Application of citrus CsARO1 gene in enhancing resistance of citrus to bacterial wilt

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of a citrus CsARO1 gene in enhancing resistance of citrus to bacterial wilt. The application constructs a VIGS vector of a CsARO1 coding sequence, transforms citrus by using an Agrobacterium tumefaciens mediation method, successfully reduces the transcription level of CsARO1 in the transgenic citrus, and obtains a VIGS plant in which the citrus CsARO1 gene is silenced. The application first clones the citrus CsARO1 gene, reduces the transcription level of the citrus CsARO1 by using VIGS silencing, verifies the function of CsARO1 in the resistance and susceptibility of citrus to bacterial wilt, has great application value for breeding of the citrus against bacterial wilt, lays a foundation for genetic breeding of the citrus against bacterial wilt, and greatly promotes development and application of gene engineering of the citrus against bacterial wilt.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the citrus CsARO1 gene in enhancing the resistance of citrus to citrus canker. Background Technology

[0002] Citrus canker ( Citrus bacterial canker CBC is a strain of Xanthomonas citrus (Citrullus xanthomonas). Xanthomonas citri subsp. Citri Citrus canker is a bacterial disease caused by Xcc, which affects most of the currently cultivated citrus varieties. Therefore, strengthening research on the prevention and control of citrus canker is an urgent need for the development of the citrus industry.

[0003] Traditional control methods for citrus canker, such as burning diseased trees and using pesticides, require significant manpower and resources and cause substantial environmental damage. Therefore, the control of citrus canker relies more heavily on cultivating new resistant germplasm. Molecular breeding, due to its ability to selectively and efficiently cultivate new resistant germplasm, has seen rapid development and widespread application. In recent years, biotechnology has yielded some citrus resources resistant to canker, such as Jincheng, Xinhui, and navel orange lines transgenic with the antimicrobial peptide D gene from silkworms; late-maturing Jincheng orange lines overexpressing CsBZIP40; and plants with enhanced resistance to citrus canker obtained through site-specific editing of the CsLOB1 promoter, a citrus canker susceptibility gene. However, high-quality candidate genes remain scarce, and their functions and mechanisms of action are not well understood. Therefore, there is an urgent need to specifically identify more genes closely related to citrus canker, deeply analyze their functions and mechanisms, and use them for molecular breeding to combat canker.

[0004] The ARO (aromatic amino acid synthesis-related proteins) family is widely distributed in various plants. It is a class of highly differentiated metabolic regulatory proteins encoded by multiple genes. Their core segments contain conserved aromatic amino acid synthesis catalytic domains, mediating key biochemical processes such as shikimate pathway metabolism, synthesis of phenolic disease-resistant substances, and supply of endogenous hormone precursors. They are a crucial protein family connecting primary plant metabolism with stress-immune regulation. Based on conserved catalytic motifs, phylogenetic evolution, and gene structure characteristics, the plant ARO family can be divided into multiple evolutionary branches. Typical ARO proteins all contain a characteristic conserved shikimate dehydrogenase domain, a hallmark feature distinguishing this family from other metabolic proteins. Currently, ARO family genes have been identified genome-wide in various crops, including Arabidopsis thaliana, rice, maize, and soybean. These proteins participate extensively in multiple biological processes, including plant organogenesis, cross-regulation of endogenous hormones, abiotic stress responses, and pathogen infection interactions, by regulating shikimate pathway flux and the balance of salicylic acid and phytoalexin synthesis. Existing studies have confirmed that pathogen infection can significantly disrupt the transcriptional level of host ARO family genes, reshape disease resistance pathways by increasing the accumulation of phenolic defense substances, regulate the plant's basic resistance to fungal and bacterial diseases, and change the rate of lesion expansion and the severity of disease.

[0005] Although there has been some basic research on the ARO-mediated auxin signaling pathway in the regulation of plant disease resistance, there are no reports on the in vivo functional verification and breeding application of the CsARO1 gene in the field of the interaction mechanism of citrus canker. Summary of the Invention

[0006] The purpose of this invention is to provide an application of citrus CsARO1 in enhancing the resistance of citrus to citrus canker. This invention is the first to clone the citrus CsARO1 gene. By transferring the citrus CsARO1 gene into citrus through the VIGS vector, the transcription level of citrus CsARO1 is reduced, which can significantly improve the resistance of citrus to citrus canker, reduce the severity of citrus canker, and does not affect the phenotype of transgenic plants.

