A function-enhanced car-t cell and a preparation method and application thereof

Abstract

The application provides a function-enhanced CAR-T cell and a preparation method and application thereof, relates to the technical field of biological medicines, and the function-enhanced CAR-T cell completely blocks the transmission of a CD70-CD27 signal axis during the preparation of the CAR-T cell, and the CAR-T cell has stronger antitumor function after the CD70-CD27 interaction is blocked; the CAR-T cell has a longer survival half-life and stronger immune memory response ability in the body, plays a positive regulation role on the persistence of the function of the CAR-T cell, and avoids the function exhaustion problem caused by only relying on the modification of a cytokine or a costimulatory domain in a traditional strategy. The application can be used in the preparation of a CD19 CAR-T for blood tumors and a GD2 CAR-T for solid tumor antigens, provides a new direct, efficient and easy-to-promote way, and is expected to play an important clinical application value in the immunotherapy of blood tumors and solid tumors.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a functionally enhanced CAR-T cell, its preparation method, and its application. Background Technology

[0002] Traditional cancer treatments primarily include surgical resection, radiotherapy, and chemotherapy. In recent years, novel treatment strategies such as interventional therapy, targeted therapy, and immunotherapy have rapidly developed. Among these, chimeric antigen receptor T cell (CAR-T) therapy, as a breakthrough immunotherapy technology, has achieved significant success in the treatment of some hematologic malignancies and has become one of the most promising cell therapies for clinical application. CAR-T cell therapy utilizes genetic engineering technology to modify T cells derived from the patient's own body or a healthy donor, enabling them to express chimeric antigen receptors (CARs) that specifically recognize tumor antigens, thereby achieving precise killing of tumor cells. As a revolutionary cancer immunotherapy, CAR-T cells have demonstrated enormous potential in the clinical research and treatment of various malignancies, particularly showing remarkable therapeutic effects in hematologic malignancies such as B-cell leukemia, lymphoma, and multiple myeloma.

[0003] Current research indicates that one of the main mechanisms of relapse after CAR-T therapy is the downregulation or absence of CAR-target antigen expression on the surface of tumor cells, also known as tumor antigen-negative relapse. However, it is noteworthy that a significant proportion of patients still experience tumor cell expression of the target antigen at the time of relapse, i.e., antigen-positive relapse. Results from a clinical study (NCT01865617) by David G. Malloney's team at the Fred Hutchinson Cancer Research Center showed that antigen-positive relapse accounted for 78% of all relapse cases after CAR-T therapy. In patients with antigen-positive relapse, it is often observed that CAR-T cells cannot maintain an effective number in vivo, suggesting insufficient cytotoxic activity and poor persistence of CAR-T cells. Therefore, improving the persistence, anti-exhaustion capacity, and long-term anti-tumor activity of CAR-T cells has become a core research direction for optimizing its clinical efficacy.

[0004] The persistence of CAR-T cells in vivo is influenced by various factors, including cell characteristics, preparation process, and tumor microenvironment. Studies have shown that the proportion of memory T cells is closely related to the efficacy of CAR-T therapy. Enriching stem cell-like memory T cell subsets before CAR-T preparation can significantly improve the anti-tumor activity of CAR-T cells. However, the cytokine IL-2, commonly used in CAR-T cell culture, reduces the proportion of memory T cells. Furthermore, CAR molecule-mediated tonic signaling continuously activates CAR-T cells and induces antigen-independent depletion during preparation, ultimately impairing CAR-T cell function.

[0005] CD27, a member of the TNF receptor superfamily, is primarily expressed on the surface of naive T cells and memory T cells. In adoptive cell therapy, the quality of the reinfused product directly determines clinical efficacy and safety. CD27 expression levels were initially considered a key biomarker for assessing T cell memory characteristics. However, studies have found that deep activation of CAR-T cells via chimeric switch receptors (CSRs) was achieved, and CD27 signaling was simultaneously significantly upregulated in this system. However, results from lymphoma and brain tumor models show that sustained CD27 signaling activation may ultimately lead to T cell inactivation. These seemingly contradictory findings suggest that the role of CD27 signaling in anti-tumor T cell activity is highly complex, and the regulatory role and mechanism of CD27 signaling on the anti-tumor activity of CAR-T cells require further elucidation.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] One of the objectives of this invention is to provide the application of substances that block CD27-CD70 interaction in the preparation of functionally enhanced CAR-T cells. This invention is the first to demonstrate that CD27-CD70 interaction exists between different subsets of CAR-T cells during the in vitro preparation stage. CD27-CD70 interaction leads to antigen-independent premature activation and functional exhaustion. Blocking CD27-CD70 interaction between subsets can significantly enhance the memory phenotype maintenance ability, in vivo persistence, and long-lasting anti-tumor activity of CAR-T cells.

[0008] The second objective of this invention is to provide a method for preparing functionally enhanced CAR-T cells.

[0009] The third objective of this invention is to provide a functionally enhanced CAR-T cell.

[0010] The fourth objective of this invention is to provide the application of the functionally enhanced CAR-T cells prepared by the above-mentioned method in the preparation of drugs for treating tumors.

[0011] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides the application of substances that block CD27-CD70 interaction in the preparation of functionally enhanced CAR-T cells.

[0012] Furthermore, the substances that block CD27-CD70 interaction include substances that inhibit CD70 gene replication, transcription, translation, post-transcriptional modification and / or post-translational modification; and / or substances that inhibit or reduce the content, activity and / or function of CD70 protein.

[0013] Furthermore, the substances that block CD27-CD70 interaction include nucleic acid molecules for silencing or knocking out the CD70 gene; and / or antibodies that bind to the CD70 protein.

[0014] Furthermore, the substance that blocks CD27-CD70 interaction includes at least one of A1 to A4: A1. RNA interference molecules targeting the CD70 gene; A2. sgRNA targeting the CD70 gene; A3, the DNA molecule encoding the sgRNA described in A2; A4. An expression cassette, recombinant vector, or recombinant host cell containing the sgRNA described in A2 and / or the DNA molecule described in A3.

[0015] Furthermore, the nucleotide sequence of the sgRNA targeting the CD70 gene is shown in SEQ ID NO.1.

