Construction method and application of lotus japonicus rna i transient gene silencing system

Abstract

The application discloses a construction method of a Lotus corniculatus RNAi transient gene silencing system, which comprises the following steps: taking a Lotus corniculatus LcHDZ1 gene as a target, and selecting an RNAi interference fragment with a length of 432 bp; respectively amplifying a sense strand and an antisense strand of the RNAi interference fragment through PCR; inserting the sense strand into a pCAMBIA-35SI expression vector through a BamH I and Spe I restriction endonuclease site, and inserting the antisense strand into the same expression vector through an Xba I and Pst I restriction endonuclease site, so as to obtain a pCAMBIA-35SI-LcHDZ1 RNAi plant expression vector; and transferring the plant expression vector into Agrobacterium GV3101; and introducing Agrobacterium bacterial liquid containing the plant expression vector into a Lotus corniculatus branch in a vacuum infiltration mode by taking the Lotus corniculatus branch as a transformation material. The application takes an HD-ZIP transcription factor family member LcHDZ1 as a functional gene, and establishes and optimizes a Lotus corniculatus RNAi transient gene silencing system.

Description

Technical Field

[0001] This invention relates to the bio-agriculture related technology industry, particularly to the fields of plant molecular biology, plant transient transformation, RNA interference, and functional gene verification of leguminous forage grasses. Specifically, it relates to a method for constructing an RNAi transient gene silencing system suitable for Lotuscorniculatus L. branches, and the application of this system in verifying the drought resistance function of the LcHDZ1 ​​gene. Background Technology

[0002] Lotus corniculatus L. is an important leguminous forage crop, possessing multiple values ​​including fodder, honey source, soil and water conservation, and horticultural ornamental value. Furthermore, due to its relatively mature genetic transformation and complete genomic information, it has become an ideal model material for studying the developmental biology and abiotic stress response mechanisms of leguminous plants. In functional genomics research on lotus corniculatus, rapid and high-throughput functional validation of genes related to key traits such as drought resistance and salt tolerance is a crucial link connecting gene sequences with biological functions.

[0003] Currently, gene function verification mainly relies on stable genetic transformation technology. However, traditional Agrobacterium-mediated stable transformation systems typically require cumbersome steps such as tissue culture, screening, regeneration, and progeny purification, taking months or even longer, and are characterized by low transformation efficiency and high experimental costs. For *Lotus sibiricum*, the long stable transformation cycle is particularly prominent, severely hindering the progress of large-scale gene function screening. Traditional stable genetic transformation usually involves multiple steps, including explant treatment, Agrobacterium infection, resistance screening, callus induction, plant regeneration, and identification of transformed materials. It suffers from limitations such as strong genotype dependence, long transformation cycle, low efficiency, and complex operation, making it difficult to meet the needs of rapid functional identification of a large number of candidate genes. In contrast, transient transformation does not require obtaining stable genetic progeny and can complete exogenous gene expression or target gene silencing in a shorter time, making it more suitable for preliminary and rapid verification of target gene function.

[0004] RNA interference (RNAi) is a post-transcriptional gene silencing mechanism that inhibits gene expression by expressing constructs containing double-stranded RNA with hairpin structures, which specifically degrades the mRNA of target genes. Compared to stable transformation, transient RNAi expression systems do not require integration of exogenous genes into the host chromosome and can silence target genes in a short time, offering advantages such as short experimental cycles, high specificity, and high efficiency, and have been widely used in plant gene function identification. However, existing transient RNAi silencing technologies are mainly used in model plants such as Arabidopsis thaliana and tobacco, or in leaf injection systems. When directly applied to Pistacia chinensis branches, they often face problems such as unstable transformation efficiency and inconsistent silencing effects.