[0007] To achieve the above objectives, the present invention provides the following technical solution: This invention provides the application of the citrus CsARO1 gene in enhancing resistance to citrus canker by reducing the transcription level of the CsARO1 gene in citrus. The nucleotide sequence of the citrus CsARO1 gene is shown in SEQ ID NO.1.

[0008] The present invention also provides a method for preventing and controlling citrus canker, including reducing the transcription level of the citrus CsARO1 gene by using VIGS silencing, wherein the nucleotide sequence of the citrus CsARO1 gene is shown in SEQ ID NO.1.

[0009] The present invention also provides a method for improving resistance to citrus canker, comprising the following steps: S1, VIGS fragment of the cloned citrus CsARO1 gene; S2. Construct the VIGS expression vector for CsARO1; The VIGS expression vectors of S3 and CsARO1 were transformed into citrus, resulting in VIGS plants in which the CsARO1 gene of citrus was silenced. The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.2.

[0010] Preferably, in step S1, the cloning method of the VIGS fragment is as follows: extract total RNA from citrus, reverse transcribe it into cDNA, and use the cDNA as a template to amplify the VIGS fragment of the citrus CsARO1 gene by high-fidelity enzyme PCR. The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.2.

[0011] More preferably, the primers used for the PCR amplification are CsARO1-VIGS-F and CsARO1-VIGS-R; The nucleotide sequence of CsARO1-VIGS-F is shown in SEQ ID NO.3; the nucleotide sequence of CsARO1-VIGS-R is shown in SEQ ID NO.4.

[0012] Preferably, in step S2, the VIGS expression vector is constructed as follows: the VIGS fragment obtained in step S1 is digested with EcoRI and KpnI enzymes, recovered, ligated with the TRV2 vector digested with the same enzymes, and transformed into competent E. coli cells. The plasmid is then extracted to obtain the VIGS vector of the CsARO1 gene.

[0013] Preferably, in step S3, the method for transforming citrus with the VIGS vector is as follows: the VIGS expression vector obtained in step S2 is transformed into Agrobacterium, an Agrobacterium bacterial solution containing the VIGS vector is prepared, and sterile citrus seedlings are infected. After verification by fluorescence observation, PCR and qRT-PCR, VIGS plants with the citrus CsARO1 gene silenced are obtained.

[0014] This invention also provides the application of using VIGS to silence and reduce the transcription level of CsARO1 in the breeding of citrus varieties resistant to citrus canker, wherein the nucleotide sequence of the CsARO1 gene is shown in SEQ ID NO.1.

[0015] The beneficial effects of this invention are: 1. This invention provides a citrus CsARO1 gene and its application in enhancing citrus resistance to citrus canker. By constructing a VIGS vector for the citrus CsARO1 gene and transforming citrus with Agrobacterium-mediated transformation, the resulting citrus plants showed significant resistance to citrus canker, with a reduction in lesion area of ​​36.43%~44.57% and a reduction in disease index of 36.61%~47.54%, significantly alleviating the severity of citrus canker. 2. The present invention provides a citrus CsARO1 gene and its application in enhancing the resistance of citrus to citrus canker. Silencing the citrus CsARO1 gene VIGS can significantly reduce the incidence of citrus canker, and silencing the citrus CsARO1 gene VIGS does not affect the phenotype of citrus plants. 3. The present invention provides a citrus CsARO1 gene and its application in enhancing the resistance of citrus to citrus canker. The citrus CsARO1 gene can also be used as a candidate gene to work in conjunction with multiple citrus canker resistance and susceptibility genes using VIGS silencing, RNA interference and gene editing technologies to carry out citrus canker resistance breeding, which has significant application value in citrus ... Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 Bioinformatics feature map of CsARO1 in citrus; Figure 2 Electrophoresis image of PCR amplification of the VIGS fragment encoding the CsARO1 gene; Figure 3 Here is a diagram of the VIGS carrier structure of CsARO1; Figure 4 This is a PCR identification diagram of transgenic plants; Figure 5 Image showing qRT-PCR detection of CsARO1 expression in VIGS plants; Figure 6 Phenotypic diagram of VIGS plants; Figure 7 Disease incidence 10 days after VIGS plants were inoculated with ulcer pathogens on their leaves; Figure 8 A statistical chart of lesion area on leaves of VIGS plants 10 days after inoculation with ulcer pathogen; Figure 9 A statistical chart of disease index of VIGS plant leaves 10 days after inoculation with ulcer pathogen. Detailed Implementation

