Application of smap2 / erf16 gene in improving content of salvianolic acid b and / or rosmarinic acid in salvia miltiorrhiza

Abstract

The present application relates to the technical field of plant genetic engineering, and particularly relates to application of SmAP2 / ERF16 gene in improving content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza; the technical points are as follows: the coding region nucleotide sequence of SmAP2 / ERF16 gene is shown as SEQ ID NO:1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO:2; a SmAP2 / ERF16 gene recombination expression box and a plant recombination expression vector are constructed, and are introduced into Salvia miltiorrhiza to realize overexpression; overexpression and CRISPR / Cas9 gene editing results show that SmAP2 / ERF16 is a positive regulation factor of salvianolic acid biosynthesis; by overexpressing SmAP2 / ERF16 gene in Salvia miltiorrhiza, transcription and expression of SmCYP98A14 can be promoted, and content of rosmarinic acid and salvianolic acid B in Salvia miltiorrhiza can be significantly improved.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of the SmAP2 / ERF16 gene in increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza. Background Technology

[0002] Salvia miltiorrhiza Bunge is a perennial herb belonging to the genus Salvia in the Lamiaceae family. Its dried root and rhizome are among the major traditional Chinese medicinal materials. Water-soluble phenolic acids are the main active components of Salvia miltiorrhiza, primarily including rosmarinic acid and salvianolic acid B. These components possess strong antioxidant activity and significant medicinal value, and are also important indicators for the quality evaluation of Salvia miltiorrhiza and related preparations.

[0003] Tanshinone acid secondary metabolites are mainly synthesized via the phenylpropane metabolic pathway and the tyrosine derivatization pathway. In the phenylpropane pathway, phenylalanine is converted into phenolic acid acyl donors by key enzymes such as PAL, C4H, and 4CL; in the tyrosine derivatization pathway, tyrosine is converted into tanshinone-related precursors by enzymes such as TAT ​​and HPPR. The precursors generated in both pathways are converted into rosmarinic acid by enzymes such as RAS, and then participate in the formation of subsequent tanshinone acid components via key enzymes such as CYP98A14.

[0004] Transcription factors can influence the accumulation of plant secondary metabolites by regulating the expression levels of key structural genes. The AP2 / ERF family of transcription factors are widely involved in plant growth and development, hormone response, stress adaptation, and secondary metabolism regulation. However, the functional genes of the AP2 / ERF family members in Tanshinone that regulate the synthesis of salvianolic acid and their applications still need further investigation. Summary of the Invention

[0005] To address the aforementioned shortcomings of existing technologies, this invention provides the application of the SmAP2 / ERF16 gene in increasing the content of salvianolic acid B and / or rosmarinic acid in tanshinone, which can effectively solve the problem of the lack of functional genes and corresponding genetic engineering regulation methods in existing technologies that can effectively promote the synthesis and accumulation of rosmarinic acid and salvianolic acid B in tanshinone.

[0006] The applicant used *Taishenia santalinus* materials with significantly different phenolic acid content as research subjects. Through combined transcriptomic and metabolomic analysis, expression trend clustering, differential expression analysis, and transcription-metabolism association network analysis, candidate transcription factors closely related to the differential accumulation of phenolic acid in *Taishenia santalinus* were screened. The results showed that the candidate gene, numbered EVM0015940, had a high expression level in materials with high phenolic acid content and a high degree of association with phenolic acid metabolites. Further, based on *Taishenia santalinus* reference genome data, whole-genome identification and phylogenetic analysis were performed on members of the *Taishenia santalinus* AP2 / ERF family. EVM0015940 was named SmAP2 / ERF16, and its coding region nucleotide sequence was obtained. The coding region nucleotide sequence is 474 bp in length, encoding 157 amino acids.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides the application of the SmAP2 / ERF16 gene in increasing the content of salvianolic acid B and / or rosmarinic acid in tanshinone, wherein the nucleotide sequence of the coding region of the SmAP2 / ERF16 gene is shown in SEQ ID NO: 1;

[0009] The application involves overexpressing the SmAP2 / ERF16 gene in Danshen (Salvia miltiorrhiza).

[0010] Furthermore, the amino acid sequence of the SmAP2 / ERF16 protein encoded by the SmAP2 / ERF16 gene is shown in SEQ ID NO: 2.

