A gene related to regulating cold tolerance of rice seedling stage and application thereof

Abstract

The application provides a gene related to regulation of rice seedling cold tolerance and application thereof, and belongs to the technical field of plant genetic engineering and genetic breeding. RBA1 The application identifies ORF1 , ORF2 and ORF3 genes contained in the site, the genes negatively regulate the rice seedling cold tolerance, enriches the gene resources related to regulation of the rice seedling cold tolerance, and provides a new technical path for rice cold tolerance breeding.

Description

Technical Field

[0001] This application belongs to the field of plant genetic engineering and genetic breeding technology, and more specifically, relates to a gene related to regulating cold tolerance in rice seedlings and its application. Background Technology

[0002] Low temperature chilling injury is a limiting factor for rice ( Oryza sativa L Low temperatures are a significant abiotic stress factor affecting rice yield and expanding planting areas. Low temperatures during the rice seedling stage can lead to stunted growth, yellowing leaves, and even death, severely impacting rice growth, development, and final yield. Therefore, identifying and utilizing rice genes related to regulating cold tolerance in rice seedlings and breeding cold-resistant rice varieties is of great importance for ensuring food security.

[0003] Cold tolerance in rice is a complex quantitative trait controlled by multiple genes, and the identification of cold tolerance phenotypes requires specific low-temperature conditions, which poses a significant challenge to cold-tolerant breeding. Currently, previous researchers have obtained a few cold tolerance-related genes through forward cloning, such as... qLTG3-1 , COLD1 , LTG1 , LTT7 , ctb1 , CTB4a However, the number of cloned genes related to regulating cold tolerance in rice seedlings remains limited, and the mechanisms of action of most of these genes are still unclear. In particular, most reported genes regulating cold tolerance in rice seedlings exhibit positive regulation—overexpression increases cold tolerance, while knockout decreases it—while reports on genes negatively regulating cold tolerance in rice are scarce. Summary of the Invention

[0004] The purpose of this application is to provide a gene related to regulating cold tolerance in rice seedlings and its application, and to identify the gene contained in the RBA1 locus derived from common wild rice. ORF1 , ORF2 and ORF3 The gene's function of negatively regulating cold tolerance in rice seedlings enriches the gene resources related to rice and regulating cold tolerance in rice seedlings, providing a new technical approach for cold-tolerant rice breeding.

[0005] A first aspect of this application provides the application of genes related to regulating cold tolerance in rice seedlings in any one of the following A1 to A3: A1. Improve the cold resistance of rice; A2. Creating cold-resistant rice varieties for seedling stage; A3. Breeding of cold-resistant rice varieties during the seedling stage; The gene is ORF2 The gene, with its nucleotide sequence as shown in SEQ ID NO.2; knockout of the gene...ORF2 Genes enhance cold tolerance in rice seedlings; overexpression of the gene described above... ORF2 Genes reduce the cold tolerance of rice seedlings.

[0006] In one embodiment of this application, the knockout is performed using a CRISPR / Cas9 system.

[0007] A second aspect of the embodiments of this application provides a connection with ORF2 Applications of gene-related biomaterials in any of the following B1~B3: B1. Improve the cold resistance of rice; B2. Creating cold-resistant rice varieties for seedling stage; B3. Breeding of cold-resistant rice varieties during the seedling stage; The ORF2 The nucleotide sequence of the gene is shown in SEQ ID NO.2; knockout of the gene... ORF2 Genes enhance cold tolerance in rice seedlings; overexpression of the gene described above... ORF2 Genes reduce cold tolerance in rice seedlings; The biomaterial is selected from any one of the following C1 to C5: C1, Knock out the above ORF2 Gene knockout boxes; C2, a knockout carrier including the knockout box described in C1; C3, a transformant comprising the knockout box described in C1 or the knockout carrier described in C2; C4. Rice obtained by regeneration of the transformant described in C3; C5. Rice containing exogenous nucleic acid molecules incorporated into the genome, wherein the nucleic acid molecules include the knockout cassette described in C1 or the knockout vector described in C2.