[0016] Secondly, the present invention provides a method for preparing functionally enhanced CAR-T cells, the method comprising inhibiting the interaction between the CD70 protein and the CD27 protein of the CAR-T cells themselves during the in vitro preparation of CAR-T cells.

[0017] Furthermore, methods to inhibit the interaction between CAR-T cell's own CD70 and CD27 proteins include adding antibodies that bind to the CD70 protein to the culture system.

[0018] Further methods to inhibit the interaction between the CD70 protein and the CD27 protein in CAR-T cells include knocking out the CD70 gene coding sequence; and / or reducing CD70 mRNA levels through RNA interference.

[0019] Thirdly, the present invention provides a functionally enhanced CAR-T cell prepared using the above-described preparation method.

[0020] Fourthly, the present invention provides the application of the functionally enhanced CAR-T cells prepared by the above-described method in the preparation of drugs for treating tumors.

[0021] Furthermore, the tumor is a CD70-positive tumor.

[0022] The application of the substance that blocks CD27-CD70 interaction provided by this invention in the preparation of functionally enhanced CAR-T cells has the following specific beneficial effects: 1. Effectively avoids premature activation of CAR-T cells and significantly enhances their anti-tumor activity.

[0023] Data show that CAR-T cells modified by CD70 knockout completely block the transmission of the CD70-CD27 signaling axis during CAR-T preparation, avoiding premature activation of CAR-T cells. After repeated stimulation by tumor cells in vitro, they can still maintain strong tumor killing ability and effector secretion levels. In vivo tumor-bearing experiments in mice also confirmed that CAR-T cells that block the CD27-CD70 interaction between CAR-T cells have stronger anti-tumor function.

[0024] 2. The study clarified the association between blocking CD27-CD70 interaction and the persistence and memory phenotype formation of CAR-T cells, providing a theoretical basis and technical support for the preparation of long-acting CAR-T products.

[0025] This invention proposes the positive impact of blocking CD27-CD70 interaction on the differentiation lineage of CAR-T cells. After blocking CD27-CD70 interaction, the proportion of central memory T cells (Tcm) and stem cell-like memory T cells (Tscm) in CAR-T cells significantly increased, while the proportion of terminally differentiated effector memory T cells decreased accordingly. This phenotypic shift resulted in CAR-T cells having a longer survival half-life and stronger immune memory response in vivo. Based on this, this invention comprehensively demonstrates, from both molecular mechanism and cellular behavior perspectives, the positive regulatory effect of blocking CD27-CD70 interaction between different subtypes on the functional persistence of CAR-T cells, avoiding the functional exhaustion problem caused by relying solely on cytokines or co-stimulatory domain modifications in traditional strategies.

[0026] 3. This preparation strategy has good versatility and transformability, and is suitable for the optimization and upgrading of CAR-T cells targeting multiple targets.

[0027] The CD27-CD70 interaction blocking scheme established in this invention is not limited to a specific CAR structure or target antigen, but can be flexibly adapted to the preparation processes of CD19 CAR-T for hematological malignancies and GD2 CAR-T for solid tumor antigens. Functional enhancement can be achieved by blocking the CD27-CD70 interaction without the need for the introduction of additional exogenous genes or small molecule compounds, simplifying the preparation process and reducing potential safety risks and regulatory complexities. Therefore, this invention provides a direct, efficient, and easily scalable new approach for improving the efficacy and large-scale application of CAR-T cell therapy, and is expected to play an important clinical role in the immunotherapy of hematological malignancies and solid tumors. Attached Figure Description

