Application of tobacco NtPIP1-2 gene in improving plant waterlogging tolerance and low temperature tolerance

Abstract

This invention provides tobacco NtPIP1-2 This invention relates to the application of genes in improving the waterlogging and low-temperature tolerance of plants, and belongs to the field of genetic engineering technology. The tobacco mentioned... NtPIP1-2 The CDS sequence of the gene is shown in SEQ ID NO.2. This invention, through flooding and low-temperature stress experiments, discovered that the transgenic... NtPIP1-2 Rapeseed plants overexpressing the tobacco gene maintained higher leaf, stem, and root biomass compared to wild-type rapeseed, while also reducing the accumulation of reactive oxygen species in root tips under flooding and low-temperature stress, thus alleviating cell damage. This indicates that the overexpression of the tobacco gene... NtPIP1-2 Genes can significantly improve a plant's tolerance to waterlogging and low temperatures, making them excellent genes for genetic engineering breeding of plants with waterlogging and low temperature tolerance.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more particularly to tobacco. NtPIP1-2 Application of genes in improving plant waterlogging and low-temperature tolerance. Background Technology

[0002] rape( Brassica napus Rapeseed (L. cv. Westar), a crucial oilseed crop belonging to the Brassicaceae family, is a core raw material crop in my country's edible oil supply system. Rapeseed is not only an important research material for oilseed genetics and breeding, and gene function exploration, but its complete cultivation industry chain is also a vital pillar for increasing farmers' income and wealth in producing areas. Rapeseed has a shallow root system and low aerenchyma development, making it sensitive to adverse environments such as rhizosphere hypoxia and low temperature. Its tolerance to waterlogging and cold is relatively weak; therefore, flooding and low-temperature stress have become key abiotic stress factors restricting stable and increased rapeseed yields in fields.

[0003] Against the backdrop of abnormal global climate change, regional heavy rainfall, short-term waterlogging, and periodic low-temperature disasters are occurring frequently, exacerbating the risks of waterlogging and chilling damage in major rapeseed producing areas. Furthermore, the heavy clay soils and poor drainage conditions in some areas further amplify the negative impact of abiotic stress on rapeseed growth. During waterlogging, soil pores are filled with water, leading to insufficient oxygen supply to the roots, hindering aerobic respiration, and inducing and activating anaerobic respiration. This results in the accumulation of toxic metabolites such as ethanol, causing oxidative damage, rot, and necrosis of the roots, followed by leaf yellowing and wilting, decreased biomass, and other harmful phenotypes. In severe cases, it can directly lead to plant death and significant yield loss. Low-temperature stress damages cell membrane structure, inhibits photosynthetic metabolism, and hinders normal growth and development of rapeseed. In comparison, tobacco (… Nicotiana tabacum L.) possesses strong tolerance to waterlogging stress and is an excellent material for discovering waterlogging-resistant genes.

[0004] The PIP family of plasma membrane aquaporins is the largest subfamily of aquaporins in plants. Located on the plasma membrane, they are primarily responsible for the transmembrane transport of small molecules such as water, CO2, and H2O2, playing a central role in plant water balance, growth and development, and stress response. Family members are divided into two subclasses, PIP1 and PIP2, based on sequence characteristics. Current research indicates that aquaporins exhibit diverse functions and significant interspecies differences, demonstrating the high complexity of their functional differentiation. (Ben Linli, Liu Xin, Yao Youli. Research progress on the regulation of plant stress response by the PIP family of aquaporins [J]. Jiangsu Agricultural Sciences, 2024, 52(21):1-9. DOI:10.15889 / j.issn.1002-1302.2024.21.001.). Studies have shown that... NtPIP1;3 It is a promising oxygen transporter protein, and NtPIP1;2The lack of promotion of oxygen transport indicates that aquaporin orthologs have developed a certain degree of oxygen transport specificity (Yeast and Tobacco Models Reveal the Efficient Oxygen Transport Capacity of Aquaporins (Part 3) - Shanghai Weizai Technology Co., Ltd.). However, different plant sources... PIP1;2 Functions also differ, and the above studies also indicate NtPIP1-2 Genes influence hydrogen peroxide transport; however, another paper, *Sugarcane mosaic virus employs 6K2 protein to impair ScPIP2;4 transport of H2O2 to facilitate virus infection*, reveals that PIPs are involved in the regulation of hydrogen peroxide in sugarcane after viral infection. This paper validated eight PIP genes (i.e., ScPIP1;1 , ScPIP1;2 , ScPIP1;5 , ScPIP2;1 , ScPIP2;4 , ScPIP2;5 , ScPIP2;6 ,as well as ScPIP2;7 Whether it has hydrogen peroxide transport capacity, the results showed that only two PIP2s ( ScPIP2;1 and ScPIP2;4 It has been verified that it has the ability to transport H2O2, while ScPIP1;2 It lacks the ability to transport H2O2 (Yeast and Tobacco Models Reveal the Efficient Oxygen Transport Capacity of Aquaporins (Part 3) - Shanghai Weizai Technology Co., Ltd.). This implies that the function of the PIP gene varies significantly among different plant sources.

