A laser microdissection-based spatial transcriptome sequencing method suitable for snap-frozen tissues

Abstract

The application provides a laser microdissection-based spatial transcriptome sequencing method suitable for fixing frozen tissues. Specifically, the method uses antibody immunolabeling to identify specific cell types for frozen tissues treated with different fixatives, completes the whole process of immunofluorescence staining under the protection of RVC, uses laser microdissection to sort, cut and collect the cells recognized by the antibody on the basis of obtaining the spatial position information of the cells in the tissue, then cracks the cells for reverse transcription, amplification and library construction, and finally performs high-throughput sequencing. The method solves the problems of difficulty in fully cracking and releasing RNA of the fixed tissue sample and RNA degradation caused by long-time immunofluorescence operation, can obtain high-sensitivity, high-repeatability and quantifiable deep transcriptome sequencing data, and is widely suitable for all tissue types.

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection technology. More specifically, this invention relates to a spatial transcriptome sequencing method based on laser microdissection suitable for fixed and quick-frozen tissues. Background Technology

[0002] Multicellular organisms typically possess complex tissue structures, and the position of cells within these tissues determines their biological functions. Traditional transcriptomics research methods involve tissue fragmentation, leading to the loss of cellular spatial location information. Similarly, single-cell transcriptomics techniques require enzymatically dissolving tissue into single-cell suspensions (Alexander B. Rosenberg et al., Single-cell profiling of the developing mouse brain and spinal cord with split-pool barcoding. Science. 2018 Apr 13;360(6385):176-182.), which also fails to obtain cellular spatial information. Spatial transcriptomics, a rapidly developing and cutting-edge technology in the biomedical field, was named Technology of the Year by Nature Methods in 2020 (Marx V. Method of the Year: spatially resolved transcriptomics. Nat Methods. 2021 Jan;18(1):9-14.). This technology can determine the gene expression characteristics of cells within tissues while preserving their spatial location information, providing a powerful research tool for the life sciences.

[0003] Understanding cellular biological functions and their interactions with the microenvironment through deep transcriptome sequencing of specific cell types within a specific tissue space is a common research goal in the biomedical field. Advances in antibody technology have enabled the differentiation of cell types within increasingly specific tissue spaces through antibody labeling. Successful antibody labeling in frozen tissue sections often requires pre-fixation with a fixative. Deep transcriptome sequencing of antibody-labeled specific cell types within fixed frozen tissues has a wide research demand. Among several spatial transcriptome techniques based on different principles, laser microdissection-based spatial transcriptome technology, with its single-cell resolution cell sorting capability and deep gene expression profiling capability, is the most suitable spatial transcriptome technique for studying such problems.

[0004] However, when using laser microdissection-based spatial transcriptomics technology to study gene expression in antibody-labeled cells in frozen tissues, high-quality gene expression data cannot be obtained, mainly due to the following key technical bottlenecks: 1) Long-term antibody labeling leads to rapid activation of RNases in the tissue and massive RNA degradation, making downstream transcription and library construction impossible; 2) The type of fixative, fixation time, and decrosslinking conditions affect the number of genes detected; 3) The effectiveness and sensitivity of the library construction method are closely related to the data quality of downstream next-generation sequencing.

[0005] Therefore, there is a need in the field to develop new universal spatial transcriptomics technologies applicable to various types of fixed and quick-frozen tissues, in order to perform in-depth quantitative measurements of gene expression in antibody-labeled specific cells, thereby understanding the biological characteristics and functions of this cell type in a specific tissue space. Summary of the Invention

[0006] The purpose of this invention is to provide a spatial transcriptome sequencing method for fixed and quick-frozen tissues.

[0007] In a first aspect of the present invention, a spatial transcriptomics sequencing method for quick-frozen tissues is provided, the method comprising: (1) Tissue fixation: A tissue sample to be tested is provided and a tissue section is obtained. The tissue section is fixed using a cross-linking fixative DSP or PFA. (2) Antibody immunofluorescence staining: Antibody immunofluorescence staining was performed on the fixed tissue sections, and ribonucleoside vanadyl complex (RVC) solution was used to treat the tissue sections throughout the entire antibody immunofluorescence staining process. The RVC solution is an RNase inhibitor. (3) Target cell sorting: Laser microdissection is performed on the stained tissue sections, target cells are sorted based on fluorescence signals, and the target cells are placed in cell collection solution; (4) mRNA reverse transcription: The target cells are lysed to obtain a lysate solution. The mRNA is reverse transcribed into cDNA directly in the lysate solution using reaction system A, wherein the reaction system A contains the reverse transcription primers shown in SEQ ID NO.2.

[0008] (5) cDNA amplification and purification: The cDNA is purified and amplified using reaction system B, wherein the reaction system B contains cDNA amplification primers as shown in SEQ ID NO.3.

[0009] (6) Library construction: The amplified cDNA was used to construct a library; (7) Sequencing.

[0010] In another preferred embodiment, in step (1), the tissue sample is a mouse testicular tissue sample that has been flash-frozen in liquid nitrogen.

[0011] In another preferred embodiment, in step (1), the tissue sample is a mouse liver tissue sample that has been flash-frozen in liquid nitrogen.

[0012] In another preferred embodiment, the thickness of the tissue section is 7-12 μm.

[0013] In another preferred embodiment, in step (1), the concentration of the DSP fixative is 0.5-2 mg / ml, preferably 1 mg / ml.

[0014] In another preferred embodiment, in step (1), the time for treating the tissue section with the DSP fixative is 10-30 minutes, preferably 20 minutes.

[0015] In another preferred embodiment, in step (1), the concentration of the PFA fixative is 2-6%, preferably 4%.

[0016] In another preferred embodiment, in step (1), the PFA fixative is used to treat the tissue sections for 5-20 minutes, preferably 10 minutes.

[0017] In another preferred embodiment, in step (1), the tissue sample is sliced, placed on a glass slide, and dried in a cryostat.

[0018] In another preferred embodiment, in step (1), the slide is pretreated with RNase Zap and irradiated with ultraviolet light.

[0019] In another preferred embodiment, in step (1), the glass slide is a glass slide covered with a PET film.

[0020] In another preferred embodiment, step (2) further includes: quenching excess aldehyde groups remaining on the tissue sections under the action of cross-linking fixative with glycine solution before performing antibody immunofluorescence staining on the tissue sections.

[0021] In another preferred embodiment, the concentration of the glycine solution is 50-200 mM, preferably 100 mM, and the treatment time of the glycine solution is 5-20 minutes, preferably 10 minutes.

[0022] In another preferred embodiment, step (2) further includes: after the tissue sections are decrosslinked, they are blocked with a blocking solution, and the blocked tissue sections are subjected to immunofluorescence staining.

[0023] In another preferred embodiment, step (2) includes immunofluorescence staining of tissue sections using primary and secondary antibody solutions.

[0024] In another preferred embodiment, in step (2), the primary antibody solution and the secondary antibody solution are prepared using RVC solution and blocking solution as buffers, wherein the ratio of RVC solution to blocking solution is 1:1.

[0025] In another preferred embodiment, in step (2), the blocking solution is prepared as follows: a serum-free protein solution is mixed with a 20 mM RVC solution at a volume ratio of 1:1, thereby ensuring that the final concentration of the RVC solution is 10 mM.

[0026] In another preferred embodiment, step (2) includes a step of cleaning the sliced ​​sample with RVC solution before adding the primary antibody solution and the secondary antibody solution.

[0027] In another preferred embodiment, the number of cleaning cycles per cleaning process is 6-8.

[0028] In another preferred embodiment, the concentration of the RVC solution used in the cleaning process is 5-15 mM, preferably 10 mM.

[0029] In another preferred embodiment, in step (3), during the laser microdissection process, RVC solution is used to inhibit the degradation of RNA by RNase.

[0030] In another preferred embodiment, in step (3), the target cells are collected in a collection tube using laser ejection.

[0031] In another preferred embodiment, in step (3), the cell collection solution contains 40 U / ul RNase inhibitor, 10% Triton X-100, and 2 μmol Barcode.

[0032] In another preferred embodiment, the barcode sequence is as shown in SEQ ID NO.1.

[0033] In another preferred embodiment, in step (4), the lysis time of the target cells is 5-20 minutes, preferably 15 minutes, and the lysis temperature is room temperature.

[0034] In another preferred embodiment, in step (4), RNA is not extracted for reverse transcription after the target cells are lysed, but the reverse transcription reaction is carried out directly in the cell lysis solution.

[0035] In another preferred embodiment, in step (4), the reaction system A contains the following components: adapter (reverse transcription primer), 5x RT buffer, dNTPs, Nuclease-Free Water, RNase Inhibitors, and Maxima H Minus Reverse Transcriptase.

[0036] In another preferred embodiment, the concentration of the adapter is 10 μmol.

[0037] In another preferred embodiment, in step (4), lysis, decrosslinking, and reverse transcription occur simultaneously in the lysis solution.

[0038] In another preferred embodiment, in step (4), the reaction system A further includes dithiothreitol (DTT), which decrosslinks by reducing disulfide bonds, thereby achieving simultaneous decrosslinking and reverse transcription.

[0039] In another preferred embodiment, in step (5), magnetic beads are used to purify the cDNA.

[0040] In another preferred embodiment, in step (5), the reaction system A comprises the following components: primer (cDNA amplification primer), reverse transcribed cDNA, 2X Terra PCR Direct buffer, and Terra PCR Direct Polymerase Mix.

[0041] In another preferred embodiment, step (5) further includes: purifying the cDNA again using magnetic beads after amplification.

[0042] In another preferred embodiment, in step (6), a library is constructed using a Tn5 library construction kit to obtain a cDNA library of the target cells.

[0043] In another preferred embodiment, in step (6), the cDNA library preparation kit is Novizan's TruePrep DNALibrary Prep Kit.

[0044] In another preferred embodiment, in step (7), the sequencing method is the NovaSeq system.

[0045] In a second aspect of the invention, a spatial transcriptomics sequencing system for quick-frozen tissues is provided, the system comprising: (1) Tissue sectioning and fixation module, wherein the module is configured to perform the following operations: sectioning the sample to be tested to obtain tissue sections, and fixing the tissue sections with a fixative; (2) Immunofluorescence staining module, the module being configured to perform the following operations: performing immunofluorescence staining on tissue sections using specific antibodies, and using RVC solution as an RNase inhibitor to inhibit RNA degradation throughout the immunofluorescence staining process; (3) A cell sorting module based on laser microscopy, wherein the module is configured to perform the following operations: laser microscopy to cut tissue sections based on fluorescence signals to obtain target cells; (4) mRNA reverse transcription and cDNA amplification module, wherein the module is configured to perform the following operations: directly reverse transcription in target cell lysate to obtain reverse transcription product cDNA, and amplify cDNA; wherein the reverse transcription system contains the reverse transcription primers described in SEQ ID NO.2; and the cDNA amplification system contains the cDNA amplification primers described in SEQ ID NO.3. (6) Library construction and sequencing module, wherein the module is configured to perform the following operations: construct a library from the amplified cDNA and sequence it. (7) Data output module, which is configured to perform the following operations: analyze the sequencing data and output the results.

[0046] In another preferred embodiment, the system is configured to perform the method described in the first aspect of the invention.

[0047] In another preferred embodiment, the elements in the system are defined according to the method described in the first aspect of the invention.

[0048] In a third aspect of the invention, a reverse transcription primer is used, the sequence of which is shown in SEQ ID NO.2: 5'-iCiGiCACACTCTTTCCCTACACGACGCrGrGrG-3'; Where iC stands for iso-dC (a C base modified with locked nucleic acid); iG stands for iso-dG; and rG stands for RNA G (i.e., ribonucleotide G).

[0049] In a fourth aspect of the invention, a cDNA amplification primer is used, the sequence of which is shown in SEQ ID NO.3: 5'- / 5Biosg / ACACTCTTTCCCTACACGACGC-3'; wherein 5Biosg is 5' biotin.

[0050] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0051] Figure 1 The diagram shows a flowchart of the spatial transcriptomics technique for fixed tissue frozen sections of the invention.

[0052] Figure 2 The invention demonstrates the immunofluorescence staining effect of PLZF-positive cells in the testes of 6-week-old mice obtained by spatial transcriptomics technology of frozen sections of tissue fixed with 4% PFA.

[0053] Figure 3 The image shows an Agilent 2100 peak diagram of cDNA from PLZF-positive cells in the testes of 6-week-old mice obtained by spatial transcriptomics technology of frozen sections of tissue fixed with 4% PFA.

[0054] Figure 4 The image shows an Agilent 2100 quality control image of a transcriptome library of PLZF-positive cells from 6-week-old mouse testes obtained using the spatial transcriptome technique of frozen sections of tissue fixed with 4% PFA.

[0055] Figure 5 The invention presents a pairwise scatter plot of spatial transcriptome data from frozen sections of tissue fixed with 4% PFA, showing the spatial transcriptome data technique.

[0056] Figure 6 The invention demonstrates the immunofluorescence staining effect of PLZF-positive cells in the testes of 6-week-old mice obtained by spatial transcriptomics technology of frozen sections of tissue fixed with 1 mg / ml DSP.

[0057] Figure 7 The image shows an Agilent 2100 peak diagram of cDNA from PLZF-positive cells in the testes of 6-week-old mice obtained by spatial transcriptomics technology using frozen sections of tissue fixed with 1 mg / ml DSP.

[0058] Figure 8 The Qseq quality control plot of a transcriptome library of PLZF-positive cells from 6-week-old mouse testes obtained by spatial transcriptomics technology using frozen sections of tissue fixed with 1 mg / ml DSP is shown.

[0059] Figure 9 The spatial transcriptomics technique of the invented 1 mg / ml DSP-fixed frozen tissue sections was shown to yield three sets of replicate experimental correlations.

[0060] Figure 10 The comparison of spatial transcriptome data quality based on PFA or DSP fixation is shown. Detailed Implementation

[0061] Through extensive and in-depth research, the inventors have developed a spatial transcriptome sequencing method suitable for fixed and quick-frozen tissues. This method optimizes various parameters based on existing spatial transcriptome sequencing methods, including the fixative, RNase inhibitor, mRNA reverse transcription reaction system, and cDNA amplification system. It solves the problems of insufficient RNA lysis and release from fixed tissues and RNA degradation caused by prolonged immunofluorescence operations. Results show that the sequencing method of this application can obtain higher quality RNA, significantly increase the number of genes sequenced, significantly improve the overall alignment ratio, and exhibit good sample reproducibility and wide applicability. This invention is based on these findings.

[0062] the term To facilitate understanding of this invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing this invention, it should be understood that it is not limited to the specific methods and experimental conditions described, as such methods and conditions can be varied.

[0063] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.

[0064] Ultraviolet laser microcutting Laser microdissection (LMD) is a high-precision sample preparation method that uses lasers to precisely separate tissues or cells under a microscope. LMD is a technique that uses a laser beam controlled by a microscope to precisely cut and separate tissues or cells. Its core purpose is to obtain specific cell populations or single cells from complex or heterogeneous samples for the analysis of DNA, RNA, proteins, and other biomolecules.

[0065] In one specific embodiment, the operating conditions for laser microsurgery are as follows: (1) the ambient humidity is below 45%; (2) the lowest possible cutting and ejection energy is used while ensuring normal cutting and ejection. Specifically, the following parameters can be set for laser microsurgery: under 10x magnification, cutting energy: 47-51; laser energy: 80-83; laser focusing: 82-84. In actual operation, the parameters need to be adjusted according to the tissue characteristics.

[0066] reverse transcription primers In this invention, specific reverse transcription primers (as shown in SEQ ID NO.2) are used in spatial transcriptome sequencing.

[0067] The reverse transcription primers used in this invention incorporate locked nucleic acid (LNA) modified iso-dC and iso-dG. LNA is a nucleotide derivative whose sugar ring is locked by a methylene bridge between the 2' oxygen atom and the 4' carbon atom. LNA exhibits strong affinity for DNA or RNA, achieving higher Tm values ​​with shorter sequences, thus ensuring specificity and accurately distinguishing templates differing by only a single base. This significantly improves hybridization efficiency with target RNA and reduces false reverse transcription of non-target RNA during reverse transcription. The oligonucleotides containing LNA possess resistance to nuclease degradation; LNA-modified primers are more stable in the reverse transcription reaction system and less susceptible to degradation by nucleases, thereby ensuring the reliability and reproducibility of the reverse transcription reaction.

[0068] Space transcriptome sequencing methods In this invention, the sequencing method described in Zhang X, Hu C, Huang C, Wei Y, Li X, Hu M, Li H, Wu J, Czajkowsky DM, Guo Y and Shao Z (2022) Robust Acquisition of Spatial Transcriptional Programs in Tissues With Immunofluorescence-Guided LaserCapture Microdissection. Front. Cell Dev. Biol. 10:853188. doi: 10.3389 / fcell.2022.853188 and the optimized sequencing method of this application are compared: The transcriptome library construction method described in the literature uses 30 μL GITC (guanidine isothiocyanate) lysis buffer to directly lyse cells collected from LCM, followed by RNA extraction using the RNeasy Micro Kit, and cDNA library construction using the Ovation SoLo RNAseq Kit. However, the method in the literature is adapted for cryogenically frozen tissue sections fixed with cold acetone. The core principle of cold acetone fixation of tissue sections is to utilize the physical and chemical properties of acetone at low temperatures to precipitate proteins and dissolve lipids, preserving the tissue morphology while retaining the immunogenicity of antigens; it is a non-crosslinking fixative. However, acetone, while dissolving lipids, damages cell membranes, causing cells to shrink and become rounded, making it unsuitable for studies related to membrane proteins. It also has poor fixation effects for certain antigens, sometimes even resulting in undetectable signals.

[0069] In contrast, the cross-linking fixatives PFA and DSP used in this application achieve fixation by forming covalent cross-links between protein molecules through aldehyde groups. Their overall performance in preserving fine cell structures and fixing proteins is far superior to that of acetone.

[0070] Furthermore, the spatial transcriptome sequencing method in this paper uses a non-crosslinking fixative, which necessitates an unnecessary decrosslinking step in subsequent processing to promote RNA release. Therefore, this method performs poorly on crosslinked and fixed tissue samples. Additionally, GITC lysis buffer is a strong protein denaturant, requiring additional RNA precipitation and purification steps. This multi-step reaction can easily lead to the loss of trace amounts of sample, thus reducing yield.

[0071] Based on the above issues, this application develops a novel transcriptome library construction scheme suitable for LCM-sorted tissue samples that have been fixed by PFA and DSP crosslinking fixatives, and can meet the fixation requirements of most antibody labeling experiments.

[0072] First, a small 10ul lysis buffer was used to lyse the cells, reducing the risk of sample loss. Triton X-100, as a mild non-ionic detergent, can effectively lyse the cell membrane while better protecting the integrity of nucleic acids. The barcode primer was introduced during the lysis stage, enabling early labeling of cell-derived components.

[0073] After cell lysis, for a small sample of only 150 cells, the separate RNA extraction step was skipped, significantly reducing sample loss, and the cell lysate was directly reverse transcribed. Maxima H Minus Reverse Transcriptase and its accompanying buffer were used in the reverse transcription step. The buffer contained a certain concentration of dithiothreitol (DTT), which could decrosslink by reducing disulfide bonds.

[0074] Maxima H Minus Reverse Transcriptase, from Thermo Scientific (catalog number EP0753), contains the following components: 5×RT Buffer: 250 mM Tris-HCl (pH 8.3 at 25 °C), 375 mM KCl, 15 mM MgCl2, and 50 mM DTT. The reverse transcriptase Storage Buffer contains: 50 mM Tris-HCl (pH 7.5), 0.1 M NaCl, 1 mM EDTA, 5 mM DTT, detergent, and 50% (v / v) glycerol. The reverse transcription reaction system contains approximately 20 mM dithiothreitol (DTT), which breaks cross-links by reducing disulfide bonds. The reaction is carried out at 42 °C for 90 minutes. In this step, the uncross-linking release of RNA and the reverse transcription of RNA occur simultaneously, significantly improving reaction efficiency.

[0075] Subsequently, the entire reaction system was purified using DNA magnetic beads to obtain cDNA fragments. Terra PCR DirectPolymerase was then used to amplify the cDNA, followed by further magnetic bead purification and screening to obtain the amplified cDNA fragments. Finally, the TruePrep DNA Library Prep Kit V2 was used for library construction. The TTE Mix V5 enzyme digestion and fragmentation step was performed at 55°C for 10 minutes, which is simple to operate, minimizes sample loss, and helps improve library complexity.

[0076] Sequencing results showed that the transcriptome library obtained using the method in the literature only detected 1,806 genes, while the transcriptome library obtained using the method in this application could detect up to 17,615 genes, which is significantly higher than the number of genes detected by the method in the literature.

[0077] Compared with the prior art, the main advantages of the present invention include: 1. Compared to non-crosslinking fixatives, using crosslinking fixatives to fix tissues can more effectively preserve the fine structure of cells and fix proteins, and retain intracellular nucleic acid information to the greatest extent.

[0078] 2. For a tiny sample size of approximately 150 cells captured by laser microdissection, the separate RNA extraction step was completely skipped. The cell lysate was directly used as a reverse transcription template, which significantly reduced the loss of trace RNA caused by multiple steps such as column purification and precipitation, ensuring the successful library construction of extremely small samples.

[0079] 3. Integrating cleavage, decrosslinking, and reverse transcription into a continuous one-step reaction significantly shortens the entire operation process, reduces the risk of RNase contamination and batch-to-batch variability caused by external operations, and improves the stability and reproducibility of experiments.

[0080] 4. It meets the fixative requirements of most antibody labeling experiments, adapts to a wider range of experimental research needs, and can perform spatial transcriptome sequencing on cross-linked and fixed tissue samples to obtain high-quality transcriptome data.

[0081] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0082] Example 1. Spatial transcriptome sequencing method for fixed tissue (testis) sections based on PFA fixative In this embodiment, frozen sections of mouse testicular tissue fixed with 4% PFA solution were used as experimental materials. Rapid immunofluorescence staining with PLZF antibody for RVC protection was used to obtain spatial transcriptome data of PLZF-positive cells.

[0083] 1. Collection and freezing of materials by the organization To ensure the quality of tissue RNA, all metal instruments used for dissection were baked at 180°C for 8 hours before use. Nuclease-free PBS, cell culture dishes, and tissue cryovials were pre-chilled on ice before dissection. Six-week-old C57 male mice were euthanized by cervical dislocation, and testicular tissue was harvested and placed in cell culture dishes containing PBS. Excess adipose tissue around the testes was removed as quickly as possible, and the surface water was blotted dry with lint-free paper. The tissue was then placed in cell cryovials, flash-frozen in liquid nitrogen for 30 minutes, and then transferred to a freezer at -80°C.

[0084] 2. Frozen slices Mouse testicular tissue samples were transferred from a -80°C freezer to a cryostat for equilibration. Before freezing, the stage, blades, anti-roll plate, and sample brush of the microtome were cleaned with 75% ethanol. An immunohistochemistry pen was used to pre-mark the slide mounting area. The tissue was fully embedded in OCT embedding medium. For tissues requiring directional sampling from specific locations, the orientation of the tissue was marked before embedding to ensure the ideal section was cut. The frozen section thickness was set to 7 μm (based on the volume of cells to be sorted). The tissue sections were mounted on RNAZap-treated PET slides, and the slides were equilibrated in the microtome for 1-2 minutes.

[0085] 3. Rapid immunofluorescence staining protected by RVC (1) Reagent preparation: I. RVC buffer: Weigh 584 mg NaCl and 610 mg MgCl and dissolve them thoroughly in 1000 ml of nuclease-free water. Seal with sealing film and store at room temperature. Before use, mix 49 ml with 1 ml of 1 M Tris-HCl to make RVC buffer (10 mM NaCl, 3 mM MgCl, 20 mM Tris-HCl, pH 7.4).

[0086] II. 20mM RVC Solution: Remove 200mM RVC stock solution from -20℃ and dissolve it completely in a 65℃ water bath. Aliquot 1ml into 1.5ml centrifuge tubes, seal with sealing film, and store at -20℃. When using, remove one tube of RVC stock solution from -20℃, dissolve it completely at room temperature, and then dilute it with RVC buffer at a ratio of 1:10 to obtain a 20mM RVC solution. Any unused 20mM RVC solution should be diluted to 10mM and stored at 4℃.

[0087] III. 10mM RVC Solution: Remove 200mM RVC stock solution from -80℃ and dissolve it completely in a 65℃ water bath. Aliquot 1ml into 1.5ml centrifuge tubes, seal each tube with sealing film, and store at -20℃. When using, remove one tube of RVC stock solution from -20℃, dissolve it completely at room temperature, and then dilute it with RVC buffer at a ratio of 1:20 to obtain a 10mM RVC solution. Any unused portion should be sealed with sealing film and stored at 4℃.

[0088] IV. Blocking solution: Mix serum-free protein solution with 20mM RVC solution at a volume ratio of 1:1 to ensure the final concentration of RVC solution is 10mM. Prepare the solution 15-30 minutes in advance and place it on ice for later use.

[0089] V. Antibody buffer: Mix the blocking solution with 10mM RVC solution at a volume ratio of 1:1 to ensure that the final concentration of RVC solution is 10mM. Then dilute according to the dilution requirements of each antibody.

[0090] (2) Transfer the glass slide that has been equilibrated to a humidified chamber, add the prepared 4% PFA fixative, and fix at 4℃ for 10 min.

[0091] (3) Pour the PFA into the waste liquid tube, add glycine solution with a final concentration of 100 mM, and react at 4℃ for 10 min.

[0092] (4) Discard the glycine, add the blocking solution to block, and react at 4°C for 20 min.

[0093] (5) Add primary antibody PLZF to antibody buffer at a ratio of 1:100 and react at 4°C for 3 hours.

[0094] (6) After the primary antibody incubation is completed, wash with 10 mM RVC 6 to 8 times. During the washing process, gently shake the slide by hand. In order to minimize the exposure time of the tissue sections at room temperature, the operation should be as fast as possible during each washing process.

[0095] (7) Add fluorescent secondary antibody to antibody buffer at a ratio of 1:200 and react at 4°C for 1 h.

[0096] (8) After the secondary antibody incubation is completed, wash with 10 mM RVC 6-8 times. During the washing process, gently shake the slide by hand. In order to minimize the exposure time of the tissue sections at room temperature, each washing process should be performed as quickly as possible. Then laser microdissection and sorting can be carried out.

[0097] RNA was extracted and transcriptome libraries were constructed from approximately 150 collected undifferentiated spermatogonia samples according to the method described by Zhang X, Hu C, Huang C, Wei Y, Li X, Hu M, Li H, Wu J, Czajkowsky DM, Guo Y and Shao Z (2022) Robust Acquisition of Spatial Transcriptional Programs in Tissues With Immunofluorescence-Guided Laser Capture Microdissection. Front. Cell Dev. Biol. 10:853188. doi: 10.3389 / fcell.2022.853188. The obtained gene expression data are shown in Table 1.

[0098] Table 1 shows the in situ transcriptome sequencing results of 150 PLZF-positive cells from frozen sections of tissue fixed with 4% PFA in 6-week-old mice: Table 1 After staining and LCM sorting using the aforementioned steps to establish RVC-protected RNA, a sample containing approximately 150 undifferentiated spermatogonia was obtained. Library construction and sequencing were then performed using the Ovation Solo Kit, resulting in low library complexity. The reasons for the low library complexity were analyzed. Considering the use of cross-linking fixatives to fix frozen sections in the aforementioned staining protocol, a new spatial transcriptomics method more suitable for fixed frozen tissue sections was optimized. The specific downstream transcriptomics library construction process is as follows.

[0099] 4. Preparation of cell collection solution: Prepare cell collection solution (containing 40 U / μL RNase inhibitor, 10% Triton X-100, 2 μL barcode) according to the components in Table 2: Table 2 Add 10 µL of cell collection medium to a single nuclease-free PCR tube, where the barcode primer is a primer with a cell tag. After preparation, store in a 4°C refrigerator for later use.

[0100] The sequence of the barcode primer is (SEQ ID NO: 1): 5'- / 5Biosg / ACACTCTTTCCCTACACGACGATCT[BC6]NNNNNNNNNN TTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3'; Wherein, 5Biosg is 5' biotin; V = A or G or C, N = A or G or C or T; [BC6] is a 6bp barcode sequence composed of four deoxynucleotides: ATCG. The barcodes differ from each other by at least two bases. Therefore, a single base sequencing error will not lead to incorrect barcode recognition. In this embodiment, the 6bp bases in the barcode primers used include GTCTCA, GTTGCA, and GTGACA.

[0101] (N)10 is a 10 bp random molecular tag (Unique Molecular Identifier, UMI), each UMI is integrated into a unique cDNA sequence generated from cellular mRNA to distinguish the origin of the amplified molecule.

[0102] 5. Laser micro-cutting and sorting of samples Turn on the dehumidifier beforehand to reduce the humidity in the room to below 45%. Turn on the instrument and calibrate it in advance, adjusting the parameters to ensure normal cutting and ejection, using the lowest possible cutting and ejection energy. Adjust the microscope focus, circle individual target cells based on the positive fluorescence signal after staining, and then perform laser cutting.

[0103] Fix the collection tube with the adhesive cap onto the LCM 8×200 µL collection plate holder, adjust the position of the cap so that it faces the center of the microscope field of view, and collect cells (about 150 cells) by laser ejection. After collection, add 10 µL of cell collection solution to the cap, incubate at room temperature for 10-20 min, centrifuge at 10000g for 10 min, and then immediately transfer to a -80℃ freezer for storage.

[0104] 6. Cell lysis Remove the PCR tube containing the cells from the -80°C freezer, place it on ice (0°C) for about 10 min to thaw, then centrifuge at 10,000 rpm for 10 min at 4°C. Collect the sample to the bottom of the tube (the precipitate at the bottom of the tube is mRNA and cell debris).

[0105] 7. mRNA is reverse transcribed into cDNA The reaction system was prepared using Maxima H Minus Reverse Transcriptase (Thermo Scientific, #EP0753) as shown in Table 3: Table 3 This system uses a specific reverse transcription primer (SEQ ID NO: 2): 5'-iCiGiCACACTCTTTCCCTACACGACGCrGrGrG-3'; where iC is iso-dC (a C base modified with locked nucleic acid); iG iso-dG; and rG is RNA G (i.e., ribonucleotide G).

[0106] Add 9 μL of the premixed reagent to each sample, mix well, centrifuge at 10000g for 30 seconds at 4°C, and then incubate at 42°C for 90 minutes in a PCR instrument.

[0107] 8. cDNA purification (1) Take the magnetic beads from 4°C to room temperature 30 minutes in advance to equilibrate. Too low a temperature will reduce the binding efficiency of the magnetic beads and DNA. Shake the magnetic beads thoroughly to ensure that they are fully mixed.

[0108] (2) Pipette 0.6 times the volume (11.4 μL) of magnetic beads into a PCR tube, mix thoroughly by pipetting multiple times, and incubate at room temperature for 5 min. During this period, prepare 400 μL of 80% ethanol.

[0109] (3) After incubation, place the PCR tube on a magnetic rack and wait for about 5 minutes until the solution becomes completely clear. Then carefully remove the supernatant.

[0110] (4) Add 180 μL of 80% ethanol to rinse the surface of the magnetic beads. After incubating at room temperature for 30 s, remove the supernatant. Repeat this operation once.

[0111] (5) After the second rinse, remove the liquid adhering to the surface of the tube as completely as possible, open the cap to dry the surface of the magnetic beads until the surface of the magnetic beads becomes matte.

[0112] (6) After the surface of the magnetic beads becomes matte, remove the tube from the magnetic rack, add 23 μL of nuclease-free water, mix thoroughly and incubate at room temperature for 5 min.

[0113] (7) After incubation, place the PCR tube on a magnetic rack and let it stand for 5 minutes until the solution is completely clear. Transfer the supernatