Use of LmOBP2 gene in inhibiting feeding of locusts and feeding inhibitor and screening method of locusts

Abstract

The application belongs to the technical field of biological control of agricultural pests and insect olfactory molecule regulation, and particularly relates to application of LmOBP2 gene in inhibiting feeding of locusts and a locust feeding inhibitor and a screening method. The application provides a locust feeding inhibitor based on LmOBP2 gene, which comprises secondary metabolite preparations (one or more of indole, taurine, DL-serine and dimethylglycine) of Metarhizium anisopliae capable of down-regulating expression of LmOBP2 and dsRNA interference preparations targeting LmOBP2, so that crop damage loss is reduced, and prevention and treatment timeliness is improved. Meanwhile, a method for rapidly screening active compounds capable of inhibiting feeding of locusts by taking recombinant LmOBP2 protein as a target is provided, which is used for efficiently screening novel green behavior regulators, and a new way of olfactory targeted biological control is expanded.

Description

Technical Field

[0001] This invention belongs to the field of biological control of agricultural pests and molecular regulation of insect olfaction, specifically involving the application of the LmOBP2 gene in inhibiting locust feeding and locust feeding inhibitors and screening methods. Background Technology

[0002] The Oriental migratory locust (Locusta migratoria) is a significant agricultural pest in my country and worldwide. Its feeding and migration behaviors are primarily regulated by chemosensory (olfactory and gustatory) and tactile cues, exhibiting remarkable behavioral plasticity. For a long time, locust control has relied mainly on chemical pesticides, but this has led to increasingly prominent issues such as pesticide resistance, environmental residues, and collateral damage to natural enemies and pollinators. Therefore, there is an urgent need to develop green and sustainable control strategies.

[0003] Metarhizium anisopliae, a broad-spectrum insect pathogenic fungus, has been widely used in biocontrol. Its infection process mainly involves penetrating the host's hemocoel through the body wall and releasing secondary metabolites that interfere with the host's physiological functions. Studies have shown that: (1) Metarhizium anisopliae var. can significantly inhibit locust feeding behavior (Arthurs and Thomas, 2000); (2) Insect odor-binding proteins (OBPs) are responsible for transporting environmental volatiles to olfactory receptors, thereby mediating behaviors such as feeding, mating, and enemy avoidance. For example, LmigOBP1 in the migratory locust can recognize volatiles in corn leaves and regulate feeding (Li et al., 2016); (3) Pathogenic fungal infection can regulate the expression of host olfactory-related genes. For example, Beauveria bassiana infection can downregulate the expression level of olfactory genes in red imported fire ants.

[0004] However, current research still has the following shortcomings: First, the pathogenic-lethal process of entomopathogenic fungi such as *Metarhizium anisopliae* is relatively slow. After field application, the host continues to feed on the fungi for a long time, causing crop damage, resulting in poor control effectiveness. Furthermore, the molecular mechanism of the beneficial phenotype of "inhibiting host feeding" possessed by fungi remains unclear, making it difficult to specifically enhance and practically apply. Second, although there is evidence that fungal infection can affect the expression of host olfactory genes, the specific molecular effectors (i.e., fungal metabolites) mediating the feeding inhibition effect and their target genes have not yet been identified, lacking clear targets. Third, current locust control methods lack green behavioral regulators based on host olfactory molecular targets, and also lack molecular screening platforms for rapidly screening novel "feeding inhibition / behavioral manipulation" active substances.

[0005] To address the above shortcomings, the present invention aims to:

[0006] (1) A new method is provided to inhibit the locust’s odor recognition of the host plant by using the LmOBP2 gene as a molecular target, thereby inhibiting its feeding behavior.

[0007] (2) Provide a specific formulation for implementing the method, including a formulation of Metarhizium anisopliae secondary metabolites (one or more of indole, taurine, DL-serine, and dimethylglycine) that can downregulate LmOBP2 expression, and a dsRNA interference formulation that targets LmOBP2; and can be combined with Metarhizium anisopliae to enhance the control effect.