[0005] Systematic research on the response characteristics of rapeseed to flooding and low temperature stress, screening and cloning flood-resistant genes and clarifying their mechanisms of action can not only improve the molecular theory of rapeseed stress resistance, but also provide key technical support for the breeding of new rapeseed varieties that are flood-resistant and cold-resistant. This has important practical significance for promoting the upgrading of stress-resistant cultivation in the rapeseed industry. Summary of the Invention

[0006] The purpose of this invention is to discover tobacco genes to improve the plant's resistance to waterlogging and low temperatures.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides tobacco NtPIP1-2 The application of genes in improving the waterlogging and low-temperature tolerance of plants, specifically in tobacco. NtPIP1-2 The CDS sequence of the gene is shown in SEQ ID NO.2.

[0008] Preferably, the plants include rapeseed and tobacco.

[0009] The present invention also provides a method for utilizing tobacco NtPIP1-2 A method for improving the waterlogging and low-temperature tolerance of plants using genes, specifically the tobacco... NtPIP1-2 Genes were introduced into the target plant for overexpression.

[0010] Preferably, the target plant includes rapeseed and tobacco.

[0011] This invention, through flooding and low-temperature stress tests, discovered that... NtPIP1-2 Compared to wild-type rapeseed, the transgenic rapeseed plants maintained higher leaf, stem, and root biomass. NBT and DAB staining results showed lower levels of reactive oxygen species accumulation in the transgenic plants, and Evans blue staining confirmed less damage to root tip cells, indicating that the transgenic plants overexpressing the tobacco gene... NtPIP1-2 The gene can significantly improve the plant's tolerance to waterlogging and low temperatures, making it an excellent gene for genetic engineering breeding of rapeseed to improve waterlogging and low temperature tolerance. Attached Figure Description

[0012] Figure 1 Among wild-type rapeseed and transgenic rapeseed OE1~OE4 plants NtPIP1-2 The expression level detection results; Figure 2 Figure 1 shows the root dry weight of transgenic rapeseed and wild-type rapeseed after one week of waterlogging stress and one week of low temperature stress. Figure 3 Figure 1 shows the stem weight of transgenic rapeseed and wild-type rapeseed after one week of waterlogging stress and one week of low temperature stress. Figure 4 Figure 1 shows the leaf dry weight of transgenic rapeseed and wild-type rapeseed after one week of waterlogging stress and one week of low temperature stress. Figure 5 The image shows the DAB staining results of transgenic rapeseed and wild-type rapeseed after one week of waterlogging stress and one week of low temperature stress. Figure 6 The image shows the NBT staining results of transgenic rapeseed and wild-type rapeseed after one week of waterlogging stress and one week of low temperature stress.

[0013] Figure 7 Evans blue staining results of transgenic rapeseed and wild-type rapeseed after one week of waterlogging stress and one week of low temperature stress.

[0014] Figure 8 A schematic diagram illustrating the mechanism by which overexpression of NtPIP1-2 enhances the tolerance of transgenic rapeseed to flooding and low-temperature stress. Detailed Implementation

[0015] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0016] Example 1

[0017] tobacco NtPIP1-2 The gene sequence and CDS sequence are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0018]