[0011] Furthermore, the amino acid sequence of the protein encoded by the SmAP2 / ERF16 gene is shown in SEQ ID NO: 2.

[0012] Furthermore, the overexpression is achieved by exogenously introducing and expressing the coding sequence of the SmAP2 / ERF16 gene into Danshen.

[0013] Furthermore, the exogenous SmAP2 / ERF16 gene was introduced into Danshen in the form of a recombinant expression cassette and expressed in Danshen.

[0014] Furthermore, the recombinant expression cassette includes a promoter, the coding sequence of the SmAP2 / ERF16 gene, and a terminator.

[0015] Furthermore, the promoter is a plant promoter capable of driving the transcription of the SmAP2 / ERF16 gene in Salvia miltiorrhiza.

[0016] Preferably, the plant promoter is the UBQ10 promoter.

[0017] Furthermore, the recombinant expression cassette is carried by a plant recombinant expression vector.

[0018] Furthermore, the plant recombinant expression vector was introduced into *Salvia miltiorrhiza* via Agrobacterium-mediated genetic transformation.

[0019] Furthermore, the Agrobacterium is Agrobacterium rhizogenes.

[0020] Furthermore, the overexpression of the SmAP2 / ERF16 gene was carried out in the hairy roots of Salvia miltiorrhiza.

[0021] In a second aspect, the present invention also provides a recombinant expression cassette for increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, the recombinant expression cassette comprising an operably linked plant promoter, a SmAP2 / ERF16 gene and a terminator, the coding region nucleotide sequence of the SmAP2 / ERF16 gene being shown in SEQ ID NO:1.

[0022] Furthermore, the plant promoter is a plant promoter capable of driving the transcription of the SmAP2 / ERF16 gene in Salvia miltiorrhiza.

[0023] Preferably, the plant promoter is the UBQ10 promoter.

[0024] Thirdly, the present invention also provides a plant recombinant expression vector for increasing the content of salvianolic acid B and / or rosmarinic acid in tanshinone, characterized in that the plant recombinant expression vector comprises the recombinant expression cassette described in the second aspect.

[0025] Fourthly, the present invention also provides a recombinant Agrobacterium for increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, wherein the transgenic recombinant bacteria contains the plant recombinant expression vector described in the third aspect.

[0026] Furthermore, the recombinant Agrobacterium is a recombinant Agrobacterium rhizogenes.

[0027] To verify the function of the SmAP2 / ERF16 gene, this invention constructed SmAP2 / ERF16-overexpressing and CRISPR / Cas9-edited SmAP2 / ERF16-overexpressing hairy roots of *S. tanshinone* and CRISPR / Cas9-edited hairy roots of *S. tanshinone*, respectively. The expression level of the SmAP2 / ERF16 gene was detected by qRT-PCR, and the contents of rosmarinic acid and salvianolic acid B in the hairy roots of *S. tanshinone* were detected by HPLC. The results showed that, compared with the corresponding empty vector control, SmAP2 / ERF16 gene overexpression significantly increased the contents of rosmarinic acid and salvianolic acid B in the hairy roots of *S. tanshinone*. When the function of the SmAP2 / ERF16 gene was inhibited or edited, the contents of rosmarinic acid and salvianolic acid B decreased accordingly, indicating that SmAP2 / ERF16 is a positive regulator of salvianolic acid biosynthesis.

[0028] Furthermore, this invention verifies through yeast one-hybrid analysis that SmAP2 / ERF16 can interact with the promoter of SmCYP98A14, a key enzyme gene in the biosynthesis of tanshinone. Gel migration arrest experiments further verify that the SmAP2 / ERF16 protein can directly bind to the SmCYP98A14 promoter probe. Dual-luciferase reporter gene analysis confirms that SmAP2 / ERF16 can enhance the transcriptional activity of the SmCYP98A14 promoter. This indicates that SmAP2 / ERF16 can participate in the regulation of tanshinone and rosmarinic acid B biosynthesis by positively regulating the expression of SmCYP98A14.

[0029] The technical solution provided by this invention has the following advantages compared with the known prior art:

[0030] 1. This invention identifies and verifies the positive regulatory function of the SmAP2 / ERF16 gene in the biosynthesis of tanshinone, clarifies the new use of this gene in increasing the content of rosmarinic acid and salvianolic acid B in tanshinone, provides a new functional gene resource for the genetic improvement of tanshinone content, and provides a new technical approach for tanshinone genetic engineering breeding and salvianolic acid metabolism engineering.