[0008] (3) A method is provided for rapidly screening active compounds that can inhibit locust feeding by targeting recombinant LmOBP2 protein. Summary of the Invention

[0009] This invention elucidates for the first time that *Metarhizium anisopliae* downregulates the LmOBP2 gene in locusts through its secondary metabolites, thereby disrupting the host's olfactory recognition of volatiles from maize leaves and inhibiting feeding. Based on this, LmOBP2 is established as a key molecular target for regulating locust feeding behavior, and three mutually reinforcing technical routes are provided: metabolite downregulation, RNAi silencing, and LmOBP2-based compound screening.

[0010] In view of this, one of the objectives of the present invention is to provide an application of the LmOBP2 gene in regulating locust feeding, wherein the nucleotide sequence of the LmOBP2 gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2, and the regulation is to inhibit locust feeding by reducing the expression of the LmOBP2 gene or by suppressing the expression of the LmOBP2 gene.

[0011] A second objective of this invention is to provide a method for preventing or inhibiting locust feeding, comprising the step of preventing or reducing the expression of the LmOBP2 gene as described in claim 1 in locusts.

[0012] Preferably, the method for preventing or reducing the expression of the LmOBP2 gene in locusts includes the step of preparing a positive-strand dsRNA sequence as shown in SEQ ID NO.3 and injecting it into locusts. Specific methods include:

[0013] Total RNA was extracted from the tested locusts, and cDNA was obtained by reverse transcription. The LmOBP2 gene fragment was obtained by gene cloning and a recombinant plasmid was constructed. Using the recombinant plasmid as a template, PCR amplification was carried out using upstream and downstream specific primers that ligated the T7 promoter sequence at the 5' end. The PCR product was purified and recovered to prepare an in vitro transcription template.

[0014] In an RNase-free system, dsRNA (positive strand nucleotide sequence shown in SEQ ID NO. 3) was synthesized via in vitro transcription using T7 RNA polymerase. The transcription product was first digested with DNase I to thoroughly remove residual DNA template, followed by lithium chloride (LiCl) precipitation to enrich dsRNA. After purification by phenol-chloroform extraction, the dsRNA concentration was adjusted to 300 ng / μL, and 5 µL of the dsRNA solution was injected into the abdomen of the tested locust. RNAi exhibited high specificity, with no significant effect on the expression of the highly homologous gene LmOBP4, but downregulation of LmOBP2 gene expression by approximately 90%. Furthermore, it significantly reduced the electrophysiological response and behavioral preference of the antennae to maize leaf volatiles (leaf alcohol, linalool), decreasing maize leaf consumption to approximately 70% of the control group.

[0015] A third objective of this invention is to provide a locust feeding inhibitor, wherein the inhibitor comprises a dsRNA interference agent targeting the LmOBP2 gene or a Metarhizium anisopliae secondary metabolite agent.

[0016] Preferably, the dsRNA interference agent comprises a dsRNA with a positive strand sequence as shown in SEQ ID NO.3.

[0017] Preferably, the Metarhizium anisopliae secondary metabolite preparation comprises four metabolites: indole, taurine, DL-serine, and dimethylglycine. After application, it can significantly downregulate the transcriptional level of antennal LmOBP2 by approximately 33.46%, 49.45%, 68.17%, and 55.00%, respectively, thereby inhibiting feeding.

[0018] Preferably, the above metabolites can be used alone or in combination, or they can be used as synergists in combination with Metarhizium anisopliae spore suspension.

[0019] The fourth objective of this invention is to provide a method for using a preparation of Metarhizium anisopliae secondary metabolites in inhibiting locust feeding.

[0020] Preferably, the method includes applying a preparation of secondary metabolites of Metarhizium anisopliae to locusts via spraying, feeding, or topical treatment. Topical treatment includes injection.

[0021] The fifth objective of this invention is to provide the application of the above-mentioned locust feeding inhibitor in the prevention and control of locusts or the suppression of their feeding, wherein the prevention and control is achieved by applying the locust feeding inhibitor to suppress locust feeding, thereby reducing crop damage and improving the timeliness of locust control.

[0022] The sixth objective of this invention is to provide a method for rapidly screening active compounds that inhibit locust feeding based on LmOBP2 protein as a target, comprising the following steps: performing a fluorescence competitive binding experiment on the test compound and LmOBP2 protein, and screening according to the competitive binding constant Ki value, wherein the amino acid sequence of the LmOBP2 protein is shown in SEQ ID NO.2.

[0023] Preferably, the method includes the following steps: prokaryotic expression and purification to obtain recombinant LmOBP2 protein; constructing a fluorescent competitive binding system using N-phenyl-1-naphthylamine (1-NPN) as a fluorescent probe; firstly determining the dissociation constant Kd between the fluorescent probe 1-NPN and the recombinant LmOBP2 protein, and then calculating the competitive binding constant Ki of each candidate compound against LmOBP2 protein; determining compounds with a competitive binding constant Ki less than 100 μM as active compounds with LmOBP2 protein binding activity; screening out compounds that can bind with high affinity to LmOBP2 (competing for maize leaf volatiles) as active substances for locust feeding inhibition or behavior manipulation, wherein the amino acid sequence of the LmOBP2 protein is shown in SEQ ID NO.2.

[0024] Beneficial effects:

[0025] 1. Clear mechanism, strong targeting, green and environmentally friendly: This invention uses the host olfactory molecule LmOBP2 as a specific target, and the metabolites used are fungal natural products that are easily degraded, have low residues, and are environmentally friendly and friendly to non-target organisms; the dsRNA has sequence specificity (does not affect the homologous gene LmOBP4), which can overcome the problems of chemical pesticide resistance and accidental damage.

[0026] 2. To compensate for the shortcoming of Metarhizium anisopliae's "slow insecticidal effect": It can actively inhibit host feeding by downregulating LmOBP2 before the fungus kills, reduce crop damage and improve the timeliness of control; metabolites or dsRNA can produce a synergistic effect of "feed suppression + lethality" when combined with Metarhizium anisopliae.

[0027] 3. Provides available molecular targets and screening platforms: LmOBP2 and its fluorescent competitive binding system can be used to efficiently screen novel green behavior regulators, expanding new avenues for olfactory-targeted biocontrol.

[0028] 4. Definite effects (supported by experimental data): Four metabolites downregulated LmOBP2 expression by 33%–68%; RNAi silencing reduced LmOBP2 to about 10%, maize leaf consumption to about 70% of the control, and significantly reduced antennal electrophysiological response and behavioral preference for leaf alcohol and linalool. Attached Figure Description

[0029] Figure 1Tissue expression profile of LmOBP2 and its expression changes under fungal infection / metabolite treatment;

[0030] Figure 2 Feeding and electrophysiological responses after RNAi silencing LmOBP2;

[0031] Figure 3 Expression, purification, and fluorescence competitive binding assays of recombinant LmOBP2;

[0032] Figure 4 A two-selection assay of locust behavior preferences for maize leaf volatiles after RNAi silencing of LmOBP2. Detailed Implementation

[0033] The present invention will be described in detail below with reference to embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples. Any modifications and variations made without departing from the spirit of the present invention should be included within the scope of the present invention. Unless otherwise specified, the experimental materials or reagents used in the following embodiments are all conventional commercially available products.

[0034] The tested locusts (Locusta migratoria) were reared in an artificial climate chamber under conditions of 30±3℃, 70% relative humidity, and a 14:10 h light-dark cycle. They were fed fresh wheat sprouts and wheat bran, and water was provided daily. All experiments used fifth-instar nymphs reared under high-density, crowded conditions. To eliminate differences in developmental stages, fifth-instar nymphs that had just completed molting and had been synchronously domesticated for 3 days were selected for subsequent experiments.

[0035] Metarhizium anisopliae (tested fungus): isolated from planthoppers;

[0036] Main reagents: nonanal (CAS No.: 124-19-6), ethyl glycolate (CAS No.: 623-50-7), linalool (CAS No.: 126-91-0), leaf alcohol (CAS No.: 928-96-1), indole (CAS No.: 120-72-9), taurine (CAS No.: 107-35-7), DL-serine (CAS No.: 302-84-1), dimethylglycine (CAS No.: 1118-68-9), nicotinamide (CAS No.: 98-92-0), 2,6-dihydroxyacetophenone (CAS No.: 699-83-2), all purchased from Shanghai Maclean Biochemical Technology Co., Ltd.

[0037] Example 1: Tissue Expression Analysis of LmOBP2

[0038] Tissues including antennae, head, central nervous system, epidermis, midgut, hind legs, wings, blood cells, fat body, and muscle of fifth-instar gregarious locusts were collected. Total RNA was extracted using the Trizol method, and LmOBP2 expression was detected by qRT-PCR after reverse transcription (internal reference Actin, 2^-ΔΔCT method).

[0039] Primers:

[0040] qLmOBP2-F 5'-TGACTGACAAAGACGAACTGGA-3';

[0041] qLmOBP2-R 5'-TGTCAAACTCTGGTGCAAACTG-3';

[0042] qActin-F 5'-AATTACCATTGGTAACGAGCGATT-3';

[0043] qActin-R 5'-TGCTTCCATACCCAGGAATGA-3'.

[0044] like Figure 1 Results showed that LmOBP2 was highly enriched in the antennae (approximately 88.8%), expressed at low levels in the head, epidermis, hind legs, and wings, and not expressed in the central nervous system, midgut, blood cells, fat body, and muscle, indicating that it is exclusively responsible for olfactory function.

[0045] Example 2: RNA interference to silence LmOBP2 (Scheme 1)

[0046] Total RNA was extracted from locusts and reverse transcribed into cDNA. The LmOBP2 target gene was cloned, and a recombinant plasmid was constructed. PCR amplification was performed using specific primers carrying the T7 promoter and the recombinant plasmid as templates. The transcription template was obtained after purification using a kit. Double-stranded RNA (dsRNA), i.e., dsOBP2, was synthesized in vitro using the MEGAscript kit in an RNase-free system via T7 transcription. Primers are as follows:

[0047] LmOBP2-F 5'-GAGATGACACCAGAATTCATG-3';

[0048] LmOBP2-R 5'-TTATTCTGACGGTTGCTGC-3';

[0049] dsLmOBP2-F

[0050] 5'- TAATACGACTCACTATAGGG AGAACATGAACCCACCGAAG-3';

[0051] dsLmOBP2-R 5'- TAATACGACTCACTATAGGG GTCCGTCTCACCACCAACTT-3';

[0052] dsGFP-F 5'- TAATACGACTCACTATAGGG TGCTTCAGCCGCTACCC-3';

[0053] dsGFP-R 5'- TAATACGACTCACTATAGGG GTCCGTCTCACCACCAACTT-3';

[0054] The nucleotide sequence of the sense strand of the synthesized dsRNA is shown in SEQ ID NO.3 (the antisense strand is inversely complementary to the sense strand sequence, and thymine T in RNA is replaced with uracil U). The transcript was first digested with DNase I to completely remove residual DNA template, and then dsRNA was enriched by lithium chloride (LiCl) precipitation, and then purified by phenol-chloroform extraction. After quantification, the concentration of dsRNA was adjusted to 300 ng / μL for later use. dsGFP targeting the GFP gene was synthesized according to the kit manufacturer's operating procedure as a negative control (GFP has no homologous sequence to locusts, has no interference side effects, and is widely used in locust RNA interference experiments). 5 µL of dsRNA solution was injected into the abdomen of the tested locusts, and the negative control group was injected with an equal volume of dsGFP. Three days after injection, locusts were subjected to (1) gene expression analysis, (2) behavioral measurement, and (3) antennal electrogram (EAG) detection.

[0055] (1). qRT-PCR analysis revealed that LmOBP2 expression decreased to approximately 10% of the control (downregulated by approximately 90%). Figure 2 A);

[0056] (2) The dry weight of corn leaves consumed by locusts before and after RNAi knockdown of LmOBP2 was measured. Each replicate consisted of 15 fifth-instar locusts per cage, and three independent biological replicates were performed. It was found that the corn leaf consumption was reduced to about 70% of that of the dsGFP control. Figure 2 B);

[0057] (3). The electrophysiological responses of LmOBP2 to different concentrations of maize leaf volatiles (nonanal, ethyl glycolate, linalool, and leaf alcohol) before and after knockdown were detected by EAG. Five concentrations (10⁻¹⁰) of nonanal, ethyl glycolate, and leaf alcohol were prepared using anhydrous ethanol as the solvent. -4 10 -3 10 -2 10 -1 and 1 M) and 3 concentrations of linalool (10 -2 10 -1And 1 M), with anhydrous ethanol as a control. Antennae potential (EAG) technology was used, where isolated antennae were inserted into glass capillaries containing silver electrodes. Each concentration was stimulated 5 times, with a 1-minute interval. The tested locusts were divided into two groups: injected with dsOBP2 and injected with dsGFP. Five antennae were taken from each batch in each group, for a total of 3 independent batches tested, meaning 15 antennae were tested per concentration in each treatment group. Records showed that for leaf alcohol (10 M), -4 -10 -1 M), linalool (10) -2 The electrophysiological response to M and ethyl glycolate (1 M) was significantly decreased. Figure 2 The results (CF) indicate that dsOBP2 can reduce the behavioral tendency of pests towards crop volatiles, thereby inhibiting the feeding behavior of pests.

[0058] Example 3: Metarhizium anisopliae infection and in vitro metabolite injection downregulation of LmOBP2

[0059] To evaluate the effect of Metarhizium anisopliae infection on LmOBP2 expression, two methods were used in this embodiment: (1) direct infection of locusts with Metarhizium anisopliae on their surface; and (2) injection of serum containing Metarhizium anisopliae cultured in vitro.

[0060] (1) Inoculation of the body surface: Metarhizium anisopliae was cultured on 1 / 4 SDA medium at 27 °C for 10 days, and spores were collected and adjusted to 1×10⁻⁶ with 0.05% Tween-80. 7 Spore suspension at spores / mL. 5 µL of spore suspension was spotted onto the pronotum of a locust, and antennae were collected for analysis after 72 h. LmOBP2 was downregulated by approximately 24.4% ( Figure 1 B).

[0061] (2) In vitro metabolite injection: Hemolymph was collected by puncturing the intersegmental membrane of fifth-instar locust nymphs, then centrifuged to remove blood cells, and aseptically filtered through a 0.22µm filter membrane to obtain sterile filtered serum. The serum was inoculated with Metarhizium anisopliae and cultured in vitro at 28 ℃ for 24 h. After filtering out hyphae through a 0.22µm filter membrane, the metabolites were injected into the locusts. After 24 h, LmOBP2 was downregulated by approximately 54.7% (…). Figure 1 C).

[0062] Example 4: Downregulation of LmOBP2 by Metabolites of Metarhizium anisopliae (Scheme 2)

[0063] UPLC-QTOF-MS analysis of differentially metabolites in hemolymph before and after infection identified indole, taurine, DL-serine, dimethylglycine, nicotinamide, and 2,6-dihydroxyacetophenone as candidate metabolites. Compounds of these candidate metabolites (Maclean's) were purchased and prepared into 400 µmol / L solutions with deionized water. 5 µl of each solution was then injected into locusts. qRT-PCR was used to detect LmOBP2 in the antennae. Figure 1As shown in Figure D: Indole application reduced LmOBP2 by 33.46%, taurine application by 49.45%, DL-serine application by 68.17%, and dimethylglycine application by 55.00%, while nicotinamide and 2,6-dihydroxyacetophenone had no significant effect on LmOBP2. This indicates that the first four metabolites can act as active ingredients for downregulating LmOBP2 and inhibiting feeding. They can be used alone or in combination, or as synergists in combination with Metarhizium anisopliae.

[0064] Example 5: Expression, purification, and fluorescence competitive binding of recombinant LmOBP2 (Scheme 3)

[0065] After removing the signal peptide, the LmOBP2 open reading frame (cloning primers F 5'-GAGATGACACCAGAATTCATG-3', R 5'-TTATTCTGACGGTTGCTGC-3') was inserted into pET-28a, transformed into E. coli BL21, and induced overnight expression at 16℃ with 0.5 mM IPTG. His-Trap affinity chromatography was used for purification, and SDS-PAGE and Western blot analysis with His antibody were performed for verification. Figure 3 A). Competitive binding was performed using 1-NPN as a fluorescent probe (excitation at 337 nm, emission at 440 nm) (fluorescence competitive binding experiment). Results ( Figure 3 (BC): LmOBP2 binds with high affinity to maize leaf volatiles 1-nonanol, leaf alcohol (cis-3-hexen-1-ol), linalool, and cis-3-hexenyl acetate (competitive binding constants Ki = 50.69, 41.28, 31.48, and 57.45 µM, respectively), and weakly to nonanal (Ki = 282.04 µM). The data are the average of three independent measurements. Based on this, a compound screening method using Ki as an indicator can be established, identifying compounds with a competitive binding constant Ki less than 100 μM as active compounds with LmOBP2 protein-binding activity. This method can be used to screen compounds that can bind with high affinity to LmOBP2 (competing with maize leaf volatiles) or significantly downregulate LmOBP2 expression, serving as active substances for inhibiting feeding or manipulating behavior in locusts.

[0066] Example 6: Measurement of Two-Selection Behavior

[0067] To evaluate the effect of LmOBP2 on the behavioral response of locusts to maize leaf volatiles, we conducted a two-selection experiment. A 90° two-selection device with a main stem of 50 cm, two lateral arms of 20 cm each, and an inner diameter of 3.0 cm was used. The airflow was 200 mL / min, and the temperature was 27±2℃ and 60±5% RH. 10 µL of the test compounds (leaf alcohol, linalool, and ethyl glycolate, diluted to 100 ng / µL with n-hexane) or pure n-hexane was placed on filter paper discs, and the time locusts spent on each arm within 5 min was recorded. The results are as follows: Figure 4 As shown: the dsGFP control locust showed a significant preference for leaf alcohol, linalool, and ethyl glycolate; while the dsLmOBP2 locust lost its preference for leaf alcohol and linalool, and only retained its preference for ethyl glycolate, proving that LmOBP2 mediates the behavioral preference for leaf alcohol and linalool.

[0068] Example 7: Control Application (In-Cage / Field)

[0069] The metabolite preparation of Example 4 (one or more of indole, taurine, DL-serine, and dimethylglycine) or the dsLmOBP2 preparation of Example 2, alone or with Metarhizium anisopliae spore suspension (1×10⁻⁶) 7 When combined with spores / mL, and applied to locust populations through spraying, feeding, or surface treatment, it can downregulate LmOBP2, inhibit their feeding on host plants such as corn, and reduce crop damage; when combined with Metarhizium anisopliae, it has a synergistic effect of both "feed suppression" and "lethality".

[0070] The conventional techniques and solutions not described in detail in the above embodiments are all well known in the art, and therefore will not be elaborated upon here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. The application of the LmOBP2 gene in regulating locust feeding, characterized in that, The nucleotide sequence of the LmOBP2 gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

2. The application as described in claim 1, characterized in that, The regulation is achieved by reducing or eliminating the expression of the LmOBP2 gene, thereby inhibiting the feeding of locusts.

3. A method for preventing or inhibiting locusts from feeding, characterized in that, The method includes the step of preventing or reducing the expression of the LmOBP2 gene as described in claim 1 in locusts.

4. The method as described in claim 3, characterized in that, The method for preventing or reducing the expression of the LmOBP2 gene in locusts includes the steps of preparing a positive strand dsRNA as shown in SEQ ID NO.3 and injecting it into locusts.

5. A locust feeding inhibitor, characterized in that, The inhibitors include dsRNA interference agents targeting the LmOBP2 gene as described in claim 1 or agents containing secondary metabolites of Metarhizium anisopliae.

6. The locust feeding inhibitor as described in claim 5, characterized in that, The dsRNA interference agent comprises a dsRNA with a positive strand sequence as shown in SEQ ID NO.

3.

7. The locust feeding inhibitor as described in claim 5, characterized in that, The Metarhizium anisopliae secondary metabolite preparation includes one or more of indole, taurine, DL-serine, and dimethylglycine.

8. The method for inhibiting locust feeding using the *Metarhizium anisopliae* secondary metabolite preparation according to claim 7, characterized in that... Application methods include spraying, feeding, or surface treatment of locusts.

9. The use of any one of the locust feeding inhibitors of claims 5-7 in the prevention and control of locusts or in the suppression of locust feeding.

10. A method for rapidly screening active compounds that inhibit locust feeding based on LmOBP2 protein as a target, characterized in that, The procedure includes the following steps: performing a fluorescence competitive binding experiment on the test compound and LmOBP2 protein, and screening based on the competitive binding constant Ki value. The amino acid sequence of the LmOBP2 protein is shown in SEQ ID NO.2.

Images