[0028] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0029] Figure 1 CD27 provided in Embodiment 1 of the present invention + CAR-T cell subsets and CD27 - Comparison of basic phenotype detection results of CAR-T cell subsets; Figure 2 CD27 provided in Embodiment 2 of the present invention + Results of CAR-T subpopulation in vitro killing function validation, where A represents the expression of CD27 in CD19 BBζ CAR-T cells before and after sorting. - Cell subsets and CD27 + Cell subset sorting purity assay, B represents the comparison of sorted CD19 BBζ CD27 under a 1:1 effector-to-target ratio. - CAR-T cells and CD27 + CAR-T cell tumor-killing ability in vitro, C represents the tumor-stimulated activity of CD19, BBζ, and CD27. - CAR-T cells and CD27 + A graph illustrating the proportion of CAR-T cells expressing exhaustion markers. The graph shows the percentage of cells simultaneously expressing 0, 1, 2, and 3 exhaustion markers. D represents the proportion of cells expressing CD19, BBζ, and CD27. - CAR-T cells or CD27 + The relative levels of GZMB and TNF in the culture medium during repeated tumor stimulation of CAR-T cells; Figure 3 This is a graph showing the results of RNA-seq differential gene analysis and GSEA enrichment analysis provided in Example 2 of the present invention; where A is a volcano plot showing CD19 BBζ CD27 - With CD27 + Differentially expressed gene distribution of CAR-T cells co-cultured with Nalm6 cells at a 1:1 ratio: B represents CD19, BBζ, and CD27. - CAR-T cells and CD27 + CAR-T cells, after receiving tumor stimulation, CD27 + Demonstration of signaling pathways with significantly enriched upregulated genes in CAR-T cells; Figure 4 CD27 provided in Embodiment 3 of the present invention + Results of CAR-T cell subpopulation antitumor activity validation, where A represents CD19 BBζ CAR-T cells with CD27 in the Nalm6 leukemia model. - Subgroups and CD27 + The flowchart of the comparative experimental design of the anti-tumor function of subpopulations in mice is shown in Figure 1. B is the in vivo imaging of tumor burden in each group of mice in the Nalm6 leukemia model. C is the dynamic change of tumor burden (number of in vivo imaging photons) in each group of mice in the Nalm6 leukemia model. D is the number of CAR-T cells per 25 μL of peripheral blood in the two groups of mice at different time points in the Nalm6 leukemia model. E is the survival analysis of Nalm6 leukemia tumor-bearing mice in each group. Figure 5 The CD70 ligand pair with CD27 provided in Embodiment 4 of the present invention + Figure showing the validation results of CAR-T cell function regulation; where A represents the expression of CD70 on the surface of the Raji lymphoma cell line, and B represents the expression of CD19+, BBζ, and CD27+ under the conditions of adding IgG or αCD70. + CD27 expression in CAR-T cells after Raji cell stimulation and CD27 expression + Comparison of cell proportions, C represents the ratio of Raji cells to CD19 BBζ CD27 under conditions of IgG or αCD70 addition. + Comparison of activation levels of CAR-T cells stimulated, D represents the activation levels of Raji cells against CD19 BBζ CD27 under conditions of IgG or αCD70 addition. + PD-1 after CAR-T cell stimulation + TIM-3 + Cell ratio, E represents the ratio of Raji cells to CD19+ / CD27+ under conditions of IgG or αCD70 addition. + PD-1 after CAR-T cell stimulation+ TIM-3 + Cell proportion statistical analysis; Figure 6 The CD70-overexpressing tumor cells provided in Example 5 of this invention are in contrast to CD27. + Figure showing the validation results of the effect on CAR-T cell function; where A represents the expression of CD70 on the cell membrane surface of wild-type Nalm6 cells (Nalm6-WT) and Nalm6 cells overexpressing CD70 (Nalm6-70), and B represents the expression of CD19, BBζ, and CD27. + Expression of CD27 and CD70 in CAR-T cells after stimulation with Nalm6-WT, Nalm6-70, and Nalm6-70+αCD70, and CD27 expression. + Cell proportion statistics, C is CD19 BBζCD27 + Comparison of the cytotoxicity of CAR-T cells against Nalm6-WT and Nalm6-70, and the effect of adding αCD70 to Nalm6-70 on the cytotoxicity of CAR-T cells. (D represents CD19 + BBζ + CD27) + Comparison of cytokine secretion levels during CAR-T cell killing of Nalm6-WT and Nalm6-70, and the effect of adding αCD70 to Nalm6-70 on cytokine secretion during CAR-T tumor killing. Figure 7 CD27 provided in Embodiment 6 of the present invention + Comparison of in vivo efficacy of CAR-T cell therapy in tumor-bearing models; where A represents CD19 BBζ CD27. - CAR-T cells or CD27 + Imaging images of tumor burden during tumor clearance by CAR-T cells against Nalm6-WT and Nalm6-70 in mice, B represents CD19, Bβ, and CD27. - CAR-T cells or CD27 + Dynamic changes in tumor burden during CAR-T cell tumor clearance of Nalm6-WT and Nalm6-70 in mice. C represents the effect of infusion of CD19 BBζ CD27 in Nalm6-WT and Nalm6-70 tumor-bearing mice. - CAR-T cells or CD27 + Survival curve analysis of mice after CAR-T cell therapy; Figure 8 Transcriptomic analysis results of CD27 signal activation regulating CAR-T cell transcriptional program provided in Example 7 of this invention Figure 1 Where A is CD19 BBζ CD27 +Heatmap of CD27 downstream molecules and activation and memory-related genes in the transcriptome of CAR-T cells after co-culturing with Nalm6-WT or Nalm6-70 for 24 h. B represents the signaling pathways that are significantly enriched in CD19BBζ CAR-T cells co-cultured with Nalm6-70. Figure 9 Transcriptomic analysis results of CD27 signal activation regulating CAR-T cell transcriptional program provided in Example 7 of this invention Figure 2 Where A is CD19 BBζ CD27 + Transcriptome analysis of CAR-T cells after stimulation with Nalm6-WT or Nalm6-70 was performed using memory T cells (Tmem) and precursor exhausted T cells (Tex). prog ), intermediate-state exhausted T cells (Tex) int ) and terminally exhausted T cells (Tex term Gene set variation analysis (GSVA) ​​was performed on differentially expressed genes based on the characteristic gene set of ), where B represents CD19, BBζ, and CD27. + Expression of PD-1 and TIM-3 in CAR-T cells after stimulation with Nalm6-WT or Nalm6-70, and PD-1 + TIM-3 + Exhausted T cell subsets (including Tex) int and TeX term The proportion and statistical analysis of ( ); Figure 10 This is the verification result of CD27–CD70 interaction among CAR-T cell autologous subsets provided in Example 8 of the present invention, where A represents sorted CD19 BBζ CD27 + CAR-T cells and CD70 + CAR-T cell subsets and CD27 with CFSE + Schematic diagram of CAR-T cell staining for subsequent experiments, B represents CD19, BBζ, and CD27. + CAR-T cells were cultured alone or with CD19 BBζCD70 + After co-culturing CAR-T cells, the expression levels of CD27 and CD70 on their surface were detected. C represents the expression levels of CAR-T cells cultured alone or in co-culture. + CD27 in cells + Cells and CD70 + Comparison of cell subset proportions, D is CD19 BBζ CD27 + CAR-T cells cultured alone or with CD70 + Detection of soluble CD27 concentration in CAR-T cell co-culture supernatant; Figure 11Comparative analysis of CD27–CD70 interaction on CD19-CAR-T transcriptional response provided in Example 9 of this invention Figure 1 Where A is CD19 BBζ CD27 + Volcano plot of transcriptional upregulation and downregulation of genes in the CAR-T cell co-culture group compared to the monoculture group, B is a heatmap showing CD19 BBζ CD27 + CAR-T cells upregulated activation and exhaustion-related genes in the co-culture group; C represents CD19 BBζ CD27 calculated by GSVA analysis. + Early activation index of CAR-T cells under single and co-culture conditions, D represents CD19 + BBζ + CD27. + Pathway enrichment analysis of upregulated genes at the transcriptional level in the co-culture group of CAR-T cells compared to the culture group alone; Figure 12 Comparative analysis of CD27–CD70 interaction on the transcriptional responses of CD19-CAR-T and GD2-CAR-T provided in Example 9 of this invention Figure 2 Where A is GD2 28ζ CD27 + Volcano plot showing the up- and down-regulated genes at the transcriptional level in the co-culture group of CAR-T cells compared to the single culture group. B represents differentially regulated genes that are simultaneously upregulated in the co-culture group of both CD19 BBζ and GD2 28ζ CAR-T models. Figure 13 The above are the ATAC-seq analysis results of CD19-CAR-T cells provided in Example 9 of this invention, where A represents the CFSE values ​​under both single-culture and co-culture conditions. + Chromatin accessibility maps of CD19 BBζ CAR-T cells at typical sites of memory-related genes (SELL), activation-related genes (CD69), and exhaustion-related genes (LAG3). B represents the activity analysis of transcription factor binding motifs enriched in the co-culture group compared to the single-culture group. Figure 14 This is the functional verification result of CD27–CD70 interaction leading to CAR-T functional impairment provided in Embodiment 10 of the present invention, where A represents CD19 BBζ CD27 + CAR-T cells cultured alone or with CD70 in vitro + After co-culturing the cells, they were sorted by flow cytometry and subjected to repeated tumor killing in vitro at an E:T ratio of 1:1. The figure shows the number of residual tumor cells, where B represents CD19, BBζ, and CD27. + CAR-T cells cultured alone or with CD70 in vitro +After co-culture, the cells were sorted by flow cytometry and subjected to long-term tumor killing in vitro at E:T=1:4 or E:T=1:8. The figure shows the number of residual tumor cells after different co-culture days. C is the concentration of effector cytokines in the supernatant of repeated tumor killing in vitro. Figure 15 The following are the construction and validation results of CD70 gene knockout (CD70-KO) CAR-T cells provided in Example 11 of the present invention. In this example, A is a flowchart of CD70 KO CAR-T cell preparation, and B is the analysis of CD70 expression level on the surface of CD19 BBζ CAR-T cells after 24 h of activation by Nalm6 cells. Figure 16 This is a phenotypic analysis diagram of CD70-KO CD19 BBζ CAR-T cells provided in Example 11 of the present invention. In this diagram, A shows the expression of CD27 and CD70 on the surface of Mock T cells, sgCONT CAR-T cells, and sgCD70 CAR-T cells 12 days after in vitro expansion; B shows the expression of CD27 in Mock T cells, sgCONT CAR-T cells, and sgCD70 CAR-T cells 12 days after in vitro expansion. + Statistical analysis of CAR-T cell proportions, where C represents the proportions of Mock T cells, sgCONT CAR-T cells, and sgCD70 CAR-T cells CD62L cells 12 days after in vitro expansion. + CCR7 + Comparison of the proportions of memory cell subsets, D represents CD69 + Cell proportion characterizes cell activation level; compare the proportion of activated cells in sgCONT CAR-T cells and sgCD70 CAR-T cells. Figure 17 The following are the verification results of the enhanced in vitro killing function of CD70-KO CD19 BBζ and GD2 28ζ CAR-T cells provided in Example 11 of this invention. A shows the number of residual tumor cells after repeated tumor killing by sgCONT CAR-T and sgCD70 CAR-T cells at an E:T=1:1 ratio in vitro; B shows the cytokine concentration in the culture supernatant of sgCONT CAR-T and sgCD70 CAR-T cells after multiple rounds of repeated tumor stimulation in vitro; C shows the number of residual tumor cells after tumor killing by sgCONT CAR-T and sgCD70 CAR-T cells at E:T=1:4 or E:T=1:8 conditions; and D shows the number of residual tumor cells after tumor killing by sgCONT CAR-T and sgCD70 CAR-T cells at E:T=1:1 or E:T=1:8 conditions in the GD2 28ζ CAR-T model. Figure 18The following are the in vivo efficacy verification results of CD70-KO CD19 BBζ CAR-T cells in the Nalm6 tumor-bearing NSG mouse model provided in Example 11 of this invention. Among them, A is the experimental design flowchart comparing the anti-tumor function of CD19 BBζ sgCONTCAR-T and CD19 BBζ sgCD70 CAR-T cells in mice using Nalm6 leukemia as a model; B is the in vivo imaging of tumor burden in mice in the Nalm6 leukemia model after infusion of different cell types; and C is the survival analysis of mice in the Nalm6 leukemia model after infusion of different cell types. Detailed Implementation