[0031] 2. Based on the genetic transformation system of *Salvia miltiorrhiza* hairy roots, this invention verified the regulatory relationship between the SmAP2 / ERF16 gene and the accumulation of tanshinone from two aspects: positive enhancement and negative inhibition, through overexpression of the SmAP2 / ERF16 gene and CRISPR / Cas9 gene editing. The experimental results showed that overexpression of the SmAP2 / ERF16 gene could significantly promote the accumulation of rosmarinic acid and tanshinone B in *Salvia miltiorrhiza* hairy roots, while the content of rosmarinic acid and tanshinone B decreased accordingly after the function of the SmAP2 / ERF16 gene was inhibited or edited, indicating that SmAP2 / ERF16 is a positive regulator of tanshinone biosynthesis.

[0032] 3. This invention, through yeast one-hybrid assays, gel migration arrest experiments, and dual-luciferase reporter gene analysis, verified that SmAP2 / ERF16 can interact with the promoter of SmCYP98A14, a key enzyme gene in the biosynthesis of tanshinone, and can directly bind to the SmCYP98A14 promoter probe, thereby enhancing the transcriptional activity of the promoter. This clarifies the mechanism by which SmAP2 / ERF16 participates in the biosynthesis of tanshinone through positive regulation of SmCYP98A14 expression, providing a theoretical basis and technical foundation for targeted regulation of the tanshinone synthesis pathway using SmAP2 / ERF16. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.

[0034] Figure 1 This is the phylogenetic tree of the AP2 / ERF family members to which SmAP2 / ERF16 belongs in this invention;

[0035] Figure 2 The expression of SmAP2 / ERF16 in different tissues of Salvia miltiorrhiza;

[0036] Figure 3 The images show positive identification results for SmAP2 / ERF16 transgenic hairy roots. In the images, A is a positive identification result for SmAP2 / ERF16 overexpressing hairy roots via PCR, B is a positive identification result for SmAP2 / ERF16 CRISPR / Cas9 gene-edited hairy roots via PCR, and C is a sequencing alignment diagram of the target sites in SmAP2 / ERF16 CRISPR / Cas9 gene-edited hairy roots.

[0037] Figure 4 The diagram shows the relative expression levels of SmAP2 / ERF16 in the hairy roots of the SmAP2 / ERF16 transgenic gene. In the diagram, A represents the relative expression levels of SmAP2 / ERF16 in the hairy roots overexpressing SmAP2 / ERF16, and B represents the relative expression levels of SmAP2 / ERF16 in the hairy roots edited with the SmAP2 / ERF16 gene by CRISPR / Cas9.

[0038] Figure 5 Figures showing the contents of rosmarinic acid and salvianolic acid B in the hairy roots of SmAP2 / ERF16 transgenic plants, where A represents the contents of rosmarinic acid and salvianolic acid B in the hairy roots overexpressing SmAP2 / ERF16, and B represents the contents of rosmarinic acid and salvianolic acid B in the hairy roots of SmAP2 / ERF16 CRISPR / Cas9 gene-edited plants.

[0039] Figure 6 The image shows the results of a yeast one-hybrid between the SmAP2 / ERF16 and SmCYP98A14 promoters.

[0040] Figure 7 The image shows the EMSA results of the binding of the SmAP2 / ERF16 protein to the SmCYP98A14 promoter probe.

[0041] Figure 8 The result of Dual-LUC for positive activation of the SmCYP98A14 promoter by SmAP2 / ERF16. Detailed Implementation

[0042] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments.

[0043] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail. The terms “comprising,” “including,” “having,” “containing,” etc., as used herein are open-ended terms, meaning that they include but are not limited to. Unless the context clearly indicates otherwise, the expressions “a” and “an” as used herein include plural references. It should be noted that “first,” “second,” etc., are used merely for convenience of description and distinction and should not be construed as indicating or implying relative importance. The term “about” as used herein indicates a range of ±20% of the following numerical value. In some embodiments, the term “about” indicates a range of ±10% of the following numerical value. In some embodiments, the term “about” indicates a range of ±5% of the following numerical value. The invention is further described below with reference to embodiments.

