Specific fragment for silencing espds gene of elymus nutans and method

Abstract

The application discloses a specific fragment for silencing Elymus sibiricus L. EsPDS gene and a method for simply, quickly and high-flux analyzing and identifying gene function, and specifically discloses a specific silencing fragment of phytoene desaturase gene EsPDS which is cloned from Elymus sibiricus L. for the first time, and a VIGS silencing system based on a TRV vector is successfully established; the application effectively overcomes the hindering of a cell wall barrier and natural immune response of a gramineous plant to agrobacterium infection by optimizing a formula of an agrobacterium infection solution and combining vacuum infiltration and co-culture incubation treatment, successfully solves a technical problem of low infection efficiency of the TRV-VIGS system in the gramineous plant, and enables the TRV vector to realize efficient infection and gene silencing in the Elymus sibiricus L. for the first time; the system is simple in operation, short in cycle, does not need to construct a stable transgenic plant, and can efficiently and specifically silence an endogenous EsPDS gene of the Elymus sibiricus L., and is suitable for popularization and application in the field of biotechnology.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a specific fragment and method for silencing the EsPDS gene in old wheat. Background Technology

[0002] Virus-induced gene silencing (VIGS) is a reverse genetics technique that uses recombinant viral vectors carrying target gene fragments to suppress the expression of endogenous genes in plants. It relies on the plant's own naturally occurring RNA silencing immune mechanism to achieve post-transcriptional gene silencing. Compared to traditional methods such as gene knockout, mutant screening, and stable genetic transformation, VIGS technology does not require the construction of stable transgenic plants and has significant advantages such as short experimental cycles, ease of operation, low cost, and high-throughput screening capabilities. It has become one of the core tools in plant functional genomics research.

[0003] Tobacco rattle virus (TRV) is one of the most widely used VIGS vectors, characterized by its broad host range, mild viral symptoms, and high silencing efficiency. It has been successfully applied in various dicotyledonous plants, including tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), pepper (Capsicum annuum), Arabidopsis thaliana, and petunia hybrida. However, due to significant differences between monocotyledonous and dicotyledonous plants in viral infection mechanisms, gene silencing pathway responses, and tissue regeneration characteristics, establishing a TRV-VIGS system in gramineous plants faces considerable challenges, and there are currently no mature reports applicable to *Triticum aestivum*.

[0004] *Elymus sibiricus* L. is a perennial, high-quality forage grass belonging to the genus *Elymus* of the Poaceae family. It is widely distributed in the Qinghai-Tibet Plateau, Northwest China, and the cold regions of North my country, and is an important forage species for grassland ecological restoration and artificial grassland establishment in Qinghai, Tibet, Sichuan, Gansu, and Inner Mongolia. It possesses excellent characteristics such as cold resistance, drought tolerance, tolerance to poor soil, good palatability, and high nutritional value, making it an important forage source for herbivorous livestock in cold regions. Furthermore, *Elymus sibiricus* has a well-developed root system, greens up early, and withers late, playing a vital role in degraded grassland restoration, soil and water conservation, and grassland ecological management. Therefore, establishing an efficient and stable TRV-VIGS gene silencing system for *Elymus sibiricus* is of great significance for overcoming the bottlenecks in its functional genomics research and accelerating the functional identification of genes related to important traits. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a simple, rapid, and high-throughput analysis method for identifying the function of the EsPDS gene in *Evodia rutaecarpa* and a specific fragment for silencing the EsPDS gene.

[0006] The technical solution adopted by the present invention to solve its technical problem is as follows: the nucleotide sequence of the specific fragment used to silence the EsPDS gene of old wheat is shown in the sequence listing SEQ ID NO.1.

[0007] Furthermore, the specific fragment is obtained in the following manner:

[0008] 1) Obtain the full-length gene sequence of EsPDS

[0009] First, the protein sequence of the Arabidopsis thaliana AtPDS (AT4G14210) gene was obtained. Then, using the transcriptome sequencing data of *Lysimachia christinae* from the Sequence Read Archive (SRA) database, homologous genes of *Lysimachia christinae* were searched by TBLASTN alignment to obtain the full-length cDNA sequence of the phytoene dehydrogenase gene EsPDS, whose nucleotide sequence is shown in SEQ ID NO.2.

