Application of honeysuckle transcription factor LjMYB44 gene

Abstract

The application discloses application of a honeysuckle transcription factor LjMYB44 gene and belongs to the technical field of plant molecular biology and genetic engineering. The application inhibits the expression of the LjMYB44 gene in honeysuckle through VIGS technology, significantly improves the content of 3,5-di-O-coffea quinic acid in the honeysuckle, and simultaneously up-regulates the expression levels of key enzyme genes PAL, 4CL and HCT of 3,5-di-O-coffea quinic acid synthesis, and the nucleotide sequence of the LjMYB44 gene is shown as SEQ ID NO. 1. The application also provides a specific operation method based on the VIGS technology, a screening method taking the expression level of the LjMYB44 gene as a molecular marker and related detection primer pairs. The application provides key gene resources and molecular breeding tools for quality improvement of the honeysuckle, and has important values for cultivating new varieties of the honeysuckle with high 3,5-di-O-coffea quinic acid content and improving the quality of medicinal materials.

Description

Technical Field

[0001] This invention relates to the fields of plant molecular biology and genetic engineering, specifically to the application of the honeysuckle transcription factor LjMYB44 gene. Background Technology

[0002] Honeysuckle (Lonicera japonica Thunb.) is a perennial, semi-evergreen woody vine belonging to the genus Lonicera in the family Caprifoliaceae. Its dried flower buds or newly opened flowers are a major traditional Chinese medicinal material, widely used in clinical prescriptions and prepared Chinese medicines for their heat-clearing, detoxifying, and wind-heat-dispersing effects. 3,5-Di-O-caffeoylquinic acid is one of the main phenolic acid active components in honeysuckle and a key indicator for quality control of the medicinal material. Studies have shown that 3,5-Di-O-caffeoylquinic acid possesses various pharmacological activities, including anti-inflammatory, antioxidant, antiviral, and antibacterial effects, and its content directly determines the quality and clinical efficacy of honeysuckle.

[0003] However, the content of 3,5-di-O-caffeoylquinic acid varies considerably among the main honeysuckle varieties currently cultivated in production. Furthermore, its stability is poor due to factors such as origin, harvesting period, and processing methods, resulting in a shortage of high-quality medicinal materials. Traditional honeysuckle breeding mainly relies on systematic selection and hybridization, which is time-consuming and inefficient, making it difficult to achieve targeted improvement of 3,5-di-O-caffeoylquinic acid content. Although studies have reported the biosynthetic pathway of 3,5-di-O-caffeoylquinic acid in honeysuckle, including key enzyme genes such as phenylalanine ammonia-lyase (PAL), cinnamic acid-4-hydroxylase (C4H), 4-coumarate-coenzyme A ligase (4CL), and hydroxycinnamoyltransferase (HCT), little is known about the upstream transcription factors regulating the expression of these enzyme genes.

[0004] MYB transcription factors are one of the largest transcription factor families in plants, widely involved in the regulation of secondary metabolism, especially the phenylpropane pathway and the biosynthesis of flavonoids. The R2R3 MYB subfamily contains both positive and negative regulators. Currently reported R2R3 MYB transcription factors that negatively regulate phenolic acid synthesis include: Tanshinone SmMYB76, which significantly downregulates the expression of SmPAL1, Sm4CL2, and SmRAS1, thereby reducing phenolic acid accumulation; Tanshinone SmMYB4, which regulates the biosynthesis of phenolic acids and tanshinone by negatively regulating the transcription of key enzyme genes in the phenolic acid and tanshinone biosynthesis pathways; and Snapdragon AmMYB308, which negatively regulates phenolic acid metabolism. However, no transcription factors in honeysuckle that negatively regulate the synthesis of 3,5-di-O-caffeoylquinic acid have been reported. Therefore, identifying and analyzing the key transcription factors that regulate the accumulation of 3,5-di-O-caffeoylquinic acid in honeysuckle not only helps to elucidate the transcriptional regulatory mechanism of phenolic acid biosynthesis, but also provides new molecular targets and breeding strategies for the quality improvement of honeysuckle.