[0008] In one embodiment of this application, the knockout is performed using a CRISPR / Cas9 system.

[0009] A third aspect of this application provides a method for improving the cold tolerance of rice seedlings, comprising: Sure ORF2 Gene target sequences; The target sequence is knocked out; Filter to obtain the ORF2 Homozygous mutant rice with loss of gene function; The ORF2 The nucleotide sequence of the gene is shown in SEQ ID NO.2; knockout of the gene... ORF2 Genes enhance cold tolerance in rice seedlings; overexpression of the gene described above... ORF2 Genes reduce the cold tolerance of rice seedlings.

[0010] In one embodiment of this application, the knockout is performed using a CRISPR / Cas9 system.

[0011] A fourth aspect of this application provides a method for creating cold-resistant rice seedlings, comprising: Knockout of donor rice ORF2 Genes, obtained ORF2 Mutants that have lost gene function; The ORF2 A mutant with loss of gene function is crossed with a target rice variety to obtain hybrid offspring, wherein the hybrid offspring possess the characteristics described above. ORF2 The gene indicates that the rice is cold-resistant during the seedling stage, and the hybrid offspring do not possess the aforementioned gene. ORF2 The gene is for cold-resistant rice seedlings; The ORF2 The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0012] The fifth aspect of the embodiments of this application provides ORF2 Gene-related testing materials in knockout ORF2 Application of gene-created seedling-stage cold-resistant rice varieties in identification and breeding. ORF2 The nucleotide sequence of the gene is shown in SEQ ID NO.2; the presence of the described... ORF2 The gene indicates that the rice seedlings are not cold-resistant and does not contain the aforementioned gene. ORF2 The gene is for cold-resistant rice seedlings; The test material is selected from any one of the following D1~D2: D1. Primer pair: The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.22, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.23. Using the genomic DNA of the rice to be tested as a template, PCR amplification is performed using the primer pair. If a specific band is amplified, then the rice to be tested contains the [specific primer pair]. ORF2 If the gene does not amplify a specific band, then the rice being tested does not contain the gene. ORF2 Gene; D2, A kit containing the primer pairs described in D1.

[0013] A sixth aspect of this application provides a method for identifying cold-resistant rice varieties at the seedling stage, comprising: Extract the genomic DNA of the hybrid offspring obtained by the aforementioned creation method; Using the genomic DNA as a template, PCR amplification was performed using primer pairs. If a specific band was amplified, then the hybrid offspring possessed [the desired characteristics]. ORF2 If the gene is not cold-resistant rice in the seedling stage, and no specific band is amplified, then the hybrid offspring do not exist. ORF2It is a cold-resistant rice variety in the seedling stage; The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.22, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.23.

[0014] A seventh aspect of this application provides a method for breeding cold-resistant rice varieties at the seedling stage, comprising: Extract the genomic DNA of the hybrid offspring obtained by the aforementioned creation method; Using the genomic DNA as a template, PCR amplification was performed using primer pairs. If a specific band was amplified, then the hybrid offspring possessed [the desired characteristics]. ORF2 If the gene is not cold-resistant rice in the seedling stage, and no specific band is amplified, then the hybrid offspring do not exist. ORF2 The rice variety is a cold-resistant seedling variety, and the cold-resistant seedling variety is retained for breeding. The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.22, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.23.