[0019] SEQ ID NO.2: ATGGAGGGGAAAGAAGAGGATGTGAAGGTAGGAGCAAACAAGTATTCAGAAAGGCAGCCATTAGGGACCTCAGCACAGAGCAAAGACTATAAGGAACCACCACCAGCACCATTGTTTGAGCCTGGTGAGCTCCATTCTTGGTCCTTTTGGAGAGCTGGGATTGCTGAATTTATGGCTACTTTCTTGTTCCCTTACATCACTGTCTTGACTGTCATGGGTTACTCTAGGGCTAACAGCAAATGTAGTACTGTTGGTGTTCCAAGGTATTGCTTGGGCTTTTGGTGGTATGATTTTTGCCCTTGTGTACTGTACTGCTGGTATCTCAGGTGGACACATTAACCCTGCTGTGACATTTGGTTTGTTTCTGGCAAGAAAATTGTCCCTAACAAGGGCAGTGTTCTACATTGTGATGCAATGCCTTGGTGCAATCTGTGGTGCTGGTGTTGTCAAAGGGTTCCAGCCATCTTTGTATCAGGTTAAGGGTGGAGGTGCCAATGTTGTGAATCATGGTTATACCAAAGGAGATGGCCTTGGGTGCTGAGATTGTTGGCACTTTTGTTCTTGTCTATACAGTCTTCTCTGCTACTGATGCCAAGAGAAATGCTAGAGACTCCCATGTCCCTATTTTGGCACCTCTCCCAATTGGATTTGCAGTGTTCTTAGTTCACTTAGCCACTATCCCAATCACAGGCACAGGCATTAATCCTGCTAGAAGCCTAGGTGCTGCCATTATCTACAACAGAGATCAAGCATGGGATGACCATTGGATTTTCTGGGTGGGACCATTCGTTGGAGCTGCACTTGCTGCCTTGTACCACCAGGTTATCATAAGAGCCATTCCATTCAAGAGTGGAAACTTGGCTTAATTAA.

[0020] 1. Construct a plant overexpression vector containing tobacco NtPIP1-2 gene and transform Agrobacterium

[0021] 1.1 Primer Design

[0022] NtPIP1-2-F (SEQ ID NO.3): AGAAGCTAAGAATGGAGGGGA; NtPIP1-2-R (SEQ ID NO.4): TTACAGAAACCAAGGCATAGC; NptII-F (SEQ ID NO.5): GAGGCTATTCGGCTATGACTGG; NptII-R (SEQ ID NO. 6): ATCGGGAGCGGCGATACCGTA.

[0023] 1.2 Amplification and Recovery of Target Fragment

[0024] Using the primer pairs described in SEQ ID NO.3 and SEQ ID NO.4 NtPIP1-2 The gene was amplified by PCR. The PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0025] Table 1 PCR reaction system

[0026] Table 2 PCR reaction conditions

[0027] 1.3 Rubber Cutting and Recycling

[0028] The PCR products were detected by agarose gel electrophoresis. The correct electrophoretic fragments were excised and the target fragments were recovered using the agarose gel DNA recovery kit (DP209-03) from Tiangen Biotech Co., Ltd. The kit was operated according to the instructions. The enzyme digestion and ligation reaction system used is shown in Table 3, and the reaction conditions are shown in Table 4.

[0029] Table 3 Enzyme digestion-ligation reaction

[0030] Table 4 Enzyme digestion-ligation reaction parameters

[0031] 1.4 Transformation of Recombinant Plasmids

[0032] (1) Take a tube of 100 μL of DH5α Escherichia coli competent cells and mix it with 4 μL of ligation product, and incubate on ice for 30 min; (2) Quickly place it in a 42 ℃ constant temperature water bath, heat shock for 90 s, then ice bath for 2 min; (3) Add 500 μL of LB liquid culture medium and mix well; (4) Incubate at 37 ℃ and 200 rpm for 45 min to allow the cells to return to normal growth. (5) Spread the bacterial culture evenly on Kana-resistant LB solid medium plates; (6) After 30 min, place in a 37℃ constant temperature incubator and incubate overnight.

[0033] 1.5 Bacterial Detection

[0034] Colony PCR was performed using NptII-F / NptII-R primers. Positive colonies were picked and cultured. The colony PCR detection system is shown in Table 5, and the colony PCR reaction conditions are shown in Table 6.