[0005] This invention is the first to clone and functionally identify the R2R3 MYB transcription factor LjMYB44, which negatively regulates the synthesis of 3,5-di-O-caffeoylquinic acid, from honeysuckle. Summary of the Invention

[0006] The purpose of this invention is to provide an R2R3 MYB transcription factor that regulates the content of 3,5-di-O-caffeoylquinic acid in honeysuckle and its application. Specifically, this invention aims to clone the LjMYB44 gene, clarify its negative regulatory function in the accumulation of 3,5-di-O-caffeoylquinic acid in honeysuckle, verify the molecular mechanism by which this gene regulates phenolic acid metabolism and the content of 3,5-di-O-caffeoylquinic acid, and construct a recombinant vector and transformation system containing this gene. This will provide key gene resources and molecular breeding tools for improving the quality of honeysuckle, and achieve the technical goal of increasing the content of 3,5-di-O-caffeoylquinic acid in honeysuckle and improving the quality of the medicinal material through genetic engineering technology.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] The application of the honeysuckle transcription factor LjMYB44 gene in increasing the content of 3,5-di-O-caffeoylquinic acid in honeysuckle or in breeding honeysuckle varieties with high 3,5-di-O-caffeoylquinic acid content includes inhibiting the expression of the LjMYB44 gene. The nucleotide sequence of the LjMYB44 gene is shown in SEQ ID NO.1, and the amino acid sequence of the LjMYB44 transcription factor is shown in SEQ ID NO.2.

[0009] In some embodiments, the method for inhibiting the expression of the LjMYB44 gene is selected from RNA interference, VIGS virus-induced gene silencing, or CRISPR / Cas9 gene editing.

[0010] A method for increasing the content of 3,5-di-O-caffeoylquinic acid in honeysuckle includes the following steps: introducing a pTRV2 recombinant vector containing a specific fragment of the LjMYB44 gene into honeysuckle plants via Agrobacterium-mediated VIGS technology to silence the expression of the endogenous LjMYB44 gene, wherein the nucleotide sequence of the LjMYB44 gene is shown in SEQ ID NO.1.

[0011] In some embodiments, the pTRV2 recombinant vector contains a LjMYB44 gene-specific fragment as shown in SEQ ID NO.1, and the amplification primers for the specific fragment are:

[0012] LjMYB44-TRV2-F: 5'-GCTCTAGAAGATGTGGATCGGATCAAGGGA-3', as shown in SEQ ID NO.7;

[0013] LjMYB44-TRV2-R: 5'-CGGGATCCTTCCAGTGATTCTTAATTGCATTGT-3', as shown in SEQ ID NO.8.

[0014] In some embodiments, the Agrobacterium is strain GV3101.

[0015] In some embodiments, the VIGS technology involves mixing pTRV1 and pTRV2-LjMYB44 recombinant vectors in a 1:1 ratio and then introducing them into honeysuckle leaves via vacuum infiltration.

[0016] A method for screening honeysuckle varieties with high 3,5-di-O-caffeoylquinic acid content, using the expression level of the LjMYB44 gene as a molecular marker, wherein honeysuckle plants with low LjMYB44 gene expression levels are identified as candidate varieties with high 3,5-di-O-caffeoylquinic acid content; the nucleotide sequence of the LjMYB44 gene is shown in SEQ ID NO.1.

[0017] In some embodiments, the expression level of the LjMYB44 gene is detected by qRT-PCR, using the following primers:

[0018] LjMYB44-qF: 5'-CGAGATAGTTCAACGGGATC-3', as shown in SEQ ID NO.9;

[0019] LjMYB44-qR: 5'-GCAGCGAAAGACTCAAAGC-3', as shown in SEQ ID NO.10.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] Using existing plant genetic engineering techniques, this invention cloned the 3,5-di-O-caffeoylquinic acid (3,5-di-O-caffeoylquinic acid)-related gene LjMYB44 from honeysuckle. Through stable overexpression in K326 tobacco, transient overexpression in honeysuckle, and VIGS silencing, it was demonstrated that LjMYB44 negatively regulates 3,5-di-O-caffeoylquinic acid accumulation. Overexpression of the LjMYB44 gene significantly reduced 3,5-di-O-caffeoylquinic acid levels, while the expression of key 3,5-di-O-caffeoylquinic acid synthesis enzymes PAL, 4CL, and HCT was significantly downregulated. Silencing the LjMYB44 gene significantly increased 3,5-di-O-caffeoylquinic acid levels, while the expression of the aforementioned key enzyme genes was significantly upregulated.