[0015] The beneficial effects of this application are as follows: This application, through screening diverse wild rice germplasm resources, is the first to discover and identify germplasm derived from common wild rice. ORF1 Gene, ORF2 Genes and ORF3 This study investigates the negative regulatory function of genes on cold tolerance during rice seedling stage, enriching the gene resources related to this regulation. Unlike traditional strategies that overexpress genes regulating cold tolerance during seedling stage to enhance cold tolerance, this application utilizes gene knockout... ORF1 Gene, ORF2 Gene or ORF3 The gene knockout can significantly improve the cold resistance of rice, providing a new technical path for cold-resistant rice breeding. Moreover, the knockout targets of the three genes are clear, which facilitates precision breeding using gene editing technologies such as CRISPR / Cas9. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 The figure shows the comparison results of seedling cold tolerance between GX2 and PL. In the figure, A represents the cold tolerance phenotype of GX2 and PL seedlings, B represents the survival rate of GX2 and PL seedlings after low-temperature treatment, and C represents the ion permeability of GX2 and PL seedlings after low-temperature treatment. Figure 2 A fine-scale localization map of the RBA1 site; Figure 3 Identification of the 25.7 kb insert fragment in the PL genome and ORF1 Gene, ORF2 Gene, ORF3 Functional verification diagram of gene negative regulation of cold tolerance; In the figure, A represents the structure of the 25.7 kb inserted fragment and... ORF1 Gene, ORF2 Gene, ORF3 Gene location diagram, B is ORF1 Gene, ORF2 Gene, ORF3 Cold tolerance phenotypes of gene knockout mutant lines and wild-type PL, C is ORF1 Gene, ORF2 Gene, ORF3 Survival rate of gene knockout mutant lines and wild-type PL seedlings after low-temperature treatment, D is ORF1 Gene, ORF2 Gene, ORF3 Ion permeability (E) of gene knockout mutant lines and wild-type PL after seedling low-temperature treatment. ORF1 Gene, ORF2 Gene, ORF3 Cold tolerance phenotype of gene overexpression lines and wild-type ZH11, F is ORF1 Gene, ORF2 Gene, ORF3 Survival rates of overexpressing ZH11 lines and wild-type ZH11 seedlings after low-temperature treatment, G being... ORF1 Gene, ORF2 Gene, ORF3 Ion permeability of overexpressing lines and wild-type ZH11 seedlings after low-temperature treatment; Figure 4 Electrophoresis results for identifying the 25.7 kb insert fragment for molecular markers; In the figure, lanes 1-15 are Xiangzaoxian 13, Zhongzao 35, Zhongleng 23, Nanlingzao, Ganzaoxian 7, Jinzao 47, Shunda 135, Zhongzao 39, 1 kb Marker, Zhongzao 33, Jiafuzhan, Zhongyouzao 81, Zhongzu 18, PL, and GX2. Detailed Implementation

[0018] The present application will now be described in detail with reference to preferred embodiments. The preferred embodiments described below according to the present application can be modified in various ways, and therefore the scope of the present application should not be construed as limited to the preferred embodiments described in detail below. Preferred embodiments are provided to help those skilled in the art to more readily understand the present application.

[0019] Unless otherwise specified, all test materials used in the examples are commercially available. Test methods without specific conditions are generally performed under standard conditions or as recommended by the manufacturer.

[0020] Example 1: Discovery and fine localization of the RBA1 site By screening diverse wild rice germplasm resources, a common wild rice variety with significant seedling cold tolerance was identified. Oryza rufipogon The germplasm GX2 was used. Using the cold-sensitive indica rice variety PL (obtained from the International Rice Research Institute, number IRGC86436, which the International Rice Research Institute has committed to distributing to other regions; application website: https: / / www.genesys-pgr.org / 10.18730 / 45YYQ) as the recipient parent and GX2 as the donor parent, 64 chromosome segment replacement lines (CSSLs) were constructed, named SL1~SL64. Among them, replacement line SL11 showed similar cold tolerance to GX2, significantly better than PL. Genotyping revealed that SL11 contains a 5.3 Mb GX2 introgression fragment on chromosome 11 (flank markers CT11-7 and CT11-10), which contains a major cold tolerance locus, named RBA1. The comparison results of seedling cold tolerance between GX2 and PL are shown in the figure below. Figure 1 As shown in the figure. Further QTL analysis and fine mapping were performed by constructing an F2 population, ultimately narrowing down the candidate region for the RBA1 locus to the segment on chromosome 11 between markers CT11-18 (position 26623002) and CT11-20 (position 26669993). The fine mapping map of the RBA1 locus is shown below. Figure 2 As shown.