[0030] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.

[0031] Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and as described in various general and more specific references, which are cited and discussed throughout this specification.

[0032] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] This invention investigated the effect of CD27 signaling on CAR-T cell function. First, in a CD19-targeted CAR-T model, in vitro tumor cell killing experiments and in vivo experiments in tumor-bearing mice clarified that a subset of CAR-T cells highly expressing CD27 possesses stronger anti-tumor function. During tumor killing, it was demonstrated that the interaction between CD27 on CAR-T cells and CD70 expressed on tumor cells can promote the anti-tumor ability of CAR-T cells and maintain their memory phenotype characteristics.

[0034] To further explore the regulatory mechanism of CD27 signaling during CAR-T cell preparation, this invention uses flow cytometry to obtain CD27 cells separately. + CAR-T cell subsets and CD70 + CAR-T cell subsets. CD27 was labeled using CFSE. +After CAR-T cell culture, separate culture groups (CD27) were set up. + Cells cultured alone and co-cultured (CD27) + CAR-T cells and CD70 + CAR-T cell co-culture), by detecting CFSE + Cells (i.e., derived from CD27) + The phenotypic differences among progeny CAR-T cells were the first to demonstrate that CD27-CD70 interactions also exist between different CAR-T subsets during in vitro CAR-T cell preparation. This interaction can trigger the activation of CD27 signaling, thereby inducing antigen-independent activation and exhaustion susceptibility of CAR-T cells.

[0035] Based on this, the present invention compares CFSE in the individually cultured group and the co-cultured group. + Cells were sorted and purified separately, and the initial CD27 was evaluated using an in vitro tumor cell repeated killing model. + The functional differences of CAR-T cells under two different culture conditions were observed. Results showed that the co-culture group derived from CFSE... + The tumor-killing ability of the cells was significantly weakened compared with the cultured group alone, suggesting that the excessive activation induced by CD27-CD70 interaction between CAR-T subsets during preparation has a significant negative effect on CAR-T cell function.

[0036] Based on the above findings, this invention further employs CRISPR-Cas9 gene editing technology to knock out the CD70 gene during CAR-T cell preparation, thereby blocking CD27-CD70 interactions between CAR-T cell subsets. Through CAR-T cell phenotypic analysis, in vitro repeated tumor cell killing experiments, and in vivo validation using tumor-bearing mouse models, this invention demonstrates that this strategy can significantly enhance the anti-tumor activity of CAR-T cells.

[0037] This strategy, based on the conventional CAR-T cell preparation process, uses gene editing to knock out the CD70 gene in CAR-T cells, clarifying the specific CD70 knockout site and its enhancing effect on CAR-T cell function. By blocking the abnormal CD27-CD70 signaling interaction between CAR-T cell subsets during the preparation process, this strategy effectively avoids antigen-independent activation and functional exhaustion of CAR-T cells during the preparation stage, resulting in CAR-T cell products with significantly improved functional durability.

[0038] The present invention will be further illustrated by the following examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or purchased directly from the market.

[0039] In the following examples, except for the GD2 CAR-T cells in Example 9, CAR-T cells and CD19 CAR-T cells all refer to CD19 BBζ CAR-T cells.

[0040] Example 1 This embodiment aims to compare CD27 + CAR-T and CD27 - The basic phenotypic differences among CAR-T subgroups can be determined by following these steps: 1. Preparation of CAR-T cells: Healthy donor PBMCs were activated with anti-CD3 / CD28 magnetic beads for 24 hours, and then CARs were transduced via lentivirus. Four days after activation with anti-CD3 / CD28 magnetic beads, the activation beads were removed using a magnetic rack. The cells were cultured in IL-2-containing medium for 8 days, with the medium changed and the cells counted every two days at a concentration of 0.6e6 / mL.

[0041] 2. Flow cytometry sorting: CD27 antibodies were labeled and sorted. + CAR-T cell subsets and CD27 - CAR-T cell subsets; 3. Flow cytometry was used to detect memory markers (CD62L, CCR7), exhaustion markers (TIM-3, LAG-3), and activation markers (CD25, CD69, CD70), with isotype controls used as negative controls.

[0042] 4. Results as follows Figure 1 As shown, CD27 + CD62L in CAR-T cells + The proportion was significantly higher than that of CD27. - Subgroup, CCR7 + A higher proportion indicates that CD27 + The subset exhibits higher memory T cell characteristics; CD27 + TIM-3 in CAR-T cells + The proportion decreased significantly, LAG-3 + A lower proportion indicates a lower level of depletion; CD27 + CD25 in CAR-T cells + CD69 + CD70 + Both were significantly lower than CD27 - Subgroups indicate lower activation levels. This is shown in the CD27 group. + CAR-T cells have higher memory and lower activation exhaustion levels.

[0043] Example 2 This embodiment aims to verify CD27. + The CAR-T subpopulation in vitro killing function advantage, with the Nalm6 leukemia cell line as the tumor target cell, is operated according to the following steps: 1. Flow cytometry verification of CD27 - and CD27 + The purity of CAR-T subpopulations, such as Figure 2 A.

[0044] 2. The CD27 obtained from Example 1 was sorted. + CAR-T and CD27 - CAR-T cells were co-incubated at a 1:1 ratio.

[0045] Four rounds of repeated killing experiments were conducted: After CAR-T cells and tumor cells were co-cultured for 24 hours, tumor cells were repeatedly added to carry out the next round of killing until the fourth round, when neither group of CAR-T cells could kill tumors.

[0046] The number of surviving target cells is counted in each round, such as Figure 2 B, CD27 + The number of surviving target cells after the fourth round of CAR-T cell killing was significantly lower than that of CD27. - This indicates that CD27 + The subpopulation exhibited significantly enhanced sustained killing ability. The concentrations of TNF and GZMB in the supernatant per round were as follows: Figure 2 D, CD27 + CAR-T cells secreted significantly more TNF and GZMB than CD27 in rounds 3 and 4. - This indicates that the sustained effect is stronger.

[0047] The expression and co-expression distribution of inhibitory receptors (exhaustion markers PD-1, LAG-3, and TIM-3) were detected, such as... Figure 2 As shown in C, CD27 + The proportion of CAR-T cells expressing 0 inhibitory receptors is higher, while the proportion expressing 1-3 is lower, indicating a less severe degree of depletion.

[0048] 3. Collect co-cultured CAR-T cells, extract total RNA, and perform RNA-seq sequencing; Differential gene analysis, such as Figure 3 As shown in Figure A: immune effector pathways (such as CXCL13, CCL22, GBP6) and memory-related pathways (such as TCF7, LMO7, KLF3) were upregulated, while exhaustion-related genes (such as GNLY, TOX) were downregulated; GSEA enrichment analysis showed... Figure 3 As shown in Figure B, immune effector pathways are upregulated. This indicates that CD27 is activated after tumor stimulation. +CAR-T cells maintain memory characteristics and upregulate immune effector pathways.

[0049] Example 3 This embodiment aims to verify CD27. + Antitumor activity within CAR-T cell subsets.

[0050] 1. Animals: 6-8 week old NSG mice; 2. Tumor model construction: Nalm-6-GL (1×10⁻⁶) stably co-expressing green fluorescent protein (GFP) and luciferase was injected via tail vein. 6 (cells / each), CD27 was sorted on day 4 after injection. - CAR-T / CD27 + CAR-T therapy was used to establish a Nalm6 leukemia tumor-bearing mouse model.

[0051] 3. Drug administration: On day 5 after tumor injection, mice were subjected to in vivo imaging before drug administration and divided into three groups according to tumor burden (Mock group n=3, CAR-T group n=6 / group): CD27 + CAR: CD27 reinfusion via tail vein + CAR-T (1×10) 6 cells / each); CD27 - CAR: CD27 reinfusion via tail vein - CAR-T (1×10) 6 cells / each); Mock: Inject an equal volume of normal saline into the tail vein.

[0052] 4. Tumor growth and CAR-T cell count were monitored on days 5, 9, 20, 27, 34, 41, 48 and 60, and survival was recorded (the endpoint was a 20% weight loss or lower limb paralysis).

[0053] The results are as follows Figure 4 As shown, CD27 + The tumor burden in the CAR group was significantly lower than that in the CD27 group between days 27 and 34. - CAR group, CD27 - The CAR group experienced tumor recurrence on Day 34, while CD27... + The CAR group showed more durable control. CAR-T cells peaked on day 12 of tumor infusion (day 7 of CAR-T infusion), with CD27... + The CAR group had significantly higher levels of CD27. - CAR group, indicating CD27 +CAR-T cells exhibit better persistence in vivo. Survival curves show that CD27... + The survival rate in the CAR group was significantly longer than that in the CD27 group. - Groups and Mock groups.

[0054] Example 4 This embodiment aims to verify that CD70, as a natural ligand of CD27, inhibits CD27 in the tumor microenvironment. + Positive regulatory role of CAR-T cell function.

[0055] 1. Target cells: The human Burkitt lymphoma cell line Raji was selected as the target cells.

[0056] 2. Experimental grouping and treatment CD27 obtained from Example 1 + CD19 BBζ-CAR-T cells were divided into three groups: CAR-T only: CD27 + CD19 BBζ-CAR-T cells were cultured alone; Raji+lgG: CD27 + CD19 BBζ-CAR-T cells and Raji cells were co-cultured at a 1:1 ratio, and IgG antibodies were added simultaneously (the added IgG antibodies have the same structure as αCD70 antibodies, but do not bind to any target). Raji+αCD70: CD27 + CD19-CAR-T cells were co-cultured with Raji cells at a 1:1 ratio, and αCD70 antibody (brand: BioLegend; catalog number: 355102; clone number: 113-16) was added. The co-culture conditions included preparing CAR-T cells and tumor cells at a concentration of 0.2e6 / mL in a U-shaped 96-well plate, adding 100 μL of CAR-T cells and tumor cells (200 μL of culture medium containing 20,000 CAR-T cells and 20,000 tumor cells) to each well, and simultaneously adding the corresponding volume of antibody to the co-culture system at a final concentration of 1 μg / mL.

[0057] 3. Detection Indicators and Methods After co-culturing for 24 hours, CD27 was collected. + CAR-T cells were subjected to the following tests: (1) Activation markers: Flow cytometry detection of CD27, CD69 and CD137 surface expression; (2) Exhaustion markers: TIM-3 and PD-1 expression; result Figure 5 As shown, in Raji+lgG, CD27 +CAR-T cells showed significant activation, while TIM-3 + The low activation rate indicates that the CD27 signal can simultaneously enhance activation and inhibit the depletion process when CD70 ligand is present; in Raji+αCD70, the above-mentioned activation enhancement and depletion delay effects are completely eliminated.

[0058] Example 5 This embodiment aims to reverse-engineer the requirement for the presence of CD70 ligand for CD27 function.

[0059] 1. Target cells: Nalm6 cell line, a human B-cell precursor acute lymphoblastic leukemia cell line.

[0060] 2. Construct Nalm6 cells overexpressing CD70; 3. Experimental grouping and treatment unstim: The control group that was not co-cultured with the target cells.

[0061] Nalm6-WT: Wild-type Nalm6 cells; Nalm6-70: Nalm6 cells overexpressing CD70; Nalm6-70+αCD70: Add αCD70 antibody to CAR-T and Nalm6-70 cell co-culture; Flow cytometry was used to verify CD70 expression, and CD27 obtained from Example 1 was analyzed. + CD19 BBζ-CAR-T cells were co-cultured with the target cells described above. The co-culture conditions included preparing CAR-T cells and tumor cells at a concentration of 0.2e6 / mL in a U-shaped 96-well plate, adding 100 μL of CAR-T cells and tumor cells (200 μL of culture medium containing 20,000 CAR-T cells and 20,000 tumor cells) to each well, and simultaneously adding the corresponding volume of antibody to the co-culture system at a final concentration of 1 μg / mL.

[0062] 4. Detection of CD27 after co-culture + The proportion, specific killing rate and concentrations of GZMB, TNF, IFN-γ and IL-2 in the supernatant; The results are as follows Figure 6 As shown in Figures A and B, Nalm6-70 highly expresses CD70 and CD27. + CD19-CAR-T cells were co-cultured with Nalm6-70 and CD27 + The proportion decreased, but after adding αCD70, it increased to nearly Nalm6-WT. For example... Figure 6 As shown in Figure C, the specific killing rate of the Nalm6-70 group was significantly higher than that of Nalm6-WT and Nalm6-70+αCD70, indicating that CD70 enhances the killing effect of CAR-T cells. Figure 6As shown in Figure D, the levels of GZMB, TNF, IFN-γ, and IL-2 in the Nalm6-70 group were significantly higher than those in the Nalm6-WT group. The levels in Nalm6-70+αCD70 were significantly reduced after the addition of αCD70 antibody, indicating that the function-enhancing effect of CD27 on CAR-T cells depends on the CD70 expressed by the tumor.

[0063] Example 6 This embodiment aims to verify the CD27 signal itself (not just CD27). + The contribution of phenotype to in vivo therapeutic effects.

[0064] 1. Animals: 6-8 week old NSG mice; 2. Tumor Model Construction Nalm6-WT model: Nalm6 cells (1×10⁻⁶) injected via tail vein. 6 cells / each); Nalm6-70 model: Nalm6 cells overexpressing CD70 (1×10⁻⁶) 6 cells / each).

[0065] 3. Drug administration: On the 5th day after tumor inoculation, each model was divided into three groups (Mock group n=3, CAR-T group n=6 / group), and the drugs were reinfused via tail vein. Nalm6-WT Mock: Model Comparison; Nalm6-WT+CD27 - CAR: CD27-CD19-CAR-T cells (1×10⁻⁶) 6 cells / each); Nalm6-WT CD27 + CAR: CD27 + CD19-CAR-T cells (1×10) 6 cells / each); Nalm6-70 Mock: Model Comparison; Nalm6-70 CD27 - CAR: CD27-CD19-CAR-T cells (1×10⁻⁶) 6 cells / each); Nalm6-70 CD27 + CAR: CD27 + CD19-CAR-T cells (1×10) 6 cells / each).

[0066] 4. BLI in vivo imaging was performed on days 5, 9, 13, 17, 23 and 29 to monitor tumor growth and construct survival curves.

[0067] The results are as follows Figure 7 As shown in Figure A, BLI displays Nalm6-70 CD27 + The CAR group showed the best tumor control; some mice still showed no tumor signal on day 23, while Nalm6-70 CD27... - CAR group and Nalm6-WT CD27 + CAR showed tumor signaling in all mice on day 23, and the tumor signaling reached the level of the model control group on day 23 on day 29. Nalm6-70 CD27 + The tumor growth rate was significantly reduced in the CAR group, indicating that CD70 expressed by tumor cells and CD27 expressed by CAR-T cells can synergistically enhance the killing effect of CAR-T cells. Figure 7 As shown in Figure B, the control model progressed rapidly, while Nalm6-70 CD27... + The CAR group had the lowest tumor burden. Figure 7 As shown in Figure C, the survival curves for Nalm6-70 CD27 are... + The median survival in the CAR group was significantly longer than that in the Nalm6-70 CD27 group. - CAR group and Nalm6-WT CD27 + The CAR group showed that the enhancement effect of CD27 depends on the expression of tumor CD70.

[0068] Example 7 This embodiment aims to analyze at the molecular level how CD27 signaling regulates the CAR-T transcription program.

[0069] Nalm6-WT and Nalm6-70 were respectively compared with CD27 sorted in Example 1. + CD19-CAR-T cells were co-cultured at a 1:1 ratio. Nalm6-70 co-culture was divided into a group supplemented with αCD70 antibody (Nalm6-70+αCD70) and a group without αCD70 antibody (Nalm6-70). Culture conditions included preparing CAR-T cells and tumor cells at a concentration of 0.2e6 / mL and adding them to 12-well plates at a 1:1 volume ratio, mixing thoroughly, and co-culturing for 24 hours. After 24 hours, flow cytometry was used to detect residual tumor cells. Once no residual tumor cells were identified, the remaining CAR-T cells were collected for RNA extraction and transcriptome sequencing.

[0070] The results are as follows Figure 8 Transcriptomic analysis showed that activation of CD27 signaling promotes CAR-T cell activation; for example... Figure 9 As shown, CD27 activation promotes CAR-T cell activation and delays depletion.

[0071] Example 8 This embodiment aims to demonstrate the existence of CD27-CD70 interactions among different subpopulations within CAR-T.

[0072] The experimental procedure is as follows Figure 10 As shown in Figure A, CD70 is sorted from CAR-T products. + and CD27 + Subgroup, using CFSE to convert CD27 + Subgroups were marked and cultured separately (Monoculture) with CD70. + CAR-T co-culture to isolate CFSE + Cell phenotype, Bulk RNA-seq, ATAC-seq, in vitro killing, and post-tumor stimulation phenotype analysis were performed.

[0073] Flow cytometry detection of CD27 and CD70 expression, such as Figure 10 As shown in Figures B and C, compared to the Monoculture group, the CD70 in the Co-culture group... + The proportion is rising, CD27 + A decrease indicates that the interaction leads to a downregulation of CD27 and an upregulation of CD70. For example... Figure 10 As shown in Figure D, the concentration of soluble CD27 in the culture supernatant of the Co-culture group was significantly higher than that of the Monoculture group. This indicates that there is CD27-CD70 interaction between different subsets during the in vitro preparation of CAR-T cells, which mediates the activation of CD27 signaling.

[0074] Example 9 This embodiment aims to integrate epigenetic and transcriptional dimensions to study the interaction mechanism. CD19 CAR-T cells and GD2 CAR-T cells were sorted from the CAR-T product in Example 8, labeled with CFSE, and cultured separately (monoculture) and CD70, respectively. + CAR-T co-culture.

[0075] Transcriptomic analysis was performed on the two groups of cells, and the results are as follows: Figure 11 and Figure 12 As shown, activation driven by the CD27-CD70 interaction is CAR type independent.

[0076] ATAC-seq analysis of CD19 CAR-T cells yielded the following results: Figure 13As shown, the SELL locus opening level was reduced in the Co-culture group, while the CD69 and LAG3 loci opening levels were increased. This indicates that CD27-CD70 interaction leads to the chromatin closure of the memory gene SELL and the chromatin opening of the activation gene CD69 and the depletion gene LAG3. In addition, all active transcription factors were members of the AP-1 family, indicating that CD27-CD70 interaction drives chromatin remodeling of activation and depletion-related genes through the AP-1 pathway. This reveals that CD27-CD70 interaction among CAR-T subsets drives CAR-T activation and tends towards depletion.

[0077] Example 10 This embodiment aims to functionally verify the negative effects of the interaction.

[0078] 1. CFSE after Monoculture and Co-culture in Example 9 + Cellular tumor killing in vitro: (1) E:T=1:1, 4 rounds were performed. Every 48 hours, the same number of fresh Nalm-6 cells as the initial co-culture were added. At the end of each round, the following were measured: target cell apoptosis rate, IFN-γ secretion, and CFSE. + CAR-T survival rate.

[0079] (2) E:T=1:4 and E:T=1:8 were cultured for 7 days, and the number of target cells was detected on day 1, day 3, day 5 and day 7.

[0080] The results are as follows Figure 14 As shown in Figures A and B, at an E:T ratio of 1:1, the number of surviving target cells in the post-coculture group in round 4 was significantly higher than that in the post-monoculture group, indicating that CAR-T killing function was impaired after co-culture. At E:T ratios of 1:4 and 1:8, the number of surviving target cells in the post-coculture group at round 7 was higher than that in the post-monoculture group; at an E:T ratio of 1:8, the number of surviving target cells in the post-coculture group at round 7 was higher than that in the post-monoculture group, showing that co-culture impaired killing function at different effector-target ratios. Figure 14 The cytokine concentrations shown in C indicate that in the second round of post-coculture, the levels of GZMB and IFN-γ in the post-coculture group were approximately 75 pg / ml (vs. approximately 140 pg / ml in the control group). P<0.001), TNF-α and IL-2 were significantly decreased. This indicates that antigen-independent activation caused by CD27-CD70 interaction impairs the anti-tumor function of CAR-T cells.