[0022] For some honeysuckle varieties with low 3,5-di-O-caffeoylquinic acid content, new honeysuckle varieties with high 3,5-di-O-caffeoylquinic acid content and high quality can be bred by silencing the LjMYB44 gene or knocking out the LjMYB44 gene using CRISPR / Cas9 gene editing technology, which can significantly improve the quality of medicinal materials and clinical efficacy. Attached Figure Description

[0023] Figure 1 Figures showing the cloning and multiple sequence alignment analysis of the LjMYB44 gene: A is a PCR amplification electrophoresis image; B is a multiple sequence alignment image of LjMYB44 and other plant MYB homologous sequences.

[0024] Figure 2 Subcellular localization map of LjMYB44 protein;

[0025] Figure 3 Figure 1 shows the reduction of 3,5-di-O-caffeoylquinic acid content in tobacco through heterologous stable transformation of LjMYB44. A represents the PCR identification of the NPTII gene in transgenic tobacco; B represents the PCR identification of the LjMYB44 gene in transgenic tobacco; C represents the detection of LjMYB44 expression level in transgenic tobacco; D represents a comparison of 3,5-di-O-caffeoylquinic acid content between transgenic and wild-type tobacco; and E represents the gene expression analysis of key enzymes synthesizing 3,5-di-O-caffeoylquinic acid components in transgenic and wild-type tobacco lines.

[0026] Figure 4The graph shows the reduction of 3,5-di-O-caffeoylquinic acid content in honeysuckle due to transient overexpression of LjMYB44: A is the qRT-PCR detection graph of LjMYB44 expression level in injected leaves; B is the HPLC detection graph of 3,5-di-O-caffeoylquinic acid content in injected leaves; C is the gene expression analysis of key enzymes for 3,5-di-O-caffeoylquinic acid synthesis in injected leaves.

[0027] Figure 5 The following figures illustrate how VIGS silencing LjMYB44 can increase the content of 3,5-di-O-caffeoylquinic acid in honeysuckle: A shows the expression level of LjMYB44 in honeysuckle leaves detected by qRT-PCR; B shows the content of 3,5-di-O-caffeoylquinic acid in honeysuckle leaves detected by HPLC; and C shows the expression analysis of key enzyme genes for 3,5-di-O-caffeoylquinic acid synthesis in the leaves of silenced plants. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, or are performed according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0029] Example 1: Cloning and vector construction of the LjMYB44 gene

[0030] RNA extraction and cDNA synthesis: Roots, stems, leaves and flowers of honeysuckle variety 'Siji' were collected. Total RNA was extracted from honeysuckle using the Eastep Super Total RNA Extraction Kit. After treatment with DNase I, RNA integrity was detected by 1% agarose gel electrophoresis. RNA concentration and purity were determined using a NanoDrop micro spectrophotometer. cDNA was synthesized by reverse transcription using the HiScript RT SuperMix for qPCR (+gDNA wiper) kit.

[0031] Gene cloning: Based on the LjMYB44 gene sequence from the honeysuckle transcriptome database, specific primers were designed:

[0032] LjMYB44-F: 5'-ATGGGGAAAGATGTGGATCG-3' (SEQ ID NO. 3);

[0033] LjMYB44-R: 5'-TCATTCAATTTTCCTAACACCAATT-3' (SEQ ID NO. 4).

[0034] PCR amplification was performed using cDNA template from the honeysuckle 'Siji' variety. The PCR reaction mixture (50 μL) consisted of: 25 μL of 2×PrimeSTARMax Premix, 2 μL each of forward and reverse primers (10 μM), 2 μL of cDNA template, and ddH2O to a final volume of 50 μL. The PCR amplification program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 72℃ extension for 1 min, for a total of 35 cycles; and a final extension at 72℃ for 5 min.

[0035] The PCR product was detected by 1% agarose gel electrophoresis, and a single specific band appeared at approximately 800 bp, consistent with the expected size. Figure 1 (A). The target fragment was recovered by gel extraction using an agarose gel DNA recovery kit, and the purified PCR product was ligated into the pMD19-T cloning vector. The ligation product was transformed into DH5α E. coli competent cells using a heat shock method. Positive clones were screened on LB plates (100 mg / L Amp). After overnight culture, single colonies were picked for colony PCR identification, and positive clones were sent to a biotechnology company for sequencing verification. The sequencing results were BLAST aligned and the sequence was assembled to obtain the full-length coding region of the LjMYB44 gene. The results showed that the open reading frame (ORF) of the LjMYB44 gene is 831 bp in length (SEQ ID NO.1), encoding 276 amino acids (SEQ ID NO.2), and contains typical R2 and R3 MYB domains (SEQ ID NO.2). Figure 1 (B)

[0036] Overexpression vector construction: After PCR product was purified by gel extraction, the complete CDS sequence of LjMYB44 was digested with Xho I and ligated into the pHELLSGATE8-35S-GFP vector, transformed into DH5α competent cells, and single clones were selected for sequencing verification.