[0010] 2) Using the full-length gene sequence of the phytopenic lycopene dehydrogenase gene EsPDS as a template, primers EsPDS-F and EsPDS-R were designed to amplify a 300bp specific fragment on the CDS domain of the EsPDS gene; their nucleotide sequences are as follows:

[0011] EsPDS-F: 5'-GGCTTCTACCAGCAATGCTTG-3'

[0012] EsPDS-R: 5'-CCTCACCACCCAAAGACTGAAT-3'

[0013] Vectors were constructed using homologous recombination. Sequences homologous to the XbaI and BamHI restriction sites of the pTRV2 vector were introduced into the 5' ends of the gene-specific primers EsPDS-F and EsPDS-R, respectively, to obtain the full-length amplification primers EsPDS-F-rec and EsPDS-R-rec, with the following sequences:

[0014] EsPDS-F-rec:

[0015] 5'-AAGGTTACCGAATTCTCTAGAGGCTTCTACCAGCAATGCTTG-3'

[0016] EsPDS-R-rec:

[0017] 5'-CGTGAGCTCGGTACCGGATCCCCTCACCACCCAAAGACTGAAT-3'

[0018] 3) Take young leaves of old wheatgrass, grind them into powder with liquid nitrogen, extract RNA using the Eastep®super total RNA extraction kit, synthesize the first strand of cDNA according to the HiScript® II 1st Strand cDNA Synthesis Kit (Vazyme, R211-01) reverse transcription kit, and store at -20℃; use the cDNA as a template to perform PCR amplification of EsPDS-F-rec and EsPDS-R-rec using primers to obtain the EsPDS gene-specific fragment with homologous arms at both ends. The size of the gene-specific part is 300bp, and the nucleotide sequence is shown in SEQ ID NO.1.

[0019] Furthermore, the PCR amplification reaction system (20 μL) consisted of: 1 μL cDNA template, 1.5 μL each of forward and reverse primers (10 μM), 1 μL dNTP mixture (2.5 mM each), 0.2 μL Taq DNA polymerase (5 U / μL), and ddH2O added to a final volume of 20 μL.

[0020] Furthermore, the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 34 cycles; 72℃ final extension for 5 min.

[0021] This invention also provides a method for silencing the EsPDS gene of *Ophiopogon japonicus* using the above-mentioned specific fragment, comprising the following steps:

[0022] A. Construction of recombinant viral vector pTRV2-EsPDS: The EsPDS gene-specific fragment was ligated into the VIGS viral backbone vector pTRV2 using homologous recombination technology to construct the recombinant viral vector pTRV2-EsPDS.

[0023] B. Agrobacterium transformation and positive identification: The recombinant viral vector pTRV2-EsPDS was transformed into Agrobacterium EHA105 competent cells by freeze-thaw method. The cells were then plated on LB plates containing 50 μg / mL kanamycin and 50 μg / mL rifampin for resistance selection. After obtaining positive clones, positive identification was performed by PCR amplification.

[0024] C. Preparation of mixed bacterial suspension: Agrobacterium suspension containing pTRV2-EsPDS identified as positive in step B and Agrobacterium suspension containing pTRV1 helper plasmid were mixed at a volume ratio of 1:1 and diluted with fresh LB medium to an OD600 value of 0.8-1.5 to obtain a mixed bacterial suspension; then, cysteine, Tween-20 and acetylsuccinone were added to the mixed bacterial suspension in sequence to make the final concentrations of each component in the mixed bacterial suspension reach 400 mg / L cysteine, 0.5% (v / v) Tween-20 and 150 μmol / L, respectively. The mixture was allowed to stand for 1 h at room temperature in the dark to obtain a mixed bacterial suspension for infection.

[0025] D. Vacuum permeation treatment: Take newly germinated seeds of old wheat and place them in the mixed bacterial solution for infection obtained in step C. Vacuum permeation treatment for 1.5 h and ultrasonic treatment for 5 min.