[0005] For the specific species *Lotus sibiricum*, especially the *Agrobacterium* vacuum infiltration system using its branches as explants, there is currently a lack of systematic optimization of technical parameters. Key factors affecting transient transformation efficiency include *Agrobacterium* bacterial concentration, vacuum pressure, and infiltration time. These parameters vary among different plant materials, and existing reports have not provided the optimal parameter combination for transient RNAi transformation of *Lotus sibiricum* branches. Furthermore, how to efficiently form hairpin structures with RNAi interference fragments in *Lotus sibiricum* and trigger sustained and stable gene silencing, and how to accurately define the optimal analytical window for silencing effects, are all technical challenges that urgently need to be addressed in this field. Summary of the Invention

[0006] The purpose of this invention is to provide a method for constructing an RNAi transient gene silencing system specifically for Lophatherum gracile branches that is simple to operate and has a short cycle, in order to solve the technical problems of long stable transformation cycle, low transient transformation efficiency and unstable silencing effect in the existing Lophatherum gracile gene function verification, thereby providing a reliable technical platform for efficient and rapid verification of target gene functions in Lophatherum gracile and leguminous plants.

[0007] Based on the first major aspect of the present invention, a method for constructing a transient gene silencing system using *Platypha latifolia* RNAi is provided, comprising the following steps:

[0008] Using the LcHDZ1 ​​gene of *Lotus Root* as the target, an RNAi interference fragment of 432 bp was selected;

[0009] The sense and antisense strands of the RNAi interference fragment were amplified by PCR, respectively.

[0010] The sense strand was inserted into the pCAMBIA-35SI expression vector via BamHI and SpeI restriction endonuclease sites, and the antisense strand was inserted into the same expression vector via XbaI and PstI restriction endonuclease sites to obtain the pCAMBIA-35SI-LcHDZ1 ​​RNAi plant expression vector.

[0011] The plant expression vector was transformed into Agrobacterium GV3101;

[0012] Using Lophatherum gracile branches as recipient material, Agrobacterium tumefaciens bacterial solution containing the plant expression vector was introduced into Lophatherum gracile branches via vacuum permeation.

[0013] The above scheme is the first to integrate RNAi technology with vacuum infiltration into the specific explant type of Lophatherum gracile branches. By designing hairpin-structured RNA to trigger the posttranscriptional gene silencing mechanism, it provides a complete and operable basic technical framework for achieving transient gene silencing in Lophatherum gracile, fundamentally solving the problem that existing technologies lack a specific RNAi transient silencing scheme for Lophatherum gracile branches.

[0014] Optionally, the nucleotide sequence of the RNAi interference fragment is shown in SEQ ID NO:1.

[0015] The choice of fragment length ensures the effectiveness of siRNA generation while avoiding the risks of insufficient silencing efficiency due to excessively short fragments or non-specific gene silencing due to excessively long fragments. This ensures a specific knockdown effect on the LcHDZ1 ​​gene and provides a sequence-level guarantee for solving the problems of unstable silencing effect and poor specificity.

[0016] Optionally, the primers used to amplify the positive strand include LcHDZ1-i1-F and LcHDZ1-i1-R, whose sequences are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively;

[0017] The primers used to amplify the antisense strand include LcHDZ1-i2-F and LcHDZ1-i2-R, whose sequences are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

[0018] Each primer introduces BamHI, SpeI, XbaI, and PstI restriction sites and protective bases, enabling the sense and antisense strands to efficiently insert into the corresponding sites of the vector in the predetermined direction. This avoids non-directional ligation and self-ligation problems, providing a key tool for improving the success rate of vector construction and shortening the system establishment cycle.

[0019] Optionally, the PCR amplification system is a 20 μL system, including 1.0 μL of cDNA template, 1.0 μL of LcHDZ1-i1 / 2-F, 1.0 μL of LcHDZ1-i1 / 2-R, 10 μL of Ex Taq enzyme, and ddH2O to make up to 20 μL;

[0020] The PCR amplification program was 94℃ for 3 min, followed by 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 2 min, and finally 72℃ for 5 min, and stored at 4℃.

[0021] The above scheme ensures that the 432 bp interference fragment can stably and efficiently obtain sufficient amplification products, avoids the generation of non-specific bands, and thus ensures the smooth progress of the vector construction step, providing time savings at the process level to solve the problem of long system establishment cycle.

[0022] Optionally, before vacuum permeation, the method further includes a step of activating Agrobacterium GV3101 carrying the plant expression vector, including: collecting Agrobacterium GV3101 cells by centrifugation, resuspending them in a suspension buffer containing 100 μmol / L acetylsyl syringone, and allowing them to stand for 60 min in the dark at room temperature.

