows: Figure 4 As shown, the knockout mutant yielded two homozygous families: the first family, whose mutation type is... SlbHLH10 The deletion of multiple bases in the first exon caused premature termination of its protein coding; the mutation type in the second family was... SlbHLH10 The deletion of multiple bases in the first exon causes premature termination of its protein coding.

[0036] 5. Low-temperature tolerance of transgenic plants Slbhlh10 mutants and SlbHLH10 Overexpression tomato seeds were sown and germinated, and then transferred to a constant temperature and light incubator along with WT plants of the same growth stage. Under light conditions of 28℃ / 16 h and darkness conditions of 25℃ / 8 h, the plants were cultured until the 3-leaf stage. Tomato plants with similar growth were then selected and grouped into two groups. Slbhlh10 mutant or SlbHLH10 Overexpressing tomatoes and two WT tomato plants were grouped together. The tomato plants were soaked in water until the potting soil was completely moist, and then subjected to low-temperature treatment at 4℃ / 16 h under light conditions and 4℃ / 8 h under darkness until the tomato plants exhibited the phenotype (WT plants or...). Slbhlh10 mutant / SlbHLH10 Overexpressing plants showed signs of wilting. They were then subjected to a recovery treatment in an incubator for about 10 days. Phenotypic characteristics were observed and data were recorded.

[0037] The results are as follows Figure 5 As shown, phenotypic observation and statistical analysis revealed that... SlbHLH10 Mutant family ( slbhlh10 It significantly enhanced the low-temperature resistance of tomatoes, while SlbHLH10 Overexpression family ( OE-SlbHLH10 It exhibits low-temperature sensitivity.

[0038] 6. Detection of physiological indicators Conductivity measurement is a commonly used method for determining plant cell membrane permeability and damage. It assesses the degree of cell membrane damage by measuring the amount of electrolyte leakage from leaf cells. Leaves from both the treatment and control groups were rinsed twice with deionized water to remove surface impurities. The leaves were then blotted dry with clean filter paper. One leaf was taken, and each group's leaves were broken into 12 pieces. The 12 leaf pieces were placed in clean test tubes, with 10 tubes used as replicates. 15 mL of deionized water was added to each test tube, and the tubes were placed in a shaker at 28°C for 3 hours. After mixing the contents, the conductivity of the deionized water (S0) and the initial conductivity of the sample (S1) were measured using a conductivity meter. The test tubes were then sealed and placed in a boiling water bath for 30 minutes. The test tubes were removed, cooled to room temperature, and the final conductivity (S2) was measured using a conductivity meter. Calculation formula: Relative conductivity (L): L = (S1-S0) / (S2-S0).

[0039] The results are as follows Figure 6 As shown, under low temperature stress, compared to the wild type (AC). SlbHLH12 mutant plants ( slbhlh10 The ion penetration rate is lower; while SlbHLH10 Overexpression family ( OE-SlbHLH10 The higher ion permeability indicates that its cell membrane is severely damaged.

[0040] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. SlbHLH10 Application of gene knockout reagents in improving the low-temperature resistance of tomatoes.

2. A method for obtaining tomato varieties with high and low temperature resistance, characterized in that, Including the removal of the starting tomato variety SlbHLH10 The steps of gene generation.

3. The method according to claim 2, characterized in that, The SlbHLH10 The gene sequence is shown in SEQ ID NO:1, or the cDNA sequence is shown in SEQ ID NO:2, or the encoded protein sequence is shown in SEQ ID NO:

3.

4. The method according to claim 3, characterized in that, Knock out using the CRISPR / Cas9 editing system SlbHLH10 Gene.

5. The method according to claim 4, characterized in that, The editing target of the CRISPR / Cas9 editing system is shown in SEQ ID NO:4 or 5. One or more bases are inserted or deleted at the editing target, causing the... SlbHLH10 Premature termination of protein translation of the gene, achieving the desired result. SlbHLH10 Gene knockout.

6. The method according to claim 4, characterized in that, The CRISPR / Cas9 editing system was transferred into the starting tomato variety using an Agrobacterium-mediated method to knock out the [insert specific ingredient / process]. SlbHLH10 Gene.

7. The method according to any one of claims 2-6, characterized in that, The tomato variety mentioned is Ailsa Craig .

Images