[0026] E. Ultrasonic treatment: The old wheat seeds after vacuum permeation treatment in D, together with the mixed bacterial solution in D, are subjected to ultrasonic treatment. The ultrasonic frequency is 40KHz, the power is 120W, the vibration interval is 5s, and the total ultrasonic time is 5min.

[0027] F. Co-culture incubation: Take out the old wheat seeds after ultrasonic treatment in step E, place them in freshly prepared mixed bacterial solution, and culture them at a constant temperature with shaking. Incubate them at a low speed at 20℃-25℃ with a shaking frequency of 80 rpm for 1 hour.

[0028] G. Cultivation and Detection: The seeds of *Eriocheir sinensis* after incubation in step E were transferred to quartz sand and placed in an incubator. The cultivation conditions were 20℃-25℃ and light / dark conditions of 14h / 10h. The phenotypic changes of the newly grown leaves of *Eriocheir sinensis* were observed, and the expression of EsPDS in the leaves was detected. Thus, the *Eriocheir sinensis* EsPDS gene sequence silencing system was constructed.

[0029] The beneficial effects of this invention are as follows: This invention is the first to clone a specific silencing fragment of the phytoene dehydrogenase gene EsPDS from *Leymus chinensis*, and successfully established a VIGS silencing system based on the TRV vector; this invention, through optimization of the Agrobacterium infection solution formulation (synergistic use of acetylsuccine, cysteine, and Tween-20) combined with vacuum permeation and co-culture incubation, effectively overcomes the obstacles of cell wall barriers and innate immune responses in gramineous plants to Agrobacterium infection, successfully solving the technical problem of low infection efficiency of the TRV-VIGS system in gramineous plants, thus enabling… For the first time, the TRV vector has achieved efficient infection and gene silencing in *Triticum aestivum*. This system is simple to operate, has a short cycle, does not require the construction of stable transgenic plants, and can efficiently and specifically silence the endogenous EsPDS gene in *Triticum aestivum*, resulting in a distinct albino phenotype in the plant leaves. This invention effectively overcomes the bottleneck problems of low genetic transformation efficiency in *Triticum aestivum* and the difficulty of rapidly identifying gene functions using traditional transgenic technology. It provides a reliable technical platform for the functional analysis of key genes related to growth and development, stress resistance regulation, and germplasm trait formation in *Triticum aestivum*, and has significant value for promoting functional genomics research in gramineous forage grasses. Attached Figure Description

[0030] Figure 1 A schematic diagram of the plasmid structure of the recombinant viral vector pTRV2-EsPDS;

[0031] Figure 2 Electrophoretic pattern for PCR identification of Agrobacterium tumefaciens EHA105 transformed with recombinant viral vector pTRV2-EsPDS;

[0032] Figure 3 Phenotypic observation of new leaves of old wheat seedlings after infection with the VIGS system; Figure 4 The graph shows the qRT-PCR detection and analysis of the silencing effect of the EsPDS gene in *Ophiopogon japonicus*. Detailed Implementation

[0033] The present invention will be further described below with reference to embodiments.

[0034] The nucleotide sequence of the specific fragment used to silence the EsPDS gene in *Evodia rutaecarpa* is shown below:

[0035] GGCTTCTACCAGCAATGCTTGGTGGCCAAGCTTACGTTGAAGCTCAAGATGGCTTAACTGTTTCAGAATGGATGGAAAAGCAGGGTGTTCCTGATCGAGTCAACGACGAGGTTTTTTGCAATGTCCAAGGCACTCAATTTCATAAACC CTGACGAGTTATCCATGCAGTGCATTCTGATTGCTCTAAACCGATTTCTCCAGGAGAAGCATGGCTCGAAAATGGCATTCTTGGATGGTAATCCTCCTGAAAGGCTATGCATGCCCATTGTTAACCACATTCAGTCTTTGGGTGGTGAGG

[0036] The specific fragment was obtained in the following manner:

[0037] 1) Obtain the full-length gene sequence of EsPDS

[0038] The protein sequence of the Arabidopsis thaliana AtPDS (AT4G14210) gene was obtained from the TAIR website (https: / / www.arabidopsis.org / ). Using the Sequence Read Archive (SRA) database on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), and employing transcriptome sequencing data from *Lysimachia christinae*, homologous genes were identified through TBLASTN alignment. The full-length cDNA sequence of the phytopenic oleoresin dehydrogenase gene EsPDS was obtained, and its nucleotide sequence is shown below:

[0039]

[0040] 2) Using the full-length gene sequence of the phytopenic lycopene dehydrogenase gene EsPDS as a template, full-length primer pairs EsPDS-F-rec and EsPDS-R-rec, with homologous arms at the 5' end, were designed to amplify a 300bp specific fragment of the CDS region of the EsPDS gene. Their sequences are as follows:

[0041] EsPDS-F-rec:

[0042] 5'-AAGGTTACCGAATTCTCTAGAGGCTTCTACCAGCAATGCTTG-3'

[0043] EsPDS-R-rec:

[0044] 5'-CGTGAGCTCGGTACCGGATCCCCTCACCACCCAAAGACTGAAT-3'

[0045] 3) Take young leaves of old wheatgrass, grind them into powder with liquid nitrogen, and extract RNA using the Eastep®super Total RNA Extraction Kit. Store at -80℃ for later use. Take the total RNA frozen at -80℃ and synthesize the first strand of cDNA according to the HiScript® II 1st StrandcDNA Synthesis Kit (Vazyme, R211-01) reverse transcription kit. Store at -20℃. Using the cDNA as a template, perform PCR amplification using primers EsPDS-F-rec and EsPDS-R-rec to obtain an EsPDS gene-specific fragment with homologous arms at both ends. The gene-specific part is 300 bp in size, and the nucleotide sequence is shown in SEQ ID NO.1.

[0046] Furthermore, the PCR amplification reaction system (20 μL) consists of: 1 μL cDNA template, 1.5 μL each of upstream and downstream primers (10 μM), 1 μL dNTP Mixture (2.5 mM each), 0.2 μL Taq DNA polymerase (5 U / μL), and ddH2O added to a final volume of 20 μL. The PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 34 cycles; and 72℃ final extension for 5 min.

[0047] This invention also discloses a method for silencing the EsPDS gene of *Ophiopogon japonicus* using the above-mentioned specific fragment, comprising the following steps:

[0048] First, the EsPDS gene-specific fragment was ligated into the XbaI and BamHI-digested vector pTRV2 using homologous recombination. The mixture was then incubated with the homologous recombinase at 50°C for 1 h in a PCR instrument. The ligation product was then heat-shocked and transformed into DH5α competent cells, plated on LB agar plates containing 50 μg / mL kanamycin, and incubated overnight at 37°C. Positive clones were then picked and expanded. Figure 1 This is a schematic diagram of the plasmid structure of the recombinant viral vector pTRV2-EsPDS. TRV1 (viral replication and motility) encodes the enzymes and proteins required for viral replication. TRV2 (target gene insertion vector) contains a 2×35S promoter, coat protein gene (CP), NOS terminator (NOSt), and multiple cloning site (MCS), which retains the XbaI and BamHI cloning sites for inserting the target gene fragment EsPDS. After extracting the plasmid pTRV2-EsPDS, colony PCR amplification was performed using the universal primers TRV-F: TTGTTACTCAAGGAAGCACGAT and TRV-R: TGTCTTACCATAGGGGA. Sequencing confirmed that the sequence was a specific fragment of EsPDS, specifically a 300bp fragment (SEQ ID NO.1) on the CDS domain of the EsPDS gene. After confirming correct sequencing, the plasmid pTRV2-EsPDS was transformed into Agrobacterium EHA105 competent cells using a freeze-thaw method. Agrobacterium strains containing the target gene fragment were obtained by plate screening with 50 μg / mL kanamycin and 50 μg / mL rifampin. Figure 2 Electrophoresis pattern for PCR identification of Agrobacterium EHA105 transformed with recombinant viral vector pTRV2-EsPDS; M in the figure is the DNA molecular weight standard (DL2000); lanes 1–5 are PCR amplification products of Agrobacterium single clones picked after transformation by freeze-thaw method; lanes 1–5 all show specific bands with the same size as the target fragment, indicating that the recombinant viral vector pTRV2-EsPDS has been successfully transformed into Agrobacterium EHA105;