[0081] Example 11 This embodiment aims to construct CD70-KO CAR-T and verify its phenotypic advantages.

[0082] 1. For example Figure 15 As shown in Figure A, sgRNA targeting CD70 was designed, and the CD70 gene in CAR-T cells was knocked out by CRISPR-Cas9.

[0083] The nucleotide sequence of sgRNA is: TCACCAAGCCCGCGACCAAT (SEQ ID NO.1).

[0084] 2. Since CD70 is expressed in activated CAR-T cells, tumors are used to stimulate CAR-T cells and then CD70 expression is detected to verify the knockout efficiency.

[0085] As shown in Figure 15B, CD70 expression was significantly reduced after knockout (see flow cytometry on Page 14 for specific data), which verified the knockout efficiency of sgCD70. The CD70 knockout CAR-T cell model (sgCD70 CAR-T) was successfully constructed and can be used for subsequent functional verification.

[0086] 3. Flow cytometry was used to detect memory and activation markers in sgCD70 CAR-T and control CAR-T cells, respectively. For example... Figure 16 As shown, sgCD70 CAR-T cells have a higher proportion of memory markers (CD62L, CCR7) and a significantly lower proportion of activation markers (CD69), indicating that knocking out CD70 blocks the CD27-CD70 interaction between different CAR-T subsets, and CAR-T cells maintain higher memory characteristics and lower activation levels.

[0087] 4. Validation of in vitro tumor killing function sgCD70 CAR-T cells, control CAR-T cells, and Nalm-6 were co-cultured (E:T ratios of 1:1, 1:4, and 1:8, respectively). Co-culture conditions included an E:T ratio of 1:1. In a U-bottom 96-well plate, CAR-T cells and tumor cells were prepared at a concentration of 0.2e6 / mL. 100 μL of CAR-T cells and tumor cells (200 μL of culture medium containing 20,000 CAR-T cells and 20,000 tumor cells) were added to each well. After 24 hours of co-culturing, the culture system was analyzed by flow cytometry. Subsequently, the same number of tumor cells as in the first round of stimulation were added for the next round of tumor killing. When the E:T ratio was 1:4 or 1:8, the co-culture volume was 200 μL, and the number of tumor cells was kept constant at 20,000. CAR-T cells were diluted according to the effector-target ratio and added to the corresponding 96-well plates. The functional differences between sgCONT CAR-T and sgCD70 CAR-T were confirmed in CD19 CAR-T cells and GD2 CAR-T cells, respectively.

[0088] In the E:T=1:1 group, five consecutive rounds of killing experiments were conducted (under the same conditions as in Example 11); at the end of each round, the apoptosis rate of target cells and the concentrations of GZMB, TNF, IFN-γ and IL-2 in the supernatant were measured.

[0089] In the E:T=1:4 and E:T=1:8 groups, the cells were cultured for 7 days, and the number of target cells was detected on days 1, 3, 5 and 7.

[0090] The results are as follows Figure 17 As shown, sgCD70 CAR-T exhibited stronger tumor-killing function in vitro, with a significantly lower number of surviving target cells than the control group, indicating that the effector function of CAR-T was restored and enhanced after CD27-CD70 interaction during the preparation process.

[0091] 5. Verification of tumor-killing function in vivo (1) Animals: 6-8 week old NSG mice; (2) Tumor model construction: Nalm-6-GL (1×10⁻⁶) was injected into the tail vein. 6 (cells / animal) to establish a systemic leukemia model.

[0092] (3) On the 5th day after modeling, the participants were randomly divided into three groups (Mock group = 3; CAR-T group n = 5 / group): sgCONT CAR-T: sgCONT CAR-T (1×10⁻⁶) infused via tail vein 6 cells / each); sgCD70 CAR-T: sgCD70 CAR-T (1×10⁻⁶) infused via tail vein 6 cells / each); Mock: Model control, with an equal volume of saline infused via tail vein.

[0093] Tumor growth was monitored weekly using IVIS imaging, and survival time was recorded.

[0094] The results are as follows Figure 18 As shown, the sgCD70 CAR-T group exhibited more thorough tumor clearance, lower BLI signal, and significantly prolonged survival in mice. This indicates that CD70 knockout CAR-T cells have a significantly enhanced anti-tumor effect in mice.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of substances that block CD27-CD70 interaction in the preparation of functionally enhanced CAR-T cells; The substances that block CD27-CD70 interaction include nucleic acid molecules used to silence or knock out the CD70 gene; and / or antibodies that bind to the CD70 protein; The blocking of CD27-CD70 interaction acts as a means of blocking CAR-T cells' own CD70 during in vitro preparation. + Subgroups and CD27 + Antigen-independent CD27-CD70 interactions between subgroups; The enhanced functions include reducing CAR-T cell exhaustion, enhancing CAR-T cell proliferation, and / or enhancing CAR-T cell killing efficacy. The nucleic acid molecule is defined as an sgRNA targeting the CD70 gene, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. A method for preparing functionally enhanced CAR-T cells, characterized in that, The preparation method includes inhibiting the interaction between the CD70 protein and the CD27 protein of the CAR-T cells themselves during the in vitro preparation of CAR-T cells; Methods to inhibit the interaction between CAR-T cell's own CD70 and CD27 proteins include adding antibodies that bind to the CD70 protein to the culture system; or, Methods to inhibit the interaction between CD70 and CD27 proteins in CAR-T cells include knocking out the CD70 gene coding sequence; and / or reducing CD70 mRNA levels through RNA interference. The nucleic acid molecule is defined as an sgRNA targeting the CD70 gene, and its nucleotide sequence is shown in SEQ ID NO.

1.

3. A functionally enhanced CAR-T cell, characterized in that, It was prepared using the preparation method described in claim 2.

4. The use of the functionally enhanced CAR-T cells prepared by the method of claim 2 in the preparation of drugs for treating tumors.

5. The application according to claim 4, characterized in that, The tumor is a CD70-positive tumor.

Images