[0023] The above scheme effectively activates the infection activity of Agrobacterium by setting a cell activation pretreatment step before vacuum infiltration. This activation treatment works synergistically with the subsequent vacuum infiltration conditions of 60 kPa and 15 min to significantly improve the infection efficiency of Agrobacterium carrying RNAi expression vectors on Lophatherum gracile root branch cells.

[0024] Among them, acetylsuccinone, as a vir gene inducer, can significantly enhance the infection activity of Agrobacterium. Static treatment allows the vir gene to be fully expressed, thereby improving the efficiency of T-DNA delivery to Lophatherum gracile root branch cells during the subsequent vacuum infiltration process. This is a key prerequisite for achieving high transformation rate and directly solves the core problem of low transformation efficiency.

[0025] Optionally, the optimal conditions for vacuum permeation are: Agrobacterium tumefaciens bacterial solution OD 600 The value is 1, the vacuum pressure is 60 kPa, and the permeation time is 15 min.

[0026] This parameter combination was optimized using an L9 orthogonal experimental system to achieve the best possible balance. Among the three factors, bacterial concentration had the greatest impact on conversion efficiency (range R = 15.02), followed by pressure and osmosis time, which decreased sequentially. Under optimal conditions, the instantaneous conversion efficiency reached 43.75%. The synergistic optimization of these three parameters directly determined the upper limit of the RNAi system's conversion efficiency and made a decisive contribution to solving the problem of low conversion efficiency.

[0027] Optionally, after vacuum infiltration, the Lobelia chinensis branches are placed on the surface of a floating board and hydroponically cultured in a dark environment at 26°C for 24 hours, and then transferred to a greenhouse at 28°C for further cultivation.

[0028] Dark culture facilitates Agrobacterium attachment and T-DNA transfer, while floating hydroponics provides sufficient water to the cuttings and avoids hypoxia. A 28°C greenhouse environment promotes recipient cell recovery and gene expression. These post-culture steps ensure that the introduced RNAi construct can be successfully transcribed to form hairpin double-stranded RNA and initiate gene silencing. As a result, GUS staining appears as early as 2 days after transformation and interference effects are continuously observed from 2 to 14 days. This makes an important contribution to achieving rapid manifestation and sustained stability of the silencing effect.

[0029] Based on the second main aspect of this invention, a transient gene silencing system for *Platycarpus macrocarpa* RNAi is provided, constructed by the aforementioned method. This system itself is considered a protected technical object, encompassing the complete technical product formed throughout the entire process from vector construction to post-transformation culture.

[0030] Based on the third main aspect of this invention, the application of the aforementioned method or system in rapid validation of gene function in *Lobelia chinensis* is provided. This application clarifies the market positioning of this RNAi transient silencing system as a gene function research tool and solves the bottleneck of traditional stable transformation, which is difficult to achieve high-throughput gene function screening due to its long cycle.

[0031] Optionally, the root gene is LcHDZ1, and the application includes:

[0032] Plants transformed with the empty pCAMBIA-35SI vector were used as controls, and plants transformed with the pCAMBIA-35SI-LcHDZ1 ​​RNAi plant expression vector were used as RNAi plants. Functional analysis of the target genes was performed 4-6 days after transformation.

[0033] The above scheme defines the specific implementation of the system in verifying the drought resistance function of LcHDZ1, especially clarifying that 4-6 days is the optimal gene function analysis window (the period with the strongest silencing effect). This enables those skilled in the art to directly reproduce the entire process of LcHDZ1 ​​functional analysis according to the scheme, providing an operable technical template for the practical application of the system. At the same time, it has a substantial promoting effect on accelerating the discovery and utilization of drought resistance gene resources in leguminous forage grasses.

[0034] Compared with the empty vector control without RNAi intervention, the experimental data of this invention show that:

[0035] 1. RNAi transient conversion system at OD 600 An instantaneous conversion rate of 43.75% was obtained under the conditions of 1, vacuum pressure of 60 kPa, and permeation time of 15 min.