[0049] Next, Agrobacterium EHA105 was transformed with pTRV1 plasmid, pTRV2 plasmid, and pTRV2-EsPDS recombinant viral vector, respectively. Freshly cultured transformant single colonies were picked and inoculated into 1 mL LB liquid medium (containing 50 μg / mL kanamycin and 50 μg / mL rifampin), and cultured at 28 ℃ and 200 r / min for 24 h. Then, the culture was transferred to 150 mL LB liquid medium (containing the same concentration of antibiotics) and cultured at 28 ℃ and 200 r / min for 12 h. The Agrobacterium EHA105 culture carrying the pTRV1 vector was mixed with the Agrobacterium EHA105 culture carrying the pTRV2 vector and the Agrobacterium EHA105 culture carrying the pTRV2-EsPDS recombinant viral vector at a 1:1 volume ratio to prepare two mixed bacterial cultures. The OD600 value of the mixed bacterial cultures was measured, and the cultures were diluted with fresh LB medium to an OD600 value of 0.8–1.5, then 400 μL of fresh LB medium was added. mg / L cysteine, 0.5% (v / v) Tween-20 and 150 μmol / L acetylsyringone were used to infect germinating seeds of *Triticum aestivum* at room temperature in the dark for 1 h. Germinating seeds of *Triticum aestivum* were then subjected to vacuum permeation treatment for 1.5 h, ultrasonic treatment for 5 min, and then soaked in a shaker at 80 rpm for 1 h. Subsequently, the seeds were transferred to quartz sand and cultured under conditions of 20–25 ℃ and a photoperiod of 14 h light / 10 h dark.

[0050] Three weeks after sowing, phenotypic changes in newly emerged leaves were observed. When the leaves exhibited an albino phenotype, the leaves were harvested, and total RNA was extracted using an RNA extraction kit. Actin was used as an internal reference gene, and the expression level of the silenced target gene was detected by qRT-PCR. The primers used were: EsPDS-RT-F, EsPDS-RT-R; the internal reference gene primers were: Actin-RT-F, Actin-RT-R; the primer sequences are as follows:

[0051] EsPDS-RT-F:CTGGAGCGAAGCAAGTAA

[0052] EsPDS-RT-R: GCAATCACGACCTGTAATG

[0053] Actin-RT-F: CCACGAGACGACCTACAATTCCATC

[0054] Actin-RT-R: CTCCGATCCAGACACTGTACTTCCT

[0055] The results of measuring the expression level of the EsPDS gene in the leaves of old wheat showed that, compared with the control CK, the expression level of the EsPDS gene in the leaves of old wheat infected with Agrobacterium carrying the pTRV2-EsPDS recombinant viral vector was significantly reduced.

[0056] Figure 3 Phenotypic observation of new leaves of old wheat seedlings after infection with the VIGS system; Figure 3 This study compares the phenotypic results of different treatments on *Triticum aestivum* plants under constant quartz sand culture conditions. The control group (CK) consisted of wild-type *Triticum aestivum* plants uninfected by any virus, while the experimental group consisted of *Triticum aestivum* plants infected with the pTRV2-EsPDS recombinant viral vector. All plants were cultured under the same environment and for the same duration to eliminate environmental interference and ensure that phenotypic differences were caused by vector infection. In the CK group, wild-type *Triticum aestivum* plants exhibited uniform and healthy green leaves, including new leaves, without chlorosis or whitening. This indicates that, without recombinant virus-mediated gene silencing, the endogenous EsPDS gene in *Triticum aestivum* can be transcribed and expressed normally, and the plant's carotenoid and chlorophyll synthesis pathways are intact, indicating normal photosynthetic system development. In the experimental group infected with the pTRV2-EsPDS recombinant viral vector, new leaves showed a stable and reproducible specific whitening phenotype, while mature leaves maintained a normal green color with only slight chlorosis. This phenotypic characteristic highly matches the plant infection characteristics of TRV virus and the mechanism of VIGS action, proving that the recombinant virus can successfully infect mature wheat plants, preferentially accumulating and proliferating in new leaves and meristems, activating the plant's endogenous RNA interference pathway, specifically inhibiting the normal function of the EsPDS gene, blocking the plant's photosynthetic pigment synthesis and metabolism, and ultimately forming the characteristic albino phenotype of gene silencing. It also indicates that the silencing system of this invention has significant targeting specificity to new plant tissues. This visualized phenotypic characteristic directly confirms that the VIGS silencing system established in this invention can stably exert its effect in mature wheat, possessing good efficacy and reproducibility.