[0021] Example 2 ORF1 Gene, ORF2 Genes and ORF3 The discovery of genes High-quality genomic analysis of GX2 and PL was performed using PacBio HiFi, Illumina short-read, and Hi-C data. de novo Assembly. Genome alignment revealed that, compared to the cold-resistant GX2 genome, the cold-sensitive PL genome contains a 25.7 kb insert in the RBA1 candidate region (positions 26627528–26653298). This insert contains three open reading frames (ORFs):ORF1 The gene (encoding a 944-amino acid NLR protein containing CC, NB-ARC, and LRR domains) ORF2 The gene (encoding the 262-amino acid CC-NB-ARC protein) and ORF3 Gene (encoding a 650-amino acid LRR protein), such as Figure 3 As shown in A in the diagram.

[0022] Example 3 ORF1 Gene, ORF2 Gene, ORF3 Construction and cold tolerance determination of gene knockout mutants 1. Materials The cold-sensitive indica rice variety PL was used as the receptor material.

[0023] 2. Construction of gene knockout vectors according to ORF1 The nucleotide sequence of the gene (as shown in SEQ ID NO.1). ORF2 The nucleotide sequence of the gene (as shown in SEQ ID NO.2). ORF3 The nucleotide sequences of the genes (as shown in SEQ ID NO.3) were used to design guide sequences (sgRNAs) of 20 nucleotides each using the Target Design tool (http: / / skl.scau.edu.cn / targetdesign / ), with two target sites for each gene. The guide sequences are as follows: ORF1 The forward oligonucleotide sequence of -g1 is: cagACACCTGCTCTCGAAGATGC, as shown in SEQ ID NO.4, and the reverse oligonucleotide sequence is: aacGCATCTTCGAGAGCAGGTGT, as shown in SEQ ID NO.5. ORF1 The forward oligonucleotide sequence of -g2 is: cagTGAATCGGCGCAACTCAGGG, as shown in SEQ ID NO.6, and the reverse oligonucleotide sequence is: aacCCCTGAGTTGCGCCGATTCA, as shown in SEQ ID NO.7. ORF2 The forward oligonucleotide sequence of -g1 is: cagTCTCGATGAGAGCTACGAGC, as shown in SEQ ID NO.8, and the reverse oligonucleotide sequence is: aacGCTCGTAGCTCTCATCGAGA, as shown in SEQ ID NO.9. ORF2The forward oligonucleotide sequence of -g2 is: cagCCATCCACCATCTAACACTC, as shown in SEQ ID NO.10; the reverse oligonucleotide sequence is: aacGAGTGTTAGATGGTGGATGG, as shown in SEQ ID NO.11. ORF3 The forward oligonucleotide sequence of -g1 is: cagCCGGGCCTTGCTAACCCGAA, as shown in SEQ ID NO.12, and the reverse oligonucleotide sequence is: aacTTCGGGTTAGCAAGGCCCGG, as shown in SEQ ID NO.13. ORF3 The forward oligonucleotide sequence of -g2 is cagAAGCCTGATCCGGAGATGGT, as shown in SEQ ID NO.14, and the reverse oligonucleotide sequence is aacACCATCTCCGGATCAGGCTT, as shown in SEQ ID NO.15.

[0024] Oligonucleotides containing the target sequence were synthesized and ligated into a CRISPR-Cas9 vector.

[0025] 3. Genetic transformation The constructed CRISPR-Cas9 knockout vector was subjected to Agrobacterium tumefaciens (Agrobacterium tumefaciens) Agrobacterium tumefaciens Transgenic plants were obtained by transforming PL callus tissue using strain EHA105-mediated transformation.

[0026] 4. Mutant Identification The obtained transgenic plants were sequenced and identified for screening. ORF1 Gene, ORF2 Gene or ORF3 A lineage with a homozygous mutation in its gene, i.e. ORF1 Gene knockout mutant lines (orf1-1, orf1-2) ORF2 Gene knockout mutant lines (orf2-1, orf2-2) ORF3 Gene knockout mutant lines (orf3-1, orf3-2).

[0027] 5. Cold resistance assessment 5.1 Low-Temperature Survival Rate Determination (1) Soak the seeds of the identified strains at 30℃ for 3 days to promote germination; (2) Transfer the germinated seeds to a greenhouse and cultivate them in 1 / 2 Kimura B nutrient solution at 28℃ / 25℃ (day / night) until the two-leaf stage; (3) Place the seedlings at a low temperature of 4℃±0.5℃ for 60 hours; (4) After low-temperature treatment, the seedlings were returned to the greenhouse to recover for 7 days; (5) Calculate the survival rate (survival rate = number of surviving seedlings / total number of plants × 100%).

[0028] 5.2 Ion Leakage Rate Measurement (1) Place the seedlings at 4℃ for 24 hours; (2) Take 5 fully expanded leaves from each seedling, cut them into equal-sized segments, immerse them in 8 mL of distilled water (10 mL test tube), and immediately measure the initial conductivity (S0). (3) Shake the test tube at 100 rpm for 1 hour at room temperature and record the conductivity (S1); (4) Place the test tube in boiling water for 20 minutes and let it cool naturally to room temperature; (5) Shake again at room temperature for 1 hour and measure the final conductivity (S2); (6) Relative ion leakage rate = (S1-S0) / (S2-S0).

[0029] 6. Results The results are as follows Figure 3 As shown in B~D. After low-temperature treatment, the survival rate of wild-type PL seedlings was only 5%~10%, while ORF1 Gene knockout mutant lines ORF2 Gene knockout mutant lines or ORF3 The survival rate of gene knockout mutant lines was significantly increased to 55%–85%, indicating that… ORF1 Gene, ORF2 Gene or ORF3 All genes can significantly improve the cold tolerance of rice seedlings. ORF1 Gene knockout mutant lines ORF2 Gene knockout mutant lines ORF3 The ion leakage rate of the gene knockout mutant line was significantly lower than that of the wild-type PL, further confirming that... ORF1 Gene, ORF2 Gene, ORF3 The gene negatively regulates the cold tolerance of rice.

[0030] Example 4 ORF1 Gene, ORF2 Gene, ORF3 Construction of gene overexpression lines and identification of their cold tolerance 1. Materials The cold-resistant japonica rice variety Zhonghua 11 (ZH11) was used as the recipient material.

[0031] 2. Construction of overexpression vectors amplification respectively ORF1 Gene, ORF2 Gene, ORF3The full-length cDNA of the gene was ligated into the p1300-GFP vector (BamHI / PmlI site) and placed under the control of the maize Ubiquitin promoter and NOS terminator.

[0032] Amplification ORF1 Gene, ORF2 Gene, ORF3 The primer pairs for the gene are as follows: ubi- ORF1 The upstream primer is gtgttacttctgcagggatccATGGCGGATTCGGCTTTG, as shown in SEQ ID NO.16, and the downstream primer is gctcaccataggcctcacgtgATATACAGGTTTGTTTGCTTCGTCC, as shown in SEQ ID NO.17. ubi- ORF2 The upstream primer is gtgttacttctgcagggatccATGGAGACCGCCCTGGGT, as shown in SEQ ID NO.18, and the downstream primer is gctcaccataggcctcacgtgCCTCTTATTCTCCAGGAAATCTCTCA, as shown in SEQ ID NO.19. ubi- ORF3 The upstream primer is gtgttacttctgcagggatccATGAGTAGCAGGATCATTGTGACC, as shown in SEQ ID NO.20, and the downstream primer is gctcaccataggcctcacgtgATCACGTTCGTGGTCGGTGC, as shown in SEQ ID NO.21.

[0033] 3. Genetic transformation The constructed overexpression vector was transformed into ZH11 callus using Agrobacterium EHA105-mediated transformation, and transgenic plants were obtained through screening. ORF1 Gene overexpression lines (ORF1-OE1, ORF1-OE2) ORF2 Gene overexpression lines (ORF2-OE1, ORF2-OE2) ORF3 Gene overexpression lines (ORF3-OE1, ORF3-OE2).

[0034] 4. Cold resistance assessment Following the method in Example 3, ZH11 and its overexpression lines were cultured to the three-leaf stage and then subjected to low-temperature treatment at 4℃±0.5℃ for 96 hours. After recovery, the survival rate was calculated.

[0035] Following the method in Example 3, the ion leakage rate of seedlings of ZH11 and its overexpression lines was measured.

[0036] 5. Results The results are as follows Figure 3 As shown in E~G. After low-temperature treatment, the survival rate of wild-type ZH11 was significantly higher than that of wild-type ZH11. ORF1 Gene overexpression lines ORF2 Gene overexpression lines ORF3 Gene overexpression lines, and the significantly increased ion leakage rate in overexpression lines, indicate that overexpression... ORF1 Gene, ORF2 Gene, ORF3 The gene significantly reduces the cold tolerance of rice seedlings.

[0037] Example 5: Molecular marker identification of a 25.7kb insert fragment Based on the 25.7 kb insert fragment from Example 2, a molecular marker was developed. The primer pair for the molecular marker is as follows: Upstream primer: Ins-F: CAGATTTGAAGGTATGAACGGCC, as shown in SEQ ID NO.22; Downstream primer: Ins-R: GGGATTCTCTGATCTTGTTGACG, as shown in SEQ ID NO.23.

[0038] Samples to be tested: Xiangzaoxian 13, Zhongzao 35, Zhongleng 23, Nanlingzao, Ganzaoxian 7, Jinzao 47, Shunda 135, Zhongzao 39, 1 kb Marker, Zhongzao 33, Jiafuzhan, Zhongyouzao 81, Zhongzu 18, PL, GX2.

[0039] Genomic DNA was extracted from the samples using the CTAB method. Using the extracted DNA as a template, PCR amplification was performed using primer pairs (Ins-F, Ins-R). The PCR amplification system is shown in Table 1. Table 1 PCR amplification system

[0040] The PCR reaction procedure is shown in Table 2: Table 2 PCR reaction procedure

[0041] The amplification products were detected by 1% agarose gel electrophoresis. The presence of a band (326 bp in length) indicates the presence of a 25.7 kb insert fragment. ORF1 Gene, ORF2 Gene, ORF3 Gene; no band indicates the absence of a 25.7kb insert fragment, meaning it does not exist. ORF1 Gene, ORF2 Gene, ORF3 Genes. Results as followsFigure 4 As shown.

[0042] The above are merely specific embodiments of this application, but the scope of protection of this application is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in this application, and these modifications or substitutions should all be covered within the scope of protection of this application. Therefore, the scope of protection of this application should be determined by the scope of the claims.

Claims

1. The application of genes related to regulating cold tolerance in rice seedlings in any one of the following A1~A3: A1. Improve the cold resistance of rice; A2. Creating cold-resistant rice varieties for seedling stage; A3. Breeding of cold-resistant rice varieties during the seedling stage; The gene is ORF2 The gene, with its nucleotide sequence as shown in SEQ ID NO.2; knockout of the gene... ORF2 Genes enhance cold tolerance in rice seedlings; overexpression of the gene described above... ORF2 Genes reduce the cold tolerance of rice seedlings.

2. The application according to claim 1, characterized in that, The knockout was performed using the CRISPR / Cas9 system.

3. with ORF2 Applications of gene-related biomaterials in any of the following B1~B3: B1. Improve the cold resistance of rice; B2. Creating cold-resistant rice varieties for seedling stage; B3. Breeding of cold-resistant rice varieties during the seedling stage; The ORF2 The nucleotide sequence of the gene is shown in SEQ ID NO.2; knockout of the gene... ORF2 Genes enhance cold tolerance in rice seedlings; overexpression of the gene described above... ORF2 Genes reduce cold tolerance in rice seedlings; The biomaterial is selected from any one of the following C1 to C5: C1, Knock out the above ORF2 Gene knockout boxes; C2, a knockout carrier including the knockout box described in C1; C3, a transformant comprising the knockout box described in C1 or the knockout carrier described in C2; C4. Rice obtained by regeneration of the transformant described in C3; C5. Rice containing exogenous nucleic acid molecules incorporated into the genome, wherein the nucleic acid molecules include the knockout cassette described in C1 or the knockout vector described in C2.

4. The application according to claim 3, characterized in that, The knockout was performed using the CRISPR / Cas9 system.

5. A method for improving the cold tolerance of rice seedlings, characterized in that, include: Sure ORF2 Gene target sequences; The target sequence is knocked out; Filter to obtain the ORF2 Homozygous mutant rice with loss of gene function; The ORF2 The nucleotide sequence of the gene is shown in SEQ ID NO.2; knockout of the gene... ORF2 Genes enhance cold tolerance in rice seedlings; overexpression of the gene described above... ORF2 Genes reduce the cold tolerance of rice seedlings.

6. The method for improving the cold tolerance of rice seedlings according to claim 5, characterized in that, The knockout was performed using the CRISPR / Cas9 system.

7. A method for creating a cold-resistant rice variety in the seedling stage, characterized in that, include: Knockout of donor rice ORF2 Genes, obtained ORF2 Mutants that have lost gene function; The ORF2 A mutant with loss of gene function is crossed with a target rice variety to obtain hybrid offspring, wherein the hybrid offspring possess the characteristics described above. ORF2 The gene indicates that the rice is cold-resistant during the seedling stage, and the hybrid offspring do not possess the aforementioned gene. ORF2 The gene is for cold-resistant rice seedlings; The ORF2 The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

8. ORF2 Gene-related testing materials in knockout ORF2 Application of gene-created seedling-stage cold-resistant rice varieties in identification and breeding, characterized by: The ORF2 The nucleotide sequence of the gene is shown in SEQ ID NO.2; The existence of the above ORF2 The gene indicates that the rice seedlings are not cold-resistant and does not contain the aforementioned gene. ORF2 The gene is for cold-resistant rice seedlings; The test material is selected from any one of the following D1~D2: D1. Primer pair: The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.22, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.

23. Using the genomic DNA of the rice to be tested as a template, PCR amplification is performed using the primer pair. If a specific band is amplified, then the rice to be tested contains the [specific primer pair]. ORF2 If the gene does not amplify a specific band, then the rice being tested does not contain the gene. ORF2 Gene; D2. A kit containing the primer pairs described in D1.

9. A method for identifying cold-resistant rice varieties at the seedling stage, characterized in that, include: Extract genomic DNA from the hybrid offspring obtained by the creation method of claim 7; Using the genomic DNA as a template, PCR amplification was performed using primer pairs. If a specific band was amplified, then the hybrid offspring possessed [the desired characteristics]. ORF2 If the gene is not cold-resistant rice in the seedling stage, and no specific band is amplified, then the hybrid offspring do not exist. ORF2 It is a cold-resistant rice variety in the seedling stage; The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.22, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.

23.

10. A method for breeding cold-resistant rice varieties at the seedling stage, characterized in that, include: Extract genomic DNA from the hybrid offspring obtained by the creation method of claim 7; Using the genomic DNA as a template, PCR amplification was performed using primer pairs. If a specific band was amplified, then the hybrid offspring possessed [the desired characteristics]. ORF2 If the gene is not cold-resistant rice in the seedling stage, and no specific band is amplified, then the hybrid offspring do not exist. ORF2 The rice variety is a cold-resistant seedling variety, and the cold-resistant seedling variety is retained for breeding. The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.22, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.23.

Images