[0036] 2. GUS staining was observed 2 days after RNAi transformation, reaching its deepest point at 8 days, and gradually fading from 8 to 12 days. Target gene expression assays showed effective gene interference for 2-8 days post-transformation. The abstract further summarizes that the gene expression duration of the RNAi system is 2-14 days, with 4-6 days being the optimal period for gene function analysis.

[0037] 3. RNAi plants were subjected to drought stress treatment. After 24 h of drought treatment with 2.5% PEG6000, the degree of wilting was lower than that of EV control plants; the relative water content was 38.43±1.88%, while that of EV control was 27.26±2.41%, and the relative water content of RNAi plants was 41% higher than that of EV control.

[0038] 4. The relative conductivity of RNAi plants was 20.56±0.37%, while that of the EV control was 24.44±0.87%, a decrease of 16% compared to the EV group; the activities of POD, SOD, and CAT were 6024.6±30.9 U / g, 444.3±11.1 U / g, and 381.1±8.6 U / g, respectively, which were 26.4%, 63.1%, and 42.2% higher than those of the EV control.

[0039] 5. The MDA content of RNAi plants was 74.2±0.5 nmol / g, while that of the EV control was 87.26±1.1 nmol / g, a decrease of 17.6%; the Pro content of RNAi plants was 85.4±2.4 μg / g, while that of the EV control was 126.8±2.6 μg / g, a decrease of 32.2%.

[0040] Compared with existing technologies, this invention uses LcHDZ1, a member of the HD-ZIP transcription factor family with drought resistance regulation function, as a functional gene to establish and optimize the transient gene silencing agent of Lophatherum splendens RNAi. It reveals the molecular mechanism by which the LcHDZ1 ​​gene participates in drought stress response by regulating the ABA signaling pathway, thus providing a reliable technical platform for rapid and high-throughput verification of gene functions in Lophatherum splendens and leguminous forage grasses. Attached Figure Description

[0041] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, obtaining other drawings based on these drawings without creative effort still falls within the scope of the present invention.

[0042] Figure 1 The diagram shows the amplification and sequencing identification of the LcHDZ1 ​​RNAi fragment in one embodiment of the present invention; A is the electrophoresis of the PCR product, M is DL2000, 1 is the sense strand, 2 is the antisense strand; B is the 432 bp RNAi fragment sequence.

[0043] Figure 2 A schematic diagram of the modification of the pCAMBIA-35SI RNAi interference vector in one embodiment of the present invention is shown; A is the vector before modification, and B is the vector after modification.

[0044] Figure 3 The diagram shows the construction of the pCAMBIA-35SI-LcHDZ1 ​​RNAi plant expression vector in one embodiment of the present invention; A is the vector map, B is the RNAi plasmid double enzyme digestion result, and C is the Agrobacterium colony PCR result.

[0045] Figure 4The diagram shows the effectiveness analysis of the Bai Mai Gen RNAi system in one embodiment of the present invention; A is GUS staining, and B is the relative expression level of LcHDZ1.

[0046] Figure 5 The diagram shows GUS staining and LcHDZ1 ​​expression levels at different transformation days in one embodiment of the present invention; A represents GUS staining from 0 to 14 days, and B represents the relative expression level of the LcHDZ1 ​​gene.

[0047] Figure 6 The diagram illustrates the effect of VIGS and RNAi silencing of LcHDZ1 ​​on the phenotype of Piper nigrum under drought stress in one embodiment of the present invention.

[0048] Figure 7 The diagram shows physiological parameters of RNAi plants and EV control plants after 24 h of drought treatment with 2.5% PEG in one embodiment of the present invention; A is relative conductivity, B is POD activity, C is SOD activity, D is CAT activity, E is MDA content, and F is Pro content.

[0049] Figure 8 The image shows DAB and NBT staining images of RNAi-silenced plants and EV control plants after 24 h of drought treatment with 2.5% PEG in one embodiment of the present invention. Detailed Implementation

[0050] The preferred embodiments of the present invention will be described in detail below to provide a clearer understanding of the purpose, features, and advantages of the invention. It should be understood that the following embodiments are not intended to limit the scope of the invention, but are merely illustrative of the essential spirit of the technical solution of the invention.