[0057] Figure 4 A graph showing the qRT-PCR detection and analysis of the silencing effect of the EsPDS gene in *Ophiopogon japonicus*. Figure 4The control group (CK) was *Triticum aestivum* infected with the empty vector pTRV2; the experimental group (EsPDS) was *Triticum aestivum* infected with the recombinant viral vector pTRV2-EsPDS. The vertical axis represents the relative expression level of the EsPDS gene. Compared with the CK group, the EsPDS gene expression level in the EsPDS group was significantly reduced. This experiment included a differential control system. The CK group consisted of *Triticum aestivum* plants infected with the empty pTRV2 vector, used to exclude the influence of non-specific factors such as the viral vector backbone, *Agrobacterium* infection operation, and culture treatment on the endogenous gene expression of *Triticum aestivum*, serving as a baseline reference for normal EsPDS gene expression. The experimental group consisted of *Triticum aestivum* plants infected with the pTRV2-EsPDS recombinant viral vector, with the relative expression level of the EsPDS gene as the detection index, used to evaluate the gene silencing effect of the recombinant vector. qRT-PCR results showed that the EsPDS gene transcriptional expression level in the CK group plants was stable, with the relative expression level remaining within the normal baseline range. This demonstrates that infection with the pTRV2 empty vector alone cannot trigger a plant-specific RNA interference response and does not interfere with the basal transcriptional expression of the EsPDS gene in *Leymus chinensis*. The control settings in this experiment were scientifically rigorous, and the experimental data were reliable and free from systematic errors. Compared to the CK group, the relative expression level of the endogenous EsPDS gene in the experimental group infected with the pTRV2-EsPDS recombinant vector was significantly reduced, the transcription process of the target gene was significantly inhibited, and the transcript abundance was significantly downregulated. qRT-PCR molecular detection results quantitatively confirmed at the transcriptional level that the TRV-VIGS silencing system constructed in this invention can efficiently and specifically silence the endogenous EsPDS gene in *Leymus chinensis*, significantly inhibiting the transcriptional expression of the target gene, with stable silencing effects and good reproducibility.

Claims

1. A specific fragment for silencing the EsPDS gene in *Oryza sativa*, characterized in that: The nucleotide sequence of the specific fragment is shown in SEQ ID NO.

1.

2. The specific fragment for silencing the EsPDS gene in *Eosinopterygium wilfordii* as described in claim 1, characterized in that: The specific fragment was obtained in the following manner: 1) Obtain the full-length gene sequence of EsPDS First, the protein sequence of the Arabidopsis thaliana AtPDS (AT4G14210) gene was obtained. Then, using the transcriptome sequencing data of *Lysimachia christinae* from the Sequence Read Archive (SRA) database, homologous genes of *Lysimachia christinae* were searched by TBLASTN alignment to obtain the full-length cDNA sequence of the phytoene dehydrogenase gene EsPDS, whose nucleotide sequence is shown in SEQ ID NO.

2. 2) Using the full-length gene sequence of the phytopenic lycopene dehydrogenase gene EsPDS as a template, primers EsPDS-F and EsPDS-R were designed to amplify a 300bp specific fragment on the CDS domain of the EsPDS gene; their nucleotide sequences are as follows: EsPDS-F: 5'-GGCTTCTACCAGCAATGCTTG-3' EsPDS-R: 5'-CCTCACCACCCAAAGACTGAAT-3' Vectors were constructed using homologous recombination. Sequences homologous to the XbaI and BamHI restriction sites of the pTRV2 vector were introduced into the 5' ends of the gene-specific primers EsPDS-F and EsPDS-R, respectively, to obtain the full-length amplification primers EsPDS-F-rec and EsPDS-R-rec, with the following sequences: EsPDS-F-rec: 5'-AAGGTTACCGAATTCTCTAGAGGCTTCTACCAGCAATGCTTG-3' EsPDS-R-rec: 5'-CGTGAGCTCGGTACCGGATCCCCTCACCACCCAAAGACTGAAT-3' 3) Take young leaves of old wheatgrass, grind them into powder with liquid nitrogen, extract RNA using the Eastep®super total RNA extraction kit, synthesize the first strand of cDNA according to the HiScript® II 1st Strand cDNA Synthesis Kit (Vazyme, R211-01) reverse transcription kit, and store at -20℃; use the cDNA as a template to perform PCR amplification of EsPDS-F-rec and EsPDS-R-rec using primers to obtain the EsPDS gene-specific fragment with homologous arms at both ends. The size of the gene-specific part is 300bp, and the nucleotide sequence is shown in SEQ ID NO.