[0035] Table 5 Colony PCR Amplification System

[0036] Table 6 Colony PCR Reaction Conditions

[0037] 1.6 Plasmid Extraction

[0038] (1) Pick single clones from LB solid medium plates and inoculate them into LB liquid medium with a final concentration of 50 μg / mL for kanamycin resistance, and incubate overnight at 37 °C; (2) Take 4 mL of activated bacterial solution, centrifuge at 10000 rpm for 2 min at room temperature, and completely discard the supernatant; (3) Take 250 μL of Solution I reagent containing ribonuclease A and thoroughly resuspend the bacterial block; (4) Take 250 μL of Solution II reagent to lyse the bacterial block, and gently invert it several times until the bacterial cells become transparent; (5) Take 350 μL of Solution III reagent, invert it several times until a white, firm flocculent substance is formed; (6) Centrifuge at 12,000 rpm for 10 min at room temperature and collect the supernatant; (7) Remove the nucleic acid purification column from the kit and place it on the collection tube; (8) Take the clear supernatant from step (6) above into the nucleic acid purification column, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate; (9) Add 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30s at room temperature, and discard the filtrate; (10) Add 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate; (11) Repeat the above operation steps (10); (12) Place the nucleic acid purification column on the collection tube and incubate at 12,000 rpm for 2 min at room temperature to remove as much residual liquid as possible; (13) Discard the collection tube, place the nucleic acid purification column into a 1.5 mL EP tube, and add 50 μL of elution buffer to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer should be preheated in a 65 ℃ constant temperature water bath to help elute the DNA), and let stand at room temperature for 2 min; (14) Centrifuge at 12,000 rpm for 2 min at room temperature to wash off the DNA attached to the nucleic acid purification column membrane, and store at -40 ℃ for later use; (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the plasmid extraction quality.

[0039] 1.7 Sequencing

[0040] The plasmid extracted from the above positive bacterial plaques was subjected to Sanger sequencing. Sequencing with the NptII specific primer showed that the sequence aligned with the target fragment, indicating successful construction of the overexpression vector. The pBRACT114-35S-K-NtPIP1-2 vector was thus constructed.

[0041] 1.8 Transformation of Agrobacterium

[0042] The constructed pBRACT114-35S-K-NtPIP1-2 vector was transformed into Agrobacterium tumefaciens GV3101 competent cells by heat shock, and the resulting strain was used for genetic transformation of rapeseed.

[0043] 2. Genetic transformation of rapeseed

[0044] Using the aboveground parts of 5-day-old rapeseed (Brassica napus L. cv Westar) seedlings with uniform growth as recipient material, stable genetic transformation was carried out using an Agrobacterium-mediated in situ callus induction and regeneration system. The specific operation procedure is as follows: 50 μL of bacterial suspension was inoculated into 20 mL of LB liquid medium, and the medium was shaken at 28 ℃ and 180 rpm for 12 h until the bacterial suspension showed OD. 600At approximately 0.4, 2 mL of bacterial suspension was centrifuged at 6000 rpm for 3 min to collect bacterial cells. The bacterial precipitate was washed twice with liquid infection medium (LIM, 4.4 g / L MS, 30 g / L sucrose, 200 μM acetylsylgenone), resuspended, and stored at 4 °C for later use. The germinated rapeseed hypocotyls were cut into 1 cm segments and placed in sterile culture dishes containing 18 mL of LIM. 2 mL of Agrobacterium resuspension was added for 10 min of infection. After discarding excess bacterial suspension, the explants were evenly placed on MS co-culture medium (pH 5.8) containing 0.1 mg / L NAA, 2 mg / L BAP, and 0.5 mg / L AgNO3 and co-cultured for 24 h. After co-culture, the explants were subjected to sterilization treatment three times with 1 / 2 MS liquid medium containing 500 mg / L Amp for 8 min each time, and rinsed three times with sterile water to thoroughly remove residual Agrobacterium. The sterilized explants were then transferred to medium supplemented with 0.1 mg / L... In MS callus induction selection medium (pH 5.8) containing NAA, 2 mg / L BAP, 0.5 mg / L silver nitrate, 500 mg / L Amp, and 50 mg / L Kan, the callus was cultured continuously for 8 weeks under 25 ℃ light conditions and subcultured monthly. After the callus growth stabilized, the hypocotyl tips of the surviving callus with good growth were transferred to MS root regeneration selection medium (pH 5.8) containing 2 mg / L BAP, 0.5 mg / L AgNO3, 500 mg / L Carb, and 50 mg / L Kan for further differentiation and regeneration culture.

[0045] The regenerated T0 generation rapeseed plants were cultivated normally. After the plants produced mature pods, the T0 generation seeds were harvested, dried, and stored in the dark. The seeds were disinfected with 5% sodium hypochlorite for 5 minutes, rinsed 5 times with sterile water, and then sown in 1 / 2 MS medium containing kanamycin resistance to screen for positive plants. The selected positive seedlings were transplanted into nutrient soil for cultivation, and T1 and T2 generation seeds were harvested sequentially. Finally, the homozygous transgenic T2 generation line seeds were obtained through screening.

[0046] 3. Obtaining rapeseed plants

[0047] The obtained T2 generation Brassica napus seeds were placed in 1.5 mL centrifuge tubes, surface-sterilized, and then sown on 1 / 2 MS medium for germination. Germinated seedlings were transplanted into a sterilized peat moss / vermiculite (2:1) substrate and placed under a 16-h photoperiod, day / night temperature of 22 ℃ / 18 ℃, and a photosynthetic photon flux density of 400 μmol·m⁻¹. -2 ·s -1The plants were cultivated in a greenhouse with a relative humidity of 50-60%, watered every 2 days, and 50% modified Hoagland nutrient solution was applied weekly. Once the plants reached the seedling stage, each rapeseed plant was labeled with its serial number, and the first pair of true leaves were collected to extract genomic DNA, allowing for the selection of transgenic lines. qRT-PCR was used to detect the homozygous T2 generation transgenic lines, analyzing the transcript abundance of NtPIP1-2 in each line, and two high-expression lines were selected for subsequent experimental analysis.

[0048] The DNA extraction method used was the CTAB method, with the following steps: ① Take 2-3 fresh rapeseed leaves and quickly place them into 2 mL centrifuge tubes containing steel balls that have been frozen in liquid nitrogen. After thorough grinding with a ball mill, add preheated (65 ℃) mixture (1 mL CTAB and 200 μL β-mercaptoethanol) to each tube. Incubate at 65 ℃ for 45 min, inverting the tube every 5 min to mix. Centrifuge at 12000 rpm for 10 min. ② Collect the supernatant, add an equal volume of chloroform, mix well, let stand for 12 min, and centrifuge at 12000 rpm for 10 min. ③ Repeat step ②, collect the supernatant, add 2 volumes of anhydrous ethanol, mix well, and incubate at -20 ℃ for 45 min to precipitate. The white solid at the bottom of the centrifuge tube is the genomic DNA precipitate. Centrifuge at 12000 rpm for 10 min and discard the supernatant. ④ Wash the DNA precipitate three times with 1 mL of 75% ethanol, centrifuge at 12000 rpm for 5 min, discard the supernatant, and air-dry the precipitate at room temperature until it becomes translucent. ⑤ Dissolve the precipitate in 40 μL of ddH2O, then add 0.5 μL of RNase and incubate at room temperature for 30 min. ⑥ Perform agarose gel electrophoresis, observe the bands, detect genomic DNA, and store the DNA at -20 ℃ for later use.

[0049] NptII specific primers were used for PCR detection. The detection system is shown in Table 7, and the detection procedure is shown in Table 8.

[0050] Table 7 PCR Detection System

[0051] Table 8 PCR Detection Procedure

[0052] The primers used for qRT-PCR detection are: F: CAGCCATTAGGGACCTCAGC (SEQ ID NO.7); R: CAGCAATCCCCAGCTCTCCAA (SEQ ID NO. 8).

[0053] The primers for the internal reference gene are: F: TGGTGTGCGATAAGTGTGAGA (SEQ ID NO.9); R: GGTGTCCATCTGTTCTTCTTGG (SEQ ID NO. 10).

[0054] RNA was first extracted using the EZNA® PlantRNA Kit for omega plant RNA extraction, and then reverse transcribed into cDNA using the Novizan kit before qRT-PCR detection. The detection system and procedure are shown in Tables 9-10.

[0055] Table 9 qRT-PCR detection system

[0056] Table 10 qRT-PCR Detection Procedure

[0057] qRT-PCR test results are as follows Figure 1 As shown, compared with wild-type rapeseed, plants overexpressing OE1, OE2, OE3, and OE4 showed higher levels of... NtPIP1-2 Gene expression levels were increased in all strains; the OE2 strain showed the highest expression level, followed by the OE1 strain.

[0058] Example 2

[0059] Using transgenic rapeseed (OE1, OE2) and wild-type (WT) rapeseed seedlings as experimental materials, rapeseed plants with uniform growth were selected and subjected to normal treatment, one week of waterlogging stress, and one week of low-temperature stress, respectively. The water level was set to the boundary between the rapeseed seedlings and the soil surface, and the low-temperature treatment was set at 10 ℃. Samples were taken from the control group (Control), the one-week waterlogging group (Waterlogging, WL), and the one-week low-temperature stress group (Low Temperature, LT). 0.1 g of sample was taken from each 2 mL centrifuge tube. Photos were taken and observed daily. The experiment was repeated three times, with six plants measured in each replicate. Relevant growth and physiological indicators were measured. Figure 8 For overexpression NtPIP1-2 A schematic diagram illustrating the mechanism by which genetically modified rapeseed enhances its tolerance to flooding and low-temperature stress.

[0060] 1. Root dry weight

[0061] like Figure 2 As shown, there was no significant difference in root dry weight between the control group (OE1, OE2) and wild-type (WT) rapeseed. After one week of flooding stress and one week of low-temperature stress, the root dry weight of wild-type plants decreased significantly; however, the decrease in root dry weight of transgenic plants was smaller, and their root dry weight was significantly higher than that of wild-type plants at the same time point. This indicates that overexpression... NtPIP1-2 Genes can alleviate the inhibition of rapeseed root growth by flooding and low temperature stress, maintain root biomass, and thus improve the plant's resistance to waterlogging and cold.

[0062] 2. Stem weight

[0063] like Figure 3 As shown, there was no significant difference in stem weight between the transgenic rapeseed (OE1, OE2) and wild-type (WT) rapeseed in the control group. After one week of flooding stress and one week of low-temperature stress, the stem weight of wild-type plants decreased significantly; while the stem weight of transgenic plants decreased less, showing no significant difference compared to the control group, and their stem weight was significantly higher than that of wild-type plants at the same stage. This indicates that overexpression... NtPIP1-2 The gene can alleviate the inhibition of aboveground growth of rapeseed by flooding and low temperature stress, maintain the accumulation of stem biomass, and thus improve the plant's resistance to waterlogging and cold.

[0064] 3. Dry weight of leaves

[0065] like Figure 4 As shown, there was no significant difference in leaf dry weight between the control group transgenic rapeseed (OE1, OE2) and wild-type (WT) rapeseed. After one week of flooding stress and one week of low-temperature stress, the leaf dry weight of wild-type plants decreased significantly, while the decrease in leaf dry weight of transgenic plants was smaller, and their leaf dry weight was significantly higher than that of wild-type plants at the same time point. This indicates that overexpression... NtPIP1-2 Genes can alleviate the inhibition of leaf growth caused by flooding and low temperature stress, maintain leaf biomass accumulation, and thus enhance the plant's resistance to waterlogging and cold.

[0066] 4. DAB staining

[0067] like Figure 5 As shown, there was no significant difference in DAB staining of root tips between the control group transgenic rapeseed (OE1, OE2) and wild-type (WT) rapeseed. After one week of flooding stress and one week of low-temperature stress treatment, the staining of root tips of both wild-type and transgenic rapeseed deepened, with the staining of wild-type plants being significantly deeper than that of transgenic plants. This indicates that overexpression... NtPIP1-2 The gene can reduce the accumulation of H2O2 in the plant under flooding and low temperature stress, reduce oxidative damage, and thus improve the plant's resistance to waterlogging and cold.

[0068] 5. NBT staining

[0069] like Figure 6 As shown, there was no significant difference in NBT staining of root tips between the control group (OE1, OE2) and wild-type (WT) rapeseed. After one week of flooding stress and one week of low-temperature stress treatment, the staining of root tips of both wild-type and transgenic rapeseed deepened, with the staining of wild-type plants being significantly deeper than that of transgenic plants. This indicates that overexpression... NtPIP1-2The gene can reduce the accumulation of superoxide anions in plants under flooding and low temperature stress, alleviate oxidative damage, and thus improve the plant's resistance to waterlogging and cold.

[0070] 6. Evans blue staining

[0071] like Figure 7 As shown, there was no significant difference in Evans blue staining of root tips between the control group (OE1, OE2) and wild-type (WT) rapeseed. After one week of flooding stress and one week of low-temperature stress, the blue staining of root tips in both wild-type and transgenic rapeseed deepened, with the staining of wild-type plants being significantly deeper than that of transgenic plants. This indicates that overexpression... NtPIP1-2 Genes can mitigate root tip cell damage caused by flooding and low temperature stress, maintain root tip cell vitality, and thus enhance the plant's resistance to waterlogging and cold.

[0072] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Tobacco NtPIP1-2 The application of genes in improving plant waterlogging and cold tolerance is characterized by, The tobacco NtPIP1-2 The CDS sequence of the gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The plants mentioned include rapeseed and tobacco.

3. A method utilizing tobacco NtPIP1-2 A method for improving plant waterlogging and cold-temperature tolerance through gene therapy, characterized in that, The tobacco NtPIP1-2 Genes were introduced into the target plant for overexpression.

4. The method according to claim 3, characterized in that, The target plants include rapeseed and tobacco.

Images