[0018] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0019] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0020] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0021] Example 1: Bioinformatics Analysis of CsARO1 in Citrus Bioinformatics characteristics of the citrus CsARO1 gene, such as Figure 1 As shown in AC, Figure 1 A, Chromosomal location of the citrus CsARO1 gene; B, Gene structure of citrus CsARO1; C, Conserved domain of citrus CsARO1. The citrus CsARO1 gene is located between 31539470 bp and 31541596 bp on chromosome 8 of citrus, contains one exon, and encodes 654 amino acids.

[0022]

[0023] Example 2: Cloning of VIGS Fragments 2.1 RNA extraction and cDNA synthesis Total RNA was extracted from citrus (Late Orange) leaves using a plant total RNA extraction kit. RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using the PrimeScript RT Master Mix reverse transcription kit and stored at -20°C for later use.

[0024] 2.2 VIGS Fragment Amplification The VIGS fragment of the CsARO1 encoding gene, 331 bp in length, was cloned from citrus cDNA using primers CsARO1-VIGS-F and CsARO1-VIGS-R and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase. Figure 2 As shown. Under UV light, the agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1).

[0025] PCR amplification program: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min.

[0026] CsARO1-VIGS-F:GAATTCTGCAGCCAATGAGCCTATCTTG (SEQ ID NO. 3); CsARO1-VIGS-R:GGTACCCACGGATTGAACTTCATATGACCG (SEQ ID NO.4); VIGS fragment of the gene encoding CsARO1: TGCAGCCAATGAGCCTATCTTGTGTCTCATCTGGGAACAAATTGCAATTCTTCACACGGGTTCAATGGAAGAGAAATGCGATGCTGCTGCATCATTGGTCTCCTTGGCTCGCGATAACGATCGTTACGGAAAGCTGATTATAGAAGAAGGTGGCGTCC CTCCGCTGCTGAAACTAGCTTATGAAGGGGAATTAGAAGGTCAGGAGAATGCTGCGAGGGCTATAGGATTGTTAGGACGCGACGCCGAAAGTGTCGAACAGATTGTGAATGCCGGTGTTTGCTCTACGTTTTGCCAAAAACCTCAAGGACGGTCATATGAAAGTTCAATCCGTG (SEQ ID NO.2).

[0027] Example 3: Construction of VIGS Vector The VIGS fragments of the TRV2 and CsARO1 genes in the VIGS vector were digested with EcoRI and KpnI, recovered by gel electrophoresis, and then the two fragments were ligated and transformed into competent E. coli cells. Plasmids were extracted to obtain the VIGS expression vector TRV2-CsARO1.

[0028] The VIGS carrier structure of CsARO1 is as follows: Figure 3 As shown, GFP: green fluorescent protein; RdRp: NA-dependent RNA polymerase; CP: coat protein; 35S: plant constitutive promoter derived from cauliflower mosaic virus; NOS: crown gall synthase gene terminator; LB: left homologous arm; RB: right homologous arm. Agrobacterium tumefaciens was transformed with the vector TRV2-CsARO1 by electroporation to prepare Agrobacterium tumefaciens bacterial culture containing the CsARO1 gene in the VIGS expression vector.

[0029] Example 4: VIGS vector transformation of citrus 4.1 Activation of Agrobacterium tumefaciens 500 μL of each of the following Agrobacterium tumefaciens cultures were added to 50 mL of liquid LB medium (containing kanamycin: 50 mg / L) and cultured at 28 °C and 200 r / min until OD500. 600 =1; Collect bacterial cells, resuspend in MMA (10 mM MgCl2, 10 nM MES, 100 μM acetylsuccinone) solution, and adjust OD. 600=1; Mix TRV1 with TRV2 and TRV2-ARO1 vectors at a volume ratio of 1:1 and incubate at room temperature for 3 h.