[0037] LjMYB44 overexpression primers:

[0038] LjMYB44-OE-F:

[0039] 5'- CATTTGGAGAGGACACGCTCGAG ATGGGGAAAGATGTGGATCG-3' (SEQ ID NO. 5);

[0040] LjMYB44-OE-R:

[0041] 5'- CTTGCTCACCATGAATTCCTCGAG TTCAATTTTCCTAACACCAATT-3' (SEQ ID NO. 6).

[0042] The first 18 bases at the 5' end of the primer are protective bases, and the next 6 bases are the Xho I restriction site CTCGAG.

[0043] Construction of silencing vector: Select the location and length of the gene-specific fragment for VIGS; design primers containing specific restriction enzyme sites; clone the fragment into the designated VIGS silencing vector, digest it with Xba I and BamHI, and then ligate it into the pTRV2 vector to obtain the pTRV2-LjMYB44 silencing vector.

[0044] LjMYB44-TRV2-F:5'- GCTCTAGA AGATGTGGATCGGATCAAGGGA-3' (SEQ ID NO. 7);

[0045] LjMYB44-TRV2-R:5'- CGGGATCC TTCCAGTGATTCTTAATTGCATTGT-3' (SEQ ID NO. 8).

[0046] In the LjMYB44-TRV2-F primer, GCTCTAGA is the Xba I restriction site, and in the LjMYB44-TRV2-R primer, CGGGATCC is the BamH I restriction site.

[0047] After the recombinant vector was verified by sequencing, it was transformed into Agrobacterium GV3101.

[0048] Example 2: Subcellular localization of LjMYB44 protein

[0049] The above-mentioned pHELLSGATE8-35S-LjMYB44-GFP fusion expression vector was transformed into Agrobacterium GV3101 and injected into leaves of Nicotiana benthamiana. The empty vector 35S-GFP was used as a control. Forty-eight hours after injection, the GFP fluorescence signal was observed using a laser confocal microscope, and the cell nuclei were stained with DAPI. Figure 2 As shown, the fluorescence signal of the 35S-GFP empty vector control is distributed throughout the cell; while the fluorescence signal of the LjMYB44-GFP fusion protein overlaps with the DAPI staining site, indicating that the LjMYB44 protein is located in the cell nucleus.

[0050] Example 3: Heterologous and stable overexpression of LjMYB44 in K326 tobacco

[0051] The pHELLSGATE8-35S-LjMYB44-GFP vector was transformed into Agrobacterium GV3101, which was then used to transform sterile leaves of K326 tobacco using the leaf disc method. After co-culturing for 2-3 days, the leaves were transferred to a selection medium containing kanamycin (100 mg / L) and carbenicillin (500 mg / L) to induce callus and adventitious shoots. When the regenerated seedlings reached 3-5 cm in length, they were cut and transferred to a rooting medium. After 4 weeks of culture, residual medium was removed from the roots, and the seedlings were transplanted into nutrient pots containing sterile nutrient soil and placed in a light-cured culture chamber. Young leaves (approximately 100 mg) of successfully transplanted transgenic tobacco were collected, and genomic DNA was extracted using the CTAB method. PCR amplification was performed using LjMYB44 gene-specific primers (LjMYB44-F / LjMYB44-R). Genomic DNA from empty vector control plants and wild-type K326 tobacco plants was used as a negative control, and the pHELLSGATE8-35S-LjMYB44-GFP plasmid was used as a positive control. PCR products were detected by 1% agarose gel electrophoresis. Plants that amplified the target band at a specific location (approximately 831 bp) were preliminarily identified as positive transgenic plants. Figure 3 (A, B)

[0052] Young leaves (approximately 100 mg) from PCR-positive transgenic plants, empty vector control plants, and wild-type plants were collected, ground in liquid nitrogen, and total RNA was extracted using an RNA extraction kit. cDNA was synthesized using a PrimeScript RT reverse transcription kit. Using the tobacco NtActin gene as an internal control, the expression level of LjMYB44 was detected by qRT-PCR. The results showed that compared with wild-type tobacco, the expression level of LjMYB44 in transgenic tobacco lines OE-44-1, OE-44-2, and OE-44-4 was significantly increased, being 6662.26 times, 8358.36 times, and 7479.95 times that of the control, respectively. Figure 3 (C)

[0053] LjMYB44-qF: 5'-CGAGATAGTTCAACGGGATC-3' (SEQ ID NO.9);

[0054] LjMYB44-qR: 5'-GCAGCGAAAGACTCAAAGC-3' (SEQ ID NO. 10);

[0055] NtActin-qF: 5'-CCTGATGGCAAGTGATT-3' (SEQ ID NO. 11);

[0056] NtActin-qR: 5'-GCTGAGGGAAGCCAAGAT-3' (SEQ ID NO. 12).