[0051] In the following description, certain specific details are set forth for the purpose of illustrating various disclosed embodiments in order to provide a thorough understanding of the various disclosed embodiments. However, those skilled in the art will recognize that embodiments may be practiced without one or more of these specific details. In other instances, well-known techniques associated with the invention may not have been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments.

[0052] Throughout this specification, references to "an embodiment" or "an embodiment" indicate that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Therefore, the appearance of "in an embodiment" or "an embodiment" in various places throughout the specification does not necessarily refer to the same embodiment. Furthermore, a particular feature, structure, or characteristic may be combined in any manner in one or more embodiments.

[0053] The specific meanings of the technical terms that may be involved in the following embodiments are explained below:

[0054] RNA interference (RNAi) is a common post-transcriptional gene silencing mechanism in eukaryotes. In this invention, hairpin RNA (hpRNA) containing an inverted repeat sequence of the LcHDZ1 ​​gene fragment is expressed under the 35S promoter to mimic dsRNA, triggering the RNAi mechanism and achieving transient silencing of the LcHDZ1 ​​gene.

[0055] Hairpin RNA (hpRNA): refers to a stem-loop structure formed by the annealing pairing of inverted complementary sequences at both ends of a single-stranded RNA molecule. The "stem" is a double-stranded region formed by the complementary pairing of inverted repeat sequences, and the "loop" is a single-stranded loop region formed by the connecting sequence (such as an intron) in the middle.

[0056] Vacuum infiltration is a method of instantaneous transformation that uses a negative pressure environment to introduce Agrobacterium tumefaciens bacterial solution into the interstitial spaces of plant tissues. The principle is that under vacuum conditions, air is extracted from the interstitial spaces of plant tissues. After the vacuum is released, the external bacterial solution rapidly penetrates into the tissue under the pressure difference, allowing Agrobacterium tumefaciens to fully contact the plant cells, thereby improving T-DNA transfer efficiency.

[0057] Transient transformation refers to the phenomenon where a foreign gene, after entering plant cells via Agrobacterium-mediated transformation or other means, is temporarily expressed without integration into the host chromosome. Compared to stable transformation, transient transformation has the advantages of shorter cycle, no need for tissue culture, and simpler operation, making it suitable for rapid preliminary verification of gene function. In this invention, the RNAi construct, after entering Lophatherum gracile root branch cells, does not integrate into the genome and continuously produces interference effects within 2-14 days, which is a typical transient transformation system.

[0058] The pCAMBIA-35SI vector upon which the hairpin transcript depends: The pCAMBIA-35SI vector used in this invention is an RNAi-specific plant expression vector modified based on the pCAMBIA series backbone. Its core structural features include: a CaMV 35S strongly constitutive promoter, an artificial intron sequence, and two multiple cloning sites (MCS1 and MCS2) located flanking the intron. The sense and antisense strands of the target gene can be inserted into MCS1 and MCS2, respectively, resulting in a 5′-sense strand-intron-antisense strand-3′ primary transcript after transcription. Subsequently, due to intron cleavage, the complementary sequences on both sides anneal to form a hairpin double-stranded RNA.

[0059] GUS histochemical staining is a commonly used histochemical method for detecting the activity of the β-glucuronidase (GUS) reporter gene.

[0060] PEG6000 drought simulation treatment: This is a common method used in the laboratory to simulate soil drought stress using a solution of the polymer polyethylene glycol (PEG). PEG6000, when dissolved in water, lowers the water potential, placing plant roots or tissues under osmotic stress, thus simulating a drought environment.

[0061] Example 1: Design and Amplification of LcHDZ1 ​​RNAi Interference Fragments

[0062] Using *Lotus styrax* cDNA as a template, the conserved sequence of the LcHDZ1 ​​gene was selected as the RNAi target sequence. This fragment is 432 bp long. The sense and antisense strands were constructed in two stages, with forward insertion followed by reverse insertion. The primers for RNAi fragment amplification are shown in Table 1 below.

[0063] Table 1: Primers and Sequence List for RNAi Fragment Amplification

[0064]

[0065] The PCR amplification reaction system is shown in Table 2 below.