[0030] 4.2 Agrobacterium infection Sterile seedlings with radicles reaching 3 cm in length were immersed in Agrobacterium tumefaciens solution and vacuumed for 1 minute. They were then rinsed 3-5 times with sterile water and cultured in seed culture medium at room temperature in the dark for 2-3 days. If green fluorescence was observed, the seedlings were considered positive. They were then transferred to soil for cultivation at 25°C with 16 h light / 8 h dark conditions and watered regularly.

[0031] 4.3 Identification and phenotypic observation of VIGS plants 4.3.1 PCR identification Seedlings showing green fluorescence under ultraviolet light were considered positive and were subsequently transferred to nutrient soil culture medium. One month later, tissues were collected to extract DNA and total RNA, which were then verified by PCR using two pairs of primers: CsARO1-ID1-F / CsARO1-ID1-R, CsARO1-ID2-F / CsARO1-ID2-R, and CsARO1-ID2-F / CsARO1-VIGS-R.

[0032] The results are as follows Figure 4 As shown in AC, Figure 4 PCR detection results of VIGS plants: +, positive control; -, negative control; M, molecular weight standard; TRV2, plant with empty vector; TRV2-CsARO1-1, TRV2-CsARO1-2, TRV2-CsARO1-3, plants transformed with CsARO1-based VIGS vectors; A: TRV1; B: TRV2; C: Detection results for the two vectors. Primer pairs CsARO1-ID1-F / R and CsARO1-ID2-F / R amplified 150 bp bands in TRV2 and TRV2-CsARO1 plants, respectively; primer pair CsARO1-ID2-F / CsARO1-VIGS-R showed no amplification in TRV2 plants, but amplified a 482 bp band in TRV2-CsARO1 plants.

[0033] PCR reaction conditions: 95℃, 3 min; 95℃, 30 s, 58℃, 30 s, 72℃, 30 s, 30 cycles; 72℃, 10 min.

[0034] CsARO1-ID1-F: GCTATTCGTATAGGGACAATCCG (SEQ ID NO.5); CsARO1-ID1-R: GAGCAATCTGCTCATGAGTGAGG (SEQ ID NO.6); CsARO1-ID2-F: ATTCACTGGGAGATGATACGCT (SEQ ID NO.7); CsARO1-ID2-R:GAATCTAAGTCCACTCGTCCGT (SEQ ID NO. 8).

[0035] 4.3.2 qRT-PCR analysis qRT-PCR was performed using primers CsARO1-RT-F and CsARO1-RT-R to verify whether CsARO1 was successfully silenced. The gene expression level of plants transfected with empty TRV1 and TRV2 vectors was set to 1. If the CsARO1 gene expression level in plants containing the target fragment vector was less than 1, gene silencing had occurred. The identification results are as follows: Figure 5 As shown, Figure 5 The differences were statistically significant (P≤0.05); TRV2, plants with the empty vector; TRV2-CsARO1, plants transfected with the CsARO1 VIGS vector. The CsARO1 transcription level decreased by 46.90%–60.78%.

[0036] qRT-PCR reaction conditions: 95℃, 3 min; 95℃, 10 s; 56℃, 30 s; 72℃, 20 s, 40 cycles; followed by melting curve analysis: 95℃, 15 s; 60℃, 60 s; then temperature increased to 95℃.

[0037] CsARO1-RT-F:AACTGGTTGTCAAATGCCGC (SEQ ID NO.9); CsARO1-RT-R: TGTTTTCCGAAATGCCGCAG (SEQ ID NO. 10).

[0038] 4.3.3 Phenotypic Observation The phenotype of VIGS plants with the CsARO1 gene was observed, and the results are as follows: Figure 6 As shown, no obvious abnormalities were found in appearance or growth. This indicates that silencing CsARO1 did not have a significant impact on the plant's phenotype and development.

[0039] 4.4 Evaluation of VIGS plant resistance Mature leaves of transgenic plants were washed, disinfected with 75% alcohol, and rinsed with sterile water before being placed in a clean bench. Acupuncture was performed around the leaf veins, and 1 μL (1×10⁻⁶) of ulcer bacteria solution was pipetted into each puncture site. 5CFU / mL); cultured in a constant temperature and light incubator at 28℃ (16 h light / 8 h dark); photographed leaves 10 days after inoculation, and the area of ​​lesions was counted using ImageJ software.

[0040] The disease is classified into grades 0-7 based on the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm). 2 Level 1 (0.25 mm) 2 <R≤0.5 mm 2 Level 2 (0.5 mm) 2 <R≤0.75 mm 2 Level 3 (0.75 mm) 2 <R≤1 mm 2 Level 4 (1.0 mm) 2 <R≤1.25 mm 2 Level 5 (1.25 mm) 2 <R≤1.5 mm 2 Level 6 (1.5 mm) 2 <R≤1.75 mm 2 Level 7 (R > 1.75 mm) 2 The disease index is calculated according to the formula: DI = 100 × Σ [number of lesions at each level × corresponding level value] / (total number of lesions × maximum level).

[0041] The results are as follows Figures 7-9 As shown, 10 days after inoculation with the citrus canker pathogen, the symptoms of VIGS plants inoculated with CsARO1 were significantly reduced; the lesion area decreased by 36.43%–44.57%; and the disease index decreased by 36.61%–47.54%. Therefore, silencing the CsARO1 gene can enhance resistance to citrus canker.

[0042] In summary, this invention significantly reduces the lesion area and severity of citrus canker by silencing CsARO1. The CsARO1 gene provided by this invention can be silenced using various techniques for molecular breeding of citrus canker resistance, or it can be used synergistically with other resistance or susceptibility genes in molecular breeding for citrus canker resistance, demonstrating significant application value in citrus canker resistance breeding.

[0043] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of the citrus CsARO1 gene in enhancing resistance to citrus canker, characterized in that, Enhance citrus canker resistance by reducing the transcription level of the CsARO1 gene in citrus; The nucleotide sequence of the citrus CsARO1 gene is shown in SEQ ID NO.

1.

2. A method for preventing and controlling citrus canker, characterized in that, This includes using VIGS silencing to reduce the transcription level of the citrus CsARO1 gene, the nucleotide sequence of which is shown in SEQ ID NO.

1.

3. A method for improving resistance to citrus canker, characterized in that, Includes the following steps: S1, VIGS fragment of the cloned citrus CsARO1 gene; S2. Construct the VIGS expression vector for CsARO1; The VIGS expression vectors of S3 and CsARO1 were transformed into citrus, resulting in VIGS plants in which the CsARO1 gene of citrus was silenced. The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.

2.

4. The method for improving resistance to citrus canker according to claim 3, characterized in that, In step S1, the cloning method of the VIGS fragment is as follows: extract total RNA from citrus, reverse transcribe it into cDNA, and use the cDNA as a template to amplify the VIGS fragment of the citrus CsARO1 gene by high-fidelity enzyme PCR. The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.

2.

5. The method for improving resistance to citrus canker according to claim 4, characterized in that, The primers used for the PCR amplification were CsARO1-VIGS-F and CsARO1-VIGS-R; The nucleotide sequence of CsARO1-VIGS-F is shown in SEQ ID NO.3; the nucleotide sequence of CsARO1-VIGS-R is shown in SEQ ID NO.

4.

6. The method for improving resistance to citrus canker according to claim 4, characterized in that, In step S2, the VIGS expression vector is constructed as follows: the VIGS fragment obtained in step S1 is digested with EcoRI and KpnI enzymes, recovered, ligated with the TRV2 vector digested with the same enzymes, and transformed into competent E. coli cells. The plasmid is extracted to obtain the VIGS vector of the CsARO1 gene.

7. The method for improving resistance to citrus canker according to claim 4, characterized in that, In step S3, the method for transforming citrus with the VIGS expression vector is as follows: the VIGS vector obtained in step S2 is transformed into Agrobacterium, Agrobacterium bacterial suspension containing the VIGS vector is prepared, and sterile citrus seedlings are infected. After verification by fluorescence observation, PCR and qRT-PCR, VIGS plants with the citrus CsARO1 gene silenced are obtained.

8. The application of VIGS silencing to reduce CsARO1 transcription levels in the breeding of citrus canker resistant varieties, characterized in that... The nucleotide sequence of the CsARO1 gene is shown in SEQ ID NO.1.

Images