[0044] The SmAP2 / ERF16 identified in this invention can positively regulate the accumulation of rosmarinic acid and salvianolic acid B in tanshinone, and can interact with the SmCYP98A14 promoter and activate its transcription, providing a new gene resource for the quality improvement of tanshinone and the engineering of salvianolic acid metabolism.

[0045] The applicant first used *Salvia miltiorrhiza* materials with significant differences in phenolic acid content as the research object, and conducted a combined transcriptome and metabolome analysis. Through expression trend clustering, differential analysis, and transcription-metabolism association network analysis, it was found that AP2 / ERF family transcription factors made significant contributions to the network related to differential accumulation of phenolic acids, and several candidate AP2 / ERF transcription factors were screened. Among them, the candidate gene numbered EVM0015940 showed a high expression level in materials with high phenolic acid content and associated with the most phenolic acid metabolites, and was therefore identified as a key candidate gene. Subsequently, based on the *Salvia miltiorrhiza* reference genome data, the applicant used AP2 / ERF conserved domain retrieval and homologous sequence alignment to perform whole-genome identification and phylogenetic analysis of *Salvia miltiorrhiza* AP2 / ERF family members, identifying a total of 169 SmAP2 / ERF family members. Based on the position of EVM0015940 in the phylogenetic tree and the family naming rules, it was named SmAP2 / ERF16, as shown below. Figure 1 As shown, the phylogenetic tree of the AP2 / ERF family members to which SmAP2 / ERF16 belongs is displayed.

[0046] The CDS sequence of SmAP2 / ERF16 was obtained based on the genome annotation information of Salvia miltiorrhiza. The nucleotide sequence of SmAP2 / ERF16 is shown in SEQ ID No.1. Its open reading frame length is 474 bp, encoding 157 amino acids. The encoded amino acid sequence is shown in SEQ ID No.2.

[0047] Example 1:

[0048] Expression characteristics analysis of SmAP2 / ERF16 gene.

[0049] Tissue samples from roots, stems, leaves, and petioles of *Salvia miltiorrhiza* with uniform growth stages were collected and immediately flash-frozen in liquid nitrogen, then stored at -80 °C for later use. Total RNA was extracted from each tissue using a plant total RNA extraction kit (purchased from Chengdu Lanbo Biotechnology Co., Ltd.) following the kit's instructions. The extracted total RNA was reverse transcribed into cDNA using a HiScript IV All-in-One Ultra qRTSuperMix for qPCR (purchased from Nanjing Novizan Biotechnology Co., Ltd.) following the kit's instructions. The expression levels of SmAP2 / ERF16 in different tissues were detected using qRT-PCR with SmActin as an internal control gene. The primers used are as follows:

[0050] F-SmActin: 5'-AGGAACCACCGATCCAGACA-3';

[0051] R-SmActin: 5'-GGTGCCCTGAGGTCCTGTT-3';

[0052] F-SmAP2 / ERF16: 5'-GCTATCGCCCTCGCAGATTCA-3';

[0053] R-SmAP2 / ERF16: 5'-CCAACACGAAACTCACCGAAAGA-3'.

[0054] Quantitative PCR was performed using the ChamQ SYBR qPCR Master Mix kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). A 10 μL reaction mixture was prepared, containing 5 μL of Mix, 3 μL of ddH2O (double-distilled water), 0.5 μL of forward primer, 0.5 μL of reverse primer, and 1 μL of template. The reaction program was: 95 ℃ pre-denaturation for 15 min; 95 ℃ denaturation for 10 s, 60 ℃ annealing / extension for 30 s, for 40 cycles; subsequently, melting curves were acquired according to the instrument's default program. 2^ -ΔΔCt The relative expression levels were calculated using a specific method. The results showed that SmAP2 / ERF16 was detected in the roots, stems, leaves, and petioles of *Salvia miltiorrhiza*. Among these, [the following text appears to be incomplete and requires further context: "for example,..."] Figure 2 As shown, the expression level is highest in the stem, followed by the petiole and leaf, and lowest in the root.

[0055] Example 2:

[0056] SmAP2 / ERF16 gene cloning.

[0057] Based on the new Salvia miltiorrhiza variety "Shu Dan 2," independently bred by their research group and recognized as a provincial-level non-major crop variety, the applicant used root cDNA of "Shu Dan 2" as a template for PCR amplification using PhantaMax MasterMix. The amplification system consisted of 10 μL Mix, 7 μL ddH2O, 1 μL upstream primer, 1 μL downstream primer, and 1 μL template. The reaction program was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 1 min, repeated 30 times; final extension at 72℃ for 10 min; and incubation at 12℃.

[0058] After PCR amplification, the target band was obtained by agarose gel electrophoresis. The target fragment was then purified using a DNA purification and recovery kit (purchased from Omega Bio-Tek, USA) according to the kit instructions. Subsequently, the SmAP2 / ERF16 target fragment and the plant expression vector pCAMBIA1305-UBQ10-GFP were double-digested with restriction endonucleases SwiftCut BamHI and SwiftCut SalI. The digestion system was as follows: 2 μL of 10×SwiftCut Buffer (10-fold concentrated reaction buffer), 1 μL of SwiftCut BamHI, 1 μL of SwiftCut SalI, 1 μg of DNA, and ddH2O to a final volume of 20 μL. After gel purification, the digested SmAP2 / ERF16 target fragment and linearized vector were ligated using T4 DNA ligase (purchased from TransGen Biotech, Beijing). The ligation system consisted of: 2 μL of 5×T4 DNALigase Buffer (a 5-fold concentrated reaction buffer for T4 DNA ligase), 3 μL of the SmAP2 / ERF16 target fragment, 1 μL of linearized vector, 1 μL of T4 DNA ligase, and ddH2O to a final volume of 10 μL. The ligation reaction was carried out at 25 °C for 2 h, ligating the SmAP2 / ERF16 gene between the UBQ10 promoter and the GFP reporter gene.

[0059] The ligation product was added to 100 μL of DH5α competent cells, gently patted to mix, and then incubated on ice for 30 min. The cells were then heat-shocked at 42℃ for 1 min, followed by incubation on ice for 2 min. 700 μL of sterile LB liquid medium was added, and the cells were incubated at 37℃ and 200 rpm for 30 min to recover. An appropriate amount of the bacterial culture was spread onto LB solid medium containing 50 μg / mL Kan and incubated upside down overnight at 37℃. Single clones were picked for PCR identification and sequencing verification. Positive transformants were screened, and the pCAMBIA1305-UBQ10-SmAP2 / ERF16-GFP recombinant expression vector was finally obtained.

[0060] Example 3:

[0061] Construction of transgenic hairy roots of Salvia miltiorrhiza.

[0062] The recombinant plasmid pCAMBIA1305-UBQ10-SmAP2 / ERF16-GFP was extracted from the positive clone bacterial culture obtained in Example 2 using a plasmid miniprep kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.) and following the kit instructions. The recombinant plasmid pCAMBIA1305-UBQ10-SmAP2 / ERF16-GFP and the overexpression empty vector pCAMBIA1305-UBQ10-GFP were transformed into *Agrobacterium rhizogenes* C58C1 via heat shock. Single clones were selected for PCR identification to obtain the *Agrobacterium rhizogenes* strain overexpressing *Agrobacterium rhizogenes* for genetic transformation of *Salvia miltiorrhiza* hairy roots.

[0063] Using the E-CRISP Design online tool (http: / / www.e-crisp.org / E-CRISP / ), two sgRNAs (sgRNA1 and sgRNA2) for SmAP2 / ERF16 were designed according to the 5'-NGG principle. The genomic distance between the designed sgRNAs did not exceed 500 bp. sgRNA1 is named GGCCTCAGCCCAGAAGACAG.

[0064] sgRNA2 is GCATCCTGACGCCCTTGTAG; the full sequence was synthesized after adding Avr II and Spe I restriction enzyme sites to both ends of the dual sgRNA expression cassette fragment containing AtU6-sgRNA1 and AtU6-sgRNA2. Subsequently, the synthesized fragment and the pCAMBIA1305-2×35S-Cas9 vector were double-digested using restriction endonucleases Avr II and Spe I, respectively. After digestion, the digested products were purified using a DNA purification kit according to the kit instructions. Finally, the dual sgRNA expression cassette was ligated into the linearized pCAMBIA1305-2×35S-Cas9 vector using T4 DNA ligase to obtain the recombinant plasmid pCAMBIA1305-AtU6-sgRNA1-AtU6-sgRNA2-2×35S-Cas9. The empty vector pCAMBIA1305-2×35S-Cas9 and the recombinant plasmid pCAMBIA1305-AtU6-sgRNA1-AtU6-sgRNA2-2×35S-Cas9 were transformed into Agrobacterium rhizogenes C58C1 by heat shock. Single clones were selected for PCR identification to obtain the CRISPR / Cas9 Agrobacterium rhizogenes strain for genetic transformation of hairy roots of Salvia miltiorrhiza.

[0065] Agrobacterium rhizogenes C58C1 cells carrying the SmAP2 / ERF16 overexpression vector, the empty overexpression vector, the CRISPR / Cas9 gene editing vector, and the empty CRISPR / Cas9 vector, respectively, were inoculated into liquid culture medium containing the corresponding antibiotics and cultured with shaking until the OD600 reached 0.6-0.8. The cultured bacterial suspensions were aliquoted into 50 mL sterile centrifuge tubes, centrifuged at 8000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in sterile MS liquid medium at the same volume as the original culture. The suspensions were thoroughly mixed to obtain the Agrobacterium suspension for infection.

[0066] Sterile tissue culture seedlings of *Salvia miltiorrhiza* with uniform growth were selected as genetic transformation materials. Roots were removed obliquely from the coleoptile using a sterile scalpel in a clean bench. The root-removed seedlings were then placed in a pre-prepared *Agrobacterium* solution and incubated with shaking for 20 min. After infection, the seedlings were blotted dry on sterile filter paper, and then inserted into 1 / 2 MS solid medium and co-cultured at 25°C in the dark for 2 days. The seedlings were then rinsed with sterile water to remove attached *Agrobacterium*, blotted dry on sterile filter paper, and transferred to hairy root solid medium. After culturing at 25°C in the dark for 1 day, they were further cultured at 25°C under 12 h light / 12 h dark conditions. Two to three weeks after infection, typical white hairy roots with multi-level lateral roots were induced at the explant incision site. When the hairy roots reached a length of 2-3 cm, individual hairy roots were separated and transferred to solid culture medium for subculture, followed by transfer to liquid culture medium and cultured at 25℃ and 100 rpm in the dark with shaking. Subculture was performed every 15 days until the hairy roots matured, yielding transgenic *Salvia miltiorrhiza* hairy root material for subsequent analysis. PCR amplification and identification were performed using the *Agrobacterium rhizogenes* Ri plasmid-specific gene RolB and a specific fragment of the SmAP2 / ERF16 gene in the overexpression vector. The primers used are as follows:

[0067] F-RolB: 5'-GCTCTTGCAGTGCTAGATTT-3';

[0068] R-RolB: 5'-GAAGGTGCAAGCTACCTCTC-3';

[0069] F-UBQ-AP2 / ERF16: 5'-TCGTCCATGCCGTGAGTGAT-3';

[0070] R-UBQ-AP2 / ERF16: 5'-CGGATATGGCTCGGCTCCTA-3'.

[0071] like Figure 3As shown in Figure A, wild-type hairy roots were designated as NC, and Agrobacterium rhizogenes carrying the target gene recombinant plasmid was designated as PC. NC only amplified the RolB gene band, while PC and the three overexpressed hairy roots amplified both the RolB gene and the UBQ-AP2 / ERF16 fragment, indicating that the three hairy roots were positive. For CRISPR / Cas9 gene-edited hairy roots, PCR amplification was performed using primers specific to the Agrobacterium rhizogenes gene RolB and the vector-specific gene Cas9, respectively. The Cas9 identification primers used are as follows:

[0072] F-Cas9: 5'-GCGGAGAATATCACTCAGGAGGAT-3';

[0073] R-Cas9: 5'-TCGGCACAGCATCAAGAAGAATC-3'.

[0074] like Figure 3 As shown in Figure B, wild-type hairy roots were designated as NC, and hairy roots transformed with the CRISPR / Cas9 empty vector were designated as PC. It can be seen that NC could only amplify the RolB gene, while both PC and CRISPR / Cas9 gene-edited hairy roots could amplify both the RolB and Cas9 genes, indicating that the three gene-edited hairy roots were positive. Then, using the genomes of the three positive hairy roots as templates, the dual-target region was amplified by PCR. The PCR product TA was cloned into an intermediate vector and sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing. The sequencing results are shown below. Figure 3 As shown in C, it can be seen that both target sites of the hairy root were edited to varying degrees.

[0075] Example 4:

[0076] Determination of SmAP2 / ERF16 expression level and salvianolic acid content in transgenic hairy roots.

[0077] After positive transgenic hairy roots were subcultured until their growth state stabilized, total RNA was extracted from the transgenic hairy roots and reverse transcribed into cDNA. Hairy roots transformed with the corresponding empty vector were used as controls. The relative expression level of transgenic hairy roots was detected by qRT-PCR. Figure 4 As shown in A, the expression levels of SmAP2 / ERF16 in the three hairy root overexpression lines were significantly higher than those in their control lines. Figure 4 As shown in B, the expression levels of SmAP2 / ERF16 in the three hairy root lines edited with the CRISPR / Cas9 gene were significantly lower than those in their control lines, indicating that transgenic induction was successful.

[0078] The hairy roots were dried to constant weight at 50℃, ground into dry powder, and the contents of rosmarinic acid and salvianolic acid B in the transgenic hairy roots were determined by HPLC. Figure 5As shown in Figure A, compared with the control overexpressing the empty vector, the rosmarinic acid content in the SmAP2 / ERF16 overexpression line increased to 1.4-1.6 times that of the control, and the salvianolic acid B content increased to 1.5-2.2 times that of the control; Figure 5 As shown in B, compared with the CRISPR / Cas9 empty vector control, the rosmarinic acid content in the SmAP2 / ERF16 gene-edited lines decreased to 61.45%-78.20% of the control, and the salvianolic acid B content decreased to 28.44%-42.47% of the control.

[0079] The above results indicate that upregulation of SmAP2 / ERF16 expression can significantly promote the accumulation of rosmarinic acid and salvianolic acid B in the hairy roots of Salvia miltiorrhiza, while inhibition or editing of SmAP2 / ERF16 function reduces the content of rosmarinic acid and salvianolic acid B, proving that SmAP2 / ERF16 is a positive regulator that promotes the accumulation of salvianolic acid in Salvia miltiorrhiza.

[0080] Example 5: Interaction, direct binding, and activation analysis of the SmAP2 / ERF16 and SmCYP98A14 promoters

[0081] Based on the SmCYP98A14 promoter sequence and the potential binding region of SmAP2 / ERF16, the core promoter fragment upstream of the SmCYP98A14 start codon was selected. Sma I and Sac I restriction sites were introduced at both ends of the fragment, and it was cloned into the pHIS2 vector to obtain the pHIS2-pSmCYP98A14 bait vector. EcoRI and BamHI restriction sites were introduced at both ends of the SmAP2 / ERF16 CDS fragment, and it was ligated into the pGADT7 vector to obtain pGADT7-SmAP2 / ERF16. The primers used are as follows:

[0082] F-pHIS2-CYP98A14:

[0083] 5'-CCCCCGGGCAAGATTCAGAATCTTTGGCTCAAC-3';

[0084] R-pHIS2-CYP98A14:

[0085] 5'-CGAGCTCAAACCCTAATCGCCAGCC-3';

[0086] F-pGADT7-AP2 / ERF16:

[0087] 5'-CGGAATTCATGGGTGAGGCCTCAGCCCA-3';

[0088] R-pGADT7-AP2 / ERF16:

[0089] 5'-CGGGATCCCTAGAAATTCCACATCCGCGAC-3'.

[0090] pGADT7-SmAP2 / ERF16 and pHIS2-pSmCYP98A14 were co-transformed into yeast Y187 competent cells, with co-transformation of pGADT7 empty vector and pHIS2-pSmCYP98A14 serving as a negative control. Self-activation inhibition and interaction screening were performed on SD / -Trp / -Leu / -His selective medium at a 3-AT concentration of 80 mM. Results are as follows: Figure 6 As shown, yeast co-transformed with pGADT7-SmAP2 / ERF16 and pHIS2-pSmCYP98A14 can grow normally on selective medium, while the negative control cannot grow normally, indicating that SmAP2 / ERF16 can interact with the SmCYP98A14 promoter.

[0091] To further verify the direct binding ability of SmAP2 / ERF16 protein to the SmCYP98A14 promoter fragment, the pRYE-HIS-SmAP2 / ERF16 prokaryotic expression vector was constructed and transformed into *E. coli* BL21. Positive clones were selected for amplification culture. When the OD600 of the bacterial culture reached 0.6-0.8, IPTG was added to a final concentration of 0.25 mM, and expression was induced overnight at 16 ℃ and 180 rpm. After induction, the bacterial cells were collected, and the supernatant was collected after sonication. The SmAP2 / ERF16 protein was obtained by His-tagged affinity purification. Subsequently, Cy5-labeled pCYP98A14 Probe, unlabeled pCYP98A14 Cold-Probe, and pCYP98A14 Mut-Probe were synthesized, and gel migration retardation assays were performed. EMSA results are shown below. Figure 7 As shown, only the free probe band was detected when only the labeled probe was present; a significant blocking band appeared after adding SmAP2 / ERF16 protein and pCYP98A14 probe; the blocking bands were significantly weakened after adding 10× and 50× cold competitive probes; and the binding ability of SmAP2 / ERF16 protein to the probe decreased after using a mutant probe. These results indicate that SmAP2 / ERF16 protein can specifically bind to the SmCYP98A14 promoter probe.

[0092] The reporter vector pGreenII-0800-pSmCYP98A14-LUC was constructed using the SmCYP98A14 promoter fragment, and the effect vector pGreenII-62-SK-SmAP2 / ERF16 was constructed using the SmAP2 / ERF16 coding sequence. The empty vector pGreenII-62-SK served as a control. The effect vector and reporter vector were combined and transformed into Agrobacterium, and transient co-expression was performed in tobacco leaves. After transient expression, the activities of firefly luciferase LUC and Renalis luciferase REN were measured, and the relative transcriptional activity of the SmCYP98A14 promoter was expressed as the LUC / REN ratio. The results are as follows: Figure 8 As shown, compared with the empty vector control, SmAP2 / ERF16 significantly enhanced the LUC / REN activity of the SmCYP98A14 promoter, indicating that SmAP2 / ERF16 has a positive activating effect on the SmCYP98A14 promoter. In summary, SmAP2 / ERF16 can promote SmCYP98A14 expression by binding to and positively activating the SmCYP98A14 promoter, thereby participating in the regulation of tanshinone biosynthesis.

[0093] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions will not cause the essence of the corresponding technical solutions to deviate from the protection scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of the SmAP2 / ERF16 gene in increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, characterized in that, The coding region nucleotide sequence of the SmAP2 / ERF16 gene is shown in SEQ ID NO: 1; The application involves overexpressing the SmAP2 / ERF16 gene in Danshen (Salvia miltiorrhiza).

2. The application of the SmAP2 / ERF16 gene according to claim 1 in increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, characterized in that, The amino acid sequence of the SmAP2 / ERF16 protein encoded by the SmAP2 / ERF16 gene is shown in SEQ ID NO:

2.

3. The application of the SmAP2 / ERF16 gene according to claim 1 in increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, characterized in that, The overexpression is achieved by exogenously introducing and expressing the coding sequence of the SmAP2 / ERF16 gene into Danshen.

4. The application of the SmAP2 / ERF16 gene according to claim 3 in increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, characterized in that, The exogenous SmAP2 / ERF16 gene was introduced into Danshen in the form of a recombinant expression cassette and expressed in Danshen.

5. The application of the SmAP2 / ERF16 gene according to any one of claims 1 to 4 in increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, characterized in that, The overexpression of the SmAP2 / ERF16 gene was carried out in the hairy roots of Salvia miltiorrhiza.

6. A recombinant expression cassette for increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, characterized in that, The recombinant expression cassette includes a promoter, a SmAP2 / ERF16 gene, and a terminator. The coding region nucleotide sequence of the SmAP2 / ERF16 gene is shown in SEQ ID NO:

1.

7. A plant recombinant expression vector for increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, characterized in that, The plant recombinant expression vector comprises the recombinant expression cassette as described in claim 6.

8. A recombinant Agrobacterium for increasing the content of salvianolic acid B and / or rosmarinic acid in Salvia miltiorrhiza, characterized in that, The recombinant Agrobacterium contains the plant recombinant expression vector as described in claim 7.

Images