1.

3. The specific fragment for silencing the EsPDS gene in *Eosinopterygium wilfordii* as described in claim 2, characterized in that: The PCR amplification reaction system (20 μL) consisted of: 1 μL cDNA template, 1.5 μL each of upstream and downstream primers (10 μM), 1 μL dNTP Mixture (2.5 mM each), 0.2 μL Taq DNA polymerase (5 U / μL), and ddH2O added to a final volume of 20 μL.

4. The specific fragment for silencing the EsPDS gene in *Eosinopterygium wilfordii* as described in claim 2, characterized in that: The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 34 cycles; 72℃ final extension for 5 min.

5. The method for silencing the EsPDS gene of *Ophiopogon japonicus* using the specific fragment described in claim 1, characterized in that: Includes the following steps: A. Construction of recombinant viral vector pTRV2-EsPDS: The EsPDS gene-specific fragment was ligated into the VIGS viral backbone vector pTRV2 using homologous recombination technology to construct the recombinant viral vector pTRV2-EsPDS. B. Agrobacterium transformation and positive identification: The recombinant viral vector pTRV2-EsPDS was transformed into Agrobacterium EHA105 competent cells by freeze-thaw method. The cells were then plated on LB plates containing 50 μg / mL kanamycin and 50 μg / mL rifampin for resistance selection. After obtaining positive clones, positive identification was performed by PCR amplification. C. Preparation of mixed bacterial suspension: Agrobacterium suspension containing pTRV2-EsPDS identified as positive in step B and Agrobacterium suspension containing pTRV1 helper plasmid were mixed at a volume ratio of 1:1 and diluted with fresh LB medium to an OD600 value of 0.8-1.5 to obtain a mixed bacterial suspension; then, cysteine, Tween-20 and acetylsuccinone were added to the mixed bacterial suspension in sequence to make the final concentrations of each component in the mixed bacterial suspension reach 400 mg / L cysteine, 0.5% (v / v) Tween-20 and 150 μmol / L, respectively. The mixture was allowed to stand for 1 h at room temperature in the dark to obtain a mixed bacterial suspension for infection. D. Vacuum permeation treatment: Take newly germinated seeds of old wheat and place them in the mixed bacterial solution for infection obtained in step C. Vacuum permeation treatment for 1.5 h and ultrasonic treatment for 5 min. E. Ultrasonic treatment: The old wheat seeds after vacuum permeation treatment in D, together with the mixed bacterial solution in D, are subjected to ultrasonic treatment. The ultrasonic frequency is 40KHz, the power is 120W, the vibration interval is 5s, and the total ultrasonic time is 5min. F. Co-culture incubation: Take out the old wheat seeds after ultrasonic treatment in step E, place them in freshly prepared mixed bacterial solution, and culture them at a constant temperature with shaking. Incubate them at a low speed at 20℃-25℃ with a shaking frequency of 80 rpm for 1 hour. G. Cultivation and Detection: The seeds of *Eriocheir sinensis* after incubation in step E were transferred to quartz sand and placed in an incubator. The cultivation conditions were 20℃-25℃ and light / dark conditions of 14h / 10h. The phenotypic changes of the newly grown leaves of *Eriocheir sinensis* were observed, and the expression of EsPDS in the leaves was detected. Thus, the *Eriocheir sinensis* EsPDS gene sequence silencing system was constructed.

Images