[0066] Table 2: PCR amplification reaction system

[0067]

[0068] The PCR amplification reaction program is as follows: temperature 94℃, time 3 min; temperature 94℃, time 30 sec; temperature 58℃, time 30 sec; temperature 72℃, time 2 min; temperature 72℃, time 5 min; temperature 4℃, time ∞.

[0069] The amplification results showed that the lengths of the sense and antisense strands were equal, both being 432 bp, and that their sequences were complementary.

[0070] Example 2: Construction of pCAMBIA-35SI-LcHDZ1 ​​RNAi plant expression vector

[0071] The initial vector pCAMBIA-35S-GFP-NOS backbone contains an EGFP fragment driven by the CaMV 35S promoter. The original EGFP coding sequence is removed using restriction endonucleases Xba I and Pst I. Then, an artificial intron sequence and MCS2 are directionally inserted into the original EGFP location via in vitro ligation to obtain the pCAMBIA-35SI-related vector for forming hairpin transcripts. After the target gene fragment is inserted flanking the intron in a forward and reverse repeat manner, it forms a hairpin double-stranded RNA driven by the 35S promoter, thereby triggering the plant RNA interference mechanism.

[0072] After purification, the RNAi fragments were double-digested according to the vector's restriction enzyme sites. Forward RNAi fragments were digested with BamHI and SpeI, while reverse RNAi fragments were digested with XbaI and PstI. Subsequently, they were ligated to the pCAMBIA-35SI expression vector using T4 ligase. The double-digestion system is shown in Table 3 below.

[0073] Table 3: Double Enzyme Digestion System

[0074]

[0075] The carrier-linked reaction system is shown in Table 4 below. The linking system was incubated at 4°C overnight.

[0076] Table 4: Carrier-linked reaction system

[0077]

[0078] The pCAMBIA-35SI-LcHDZ1 ​​RNAi recombinant plasmid was successfully constructed after double enzyme digestion and Agrobacterium colony PCR verification.

[0079] Example 3: Optimization of Agrobacterium-mediated transient transformation system for Piper longum RNAi

[0080] The frozen Agrobacterium strain GV3101 was retrieved from a -80°C ultra-low temperature freezer and revived using a streak plate method. Once the cells reached the exponential growth stage, they were centrifuged at 5400 rpm for 5 min at room temperature to precipitate the cells. After discarding the supernatant, the cells were resuspended in a suspension buffer supplemented with 100 μmol / L acetylsyleugenone (AS). The prepared bacterial suspension was allowed to stand for 60 min in a dark, room temperature environment before being used for vacuum infiltration of Lophatherum gracile branches.

[0081] An L9(3³) three-factor, three-level orthogonal experiment was constructed using bacterial concentration, vacuum pressure, and permeation time as three factors. The factor levels were: bacterial concentration OD... 600 The values ​​were 0.6, 0.8, and 1.0 kPa; the vacuum pressures were 60, 70, and 80 kPa; and the infiltration times were 5, 10, and 15 min. Each treatment group consisted of 15 plants, and three biological replicates were set up.

[0082] The optimization results of RNAi transient transformation parameters are shown in Table 5 below.

[0083] Table 5: Results of RNAi transient transformation parameter optimization

[0084]

[0085] The results showed that the influence of the three factors on the transient transformation efficiency of RNAi was as follows: bacterial concentration > vacuum pressure > osmosis time; the optimal condition was the OD of Agrobacterium tumefaciens bacterial solution. 600=1. Under vacuum pressure of 60 kPa and permeation time of 15 min, the instantaneous RNAi conversion rate was 43.75%.

[0086] Example 4: Validation of the RNAi system

[0087] Agrobacterium carrying the pCAMBIA-35SI-LcHDZ1 ​​vector was used to perform vacuum permeation treatment on Lophatherum gracile branches, followed by GUS histochemical staining of the leaves after dark culture.

[0088] The results showed that the transformed leaves were distinctly blue, while the control plants did not show any blue coloration. qRT-PCR detection of LcHDZ1 ​​gene expression showed that the expression level of LcHDZ1 ​​in the pCAMBIA-35SI-LcHDZ1 ​​vector-transformed plants was significantly lower than that in wild-type plants and empty vector-transformed plants (P<0.001).

[0089] The time-dynamic results showed that the leaves of Lophatherum gracile showed a blue color reaction 2 days after instantaneous transformation, and the staining deepened with time, reaching the deepest point on the 8th day after transformation; the blue color gradually lightened during the period of 8-12 days.

[0090] Gene expression assays showed that a significant increase in GUS gene expression was observed as early as day 2 post-transformation, and the gene interference effect was maintained from day 2 to day 8.

[0091] Example 5: Application of RNAi system in verifying drought resistance function of LcHDZ1

[0092] In the RNAi system, pCAMBIA-35SI-LcHDZ1 ​​was used as the experimental group, and pCAMBIA-35SI empty vector was used as the control group. Five days after transformation, the plants were subjected to 2.5% PEG6000 simulated drought treatment for 24 h, and the phenotype and physiological indicators of Lophatherum sp. were detected.

[0093] Optimization of PEG6000 simulated drought treatment concentration showed that: at 0%, the plants were normal; at 1.25%, the drought phenotype was not obvious; at 2.5%, the phenotype was obvious; and at 5%, the phenotype was severe. Therefore, 2.5% was selected as the drought treatment condition.

[0094] The results are shown below:

[0095] Group 1 had a PEG6000 concentration of 0% and a normal drought phenotype.

[0096] Group 2 had a PEG6000 concentration of 1.25%, and the drought phenotype was not obvious.

[0097] Group 3, with a PEG6000 concentration of 2.5%, exhibited a pronounced drought phenotype.

[0098] Group 4, with a PEG6000 concentration of 5%, exhibited severe drought phenotype;

[0099] The main physiological parameters of RNAi plants after treatment with 2.5% PEG6000 for 24 h are shown in Table 6 below.

[0100] Table 6: Main physiological indicators of RNAi plants after 24 h of treatment with 2.5% PEG6000

[0101]

[0102] DAB and NBT staining results showed that the leaves of EV control plants after drought treatment were more deeply stained with DAB and NBT than those of RNAi plants, indicating that reducing LcHDZ1 ​​expression can reduce H2O2 and O2. - Accumulation enhances the ability of Bai Mai Gen (a type of root) to scavenge reactive oxygen species.

[0103] The sequence list involved in this invention is as follows:

[0104] SEQ ID NO:1 LcHDZ1 ​​RNAi interference fragment (432 bp)

[0105] AGACAGATTGCAATATGGTTTCAGAATAGGAGGGCAAGGTGGAAAACAAAGCACTTGGAGAAGGAATTTGTTGTCCTCAAGAAGCAGTTTGATGCAGCCAAGGCTGAAAATGATGCACTTAAACTTCAGAATCAGAAGCTATGCACAGAGTTACAAGCTTTAAAAAGAAGGGATTGGTGTGAAGCTCGAACAATCAGCTTTAAGAAAGAAACTGAG GGTACTTGGAGCAATGGAAGTGAAAACAGCTCAGACATAAATTTAGATCTCTCAAGAACATCAATTTCAAATAGTCCTGTATCTCCCCAGAACAATAAAAACCTTATGACCACTTCAATAAAAACCCCCAGCATAACCCAACTCCTTCAATTCTCATCACGGCCAAATCTCCAAGATGAAGGCTTGTGCAACATGTTTCACAACATTGATGAGCAC

[0106] SEQ ID NO:2 LcHDZ1-i1-F

[0107] GGATCCAGACAGATTGCAATATGG

[0108] SEQ ID NO:3 LcHDZ1-i1-R

[0109] ACTAGTGTGCTCATCAATGTTGTG

[0110] SEQ ID NO:4 LcHDZ1-i2-F

[0111] TCTAGAGTGCTCATCAATGTTGTG

[0112] SEQ ID NO:5 LcHDZ1-i2-R

[0113] CTGCAGAGACAGATTGCAATATGG

[0114] The acquisition, storage, and application of user personal information involved in the technical solution of this invention all comply with the provisions of relevant laws and regulations and do not violate public order and good morals.

[0115] It should be understood that the various forms of processes shown above can be used to reorder, add, or delete steps. For example, the steps described in this invention can be executed in parallel, sequentially, or in different orders, as long as the desired result of the technical solution of this invention can be achieved, and this invention does not impose any limitations on them.

[0116] The technical terms, principles, or means related to the technical solutions of the present invention mentioned in the above embodiments, which are not described in detail above, are all well-known technologies or common practices that are known to those skilled in the art.

[0117] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A method for constructing a transient gene silencing system using *Platycodon grandiflorus* RNAi, characterized in that, Includes the following steps: Using the LcHDZ1 ​​gene of *Lotus Root* as the target, an RNAi interference fragment of 432 bp was selected; The sense and antisense strands of the RNAi interference fragment were amplified by PCR, respectively. The sense strand was inserted into the pCAMBIA-35SI expression vector via BamHI and SpeI restriction endonuclease sites, and the antisense strand was inserted into the same expression vector via XbaI and PstI restriction endonuclease sites to obtain the pCAMBIA-35SI-LcHDZ1RNAi plant expression vector. The plant expression vector was transformed into Agrobacterium GV3101; Using Lophatherum gracile branches as transformation material, Agrobacterium tumefaciens bacterial solution containing the plant expression vector was introduced into Lophatherum gracile branches by vacuum permeation.

2. The method for constructing the *Platyphae chinensis* RNAi transient gene silencing system according to claim 1, characterized in that, The nucleotide sequence of the RNAi interference fragment is shown in SEQ ID NO:

1.

3. The method for constructing the *Platycodon grandiflorus* RNAi transient gene silencing system according to claim 1, characterized in that, The primers used to amplify the positive strand include LcHDZ1-i1-F and LcHDZ1-i1-R, whose sequences are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. The primers used to amplify the antisense strand include LcHDZ1-i2-F and LcHDZ1-i2-R, whose sequences are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

4. The method for constructing the *Platyphae chinensis* RNAi transient gene silencing system according to claim 1, characterized in that, The PCR amplification system was a 20 μL system, including 1.0 μL of cDNA template, 1.0 μL of LcHDZ1-i1 / 2-F, 1.0 μL of LcHDZ1-i1 / 2-R, 10 μL of Ex Taq enzyme, and ddH2O to make up to 20 μL; The PCR amplification program was 94℃ for 3 min, followed by 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 2 min, and finally 72℃ for 5 min, and stored at 4℃.

5. The method for constructing the *Platyphae chinensis* RNAi transient gene silencing system according to claim 1, characterized in that, Before the vacuum permeation, the method further includes a step of activating Agrobacterium GV3101 carrying the plant expression vector, which includes: collecting Agrobacterium GV3101 cells by centrifugation, resuspending them in a suspension buffer containing 100 μmol / L acetylsyl syringone, and allowing them to stand for 60 min in the dark at room temperature.

6. The method for constructing the *Platycodon grandiflorus* RNAi transient gene silencing system according to claim 5, characterized in that, The optimal conditions for vacuum permeation are: Agrobacterium bacterial solution OD 600 The value is 1, the vacuum pressure is 60 kPa, and the permeation time is 15 min.

7. The method for constructing the *Platycodon grandiflorus* RNAi transient gene silencing system according to claim 1 or 6, characterized in that, After vacuum infiltration, the branches of Lobelia chinensis were placed on the surface of the floating board and hydroponically cultured in a dark environment at 26℃ for 24 hours, and then transferred to a greenhouse at 28℃ for further cultivation.

8. A transient gene silencing system using *Polyporus thunbergii* RNAi, characterized in that, It is constructed by the method described in any one of claims 1-7.

9. The application of the method according to any one of claims 1-7 or the system according to claim 8 in the rapid verification of gene function in *Polygonum multiflorum*.

10. The application according to claim 9, characterized in that, The gene for *Lotus Root* is LcHDZ1, and the applications include: Plants transformed with the empty pCAMBIA-35SI vector were used as controls, and plants transformed with the pCAMBIA-35SI-LcHDZ1 ​​RNAi plant expression vector were used as RNAi plants. Functional analysis of the target genes was performed 4-6 days after transformation.

Images