[0057] 3,5-Di-O-caffeoylquinic acid content determination: HPLC method was used. 0.1 g of leaf powder was added to 2 mL of 70% methanol, and the mixture was ultrasonically extracted for 30 min. After centrifugation at 12000 rpm for 10 min, the supernatant was filtered through a 0.22 μm filter membrane. Chromatographic conditions: C 18 The chromatographic column (4.6 mm × 250 mm, 5 μm) was used with a mobile phase of 0.1% phosphoric acid aqueous solution (A) and acetonitrile (B), using gradient elution (0–8 min, 16% B to 20% B; 8–14 min, 20% B; 14–30 min, 20% B to 32% B; 30–40 min, 32% B; 40–50 min, 32% B to 100% B). The column temperature was maintained at 25 °C, the injection volume was 10 μL, and the elution flow rate was 0.7 mL·min. -1 The detection wavelength is 327nm.

[0058] like Figure 3 As shown in Figure D, the 3,5-di-O-caffeoylquinic acid (3,5-DI-O-caffeoylquinic acid) contents in transgenic tobacco lines OE-44-1, OE-44-2, and OE-44-4 were 10.52 μg / g DW, 6.79 μg / g DW, and 8.55 μg / g DW, respectively, which were reduced by 31.69%, 55.9%, and 44.48% compared with the wild-type control. This indicates that stable heterologous overexpression of LjMYB44 in K326 tobacco can significantly reduce the 3,5-di-O-caffeoylquinic acid content, confirming that LjMYB44 negatively regulates the accumulation of 3,5-di-O-caffeoylquinic acid.

[0059] Expression analysis of key enzyme genes involved in 3,5-di-O-caffeoylquinic acid synthesis: Leaf samples from the same batch used for 3,5-di-O-caffeoylquinic acid content determination were collected. Total RNA was extracted and reverse transcribed to synthesize cDNA. Using the tobacco NtActin gene as an internal control, the expression levels of the key enzyme genes NtPAL, Nt4CL, NtHCT, and NtC4H involved in 3,5-di-O-caffeoylquinic acid synthesis were detected by qRT-PCR. Figure 3 As shown in Figure E, the expression levels of NtPAL, Nt4CL, and NtHCT, key enzyme genes for phenolic acid synthesis, were significantly downregulated in the OE-44-1, OE-44-2, and OE-44-4 transgenic tobacco lines compared with the wild type.

[0060] Example 4: Transient overexpression of LjMYB44 in honeysuckle leaves

[0061] Healthy honeysuckle leaves were selected for injection treatment. Treatment groups: ① Empty vector control (pHELLSGATE8-35S-GFP); ② LjMYB44 overexpression (pHELLSGATE8-35S-LjMYB44-GFP). Agrobacterium tumefaciens bacterial suspension concentration OD 600 =0.6. 5-7 days after injection, leaf discs from the injection area were taken and frozen in liquid nitrogen to determine the expression level of LjMYB44, the content of 3,5-di-O-caffeoylquinic acid, and the expression level of the gene for the key enzyme in the synthesis of 3,5-di-O-caffeoylquinic acid.

[0062] Transient expression effect detection: Results are as follows Figure 4 As shown in Figure A, the expression level of LjMYB44 in the leaves of the overexpression groups (TE-44-1 and TE-44-2) was significantly higher than that of the wild-type control, with relative expression levels increasing by 590.04 times and 457.58 times, respectively, indicating that transient overexpression was successful.

[0063] 3,5-Di-O-caffeoylquinic acid content: such as Figure 4 As shown in Figure B, the 3,5-di-O-caffeoylquinic acid content in the leaves of the wild-type control was 5.86 mg / g DW, while the 3,5-di-O-caffeoylquinic acid content in the leaves of the overexpression group was 3.04 mg / g DW and 4.3 mg / g DW, respectively, which were 48.12% and 26.62% lower than the control, respectively. This indicates that transient overexpression of LjMYB44 can significantly reduce the 3,5-di-O-caffeoylquinic acid content in honeysuckle leaves.

[0064] Expression analysis of key enzyme genes involved in the synthesis of 3,5-di-O-caffeoylquinic acid: The expression levels of LjPAL, Lj4CL, LjC4H, and LjHCT genes were detected by qRT-PCR. The results are as follows: Figure 4 As shown in Figure C, compared with the control, the expression levels of the key enzyme genes LjPAL, Lj4CL and LjHCT for 3,5-di-O-caffeoylquinic acid synthesis in the leaves of the overexpression group were significantly downregulated.

[0065] Example 5: VIGS Silent Honeysuckle LjMYB44

[0066] Agrobacterium GV3101 bacterial culture containing pTRV1 vector and pTRV2-LjMYB44 silencing vector (OD) 600 =0.6) was mixed at a 1:1 ratio and used to infect honeysuckle leaves via Agrobacterium vacuum infection. The control was an empty vector pTRV1+pTRV2. Samples were taken 4 weeks after infection. The expression level of the LjMYB44 gene was detected by qRT-PCR, and the results are as follows. Figure 5As shown in Figure A, the expression levels of LjMYB44 in the TRV-44-1 and TRV-44-2 treatment groups were 0.14 and 0.26, respectively. Simultaneously, the content of 3,5-di-O-caffeoylquinic acid was determined by HPLC. The contents of 3,5-di-O-caffeoylquinic acid in the leaves of the silenced plants were 8.81 mg / g DW and 11.05 mg / g DW, respectively, which were 30.13% and 63.22% higher than the control. Figure 5 The expression levels of key enzyme genes for 3,5-di-O-caffeoylquinic acid synthesis, LjPAL, Lj4CL, and LjHCT, were significantly increased (in B). Figure 5 (C)

[0067] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.

Claims

1. The application of the honeysuckle transcription factor LjMYB44 gene in increasing the content of 3,5-di-O-caffeoylquinic acid in honeysuckle or in breeding honeysuckle varieties with high 3,5-di-O-caffeoylquinic acid content, characterized in that... The application includes inhibiting the expression of the LjMYB44 gene, the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of which is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The method for inhibiting the expression of the LjMYB44 gene is selected from RNA interference, VIGS virus-induced gene silencing, or CRISPR / Cas9 gene editing.

3. A method for increasing the content of 3,5-di-O-caffeoylquinic acid in honeysuckle, characterized in that, Includes the following steps: Using Agrobacterium-mediated VIGS technology, a pTRV2 recombinant vector containing a specific fragment of the LjMYB44 gene was introduced into honeysuckle plants to silence the expression of the endogenous LjMYB44 gene, wherein the nucleotide sequence of the LjMYB44 gene is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that, The pTRV2 recombinant vector contains a specific fragment of the LjMYB44 gene shown in SEQ ID NO.1, and the amplification primers for the specific fragment are: LjMYB44-TRV2-F: 5'-GCTCTAGAAGATGTGGATCGGATCAAGGGA-3', as shown in SEQ ID NO.7; LjMYB44-TRV2-R: 5'-CGGGATCCTTCCAGTGATTCTTAATTGCATTGT-3', as shown in SEQ ID NO.

8.

5. The method according to claim 3, characterized in that, The Agrobacterium was strain GV3101.

6. The method according to claim 4, characterized in that, The VIGS technology involves mixing pTRV1 and pTRV2-LjMYB44 recombinant vectors in a 1:1 ratio and then introducing them into honeysuckle leaves via vacuum inoculation.

7. A method for screening honeysuckle varieties with high 3,5-di-O-caffeoylquinic acid content, characterized in that, Using the expression level of the LjMYB44 gene as a molecular marker, honeysuckle plants with low LjMYB44 gene expression levels were identified as candidate varieties with high 3,5-di-O-caffeoylquinic acid content; the nucleotide sequence of the LjMYB44 gene is shown in SEQ ID NO.

1.

8. The method according to claim 7, characterized in that, The expression level of the LjMYB44 gene was detected by qRT-PCR, using the following primers: LjMYB44-qF: 5'-CGAGATAGTTCAACGGGATC-3', as shown in SEQ ID NO.9; LjMYB44-qR: 5'-GCAGCGAAAGACTCAAAGC-3', as shown in SEQ ID NO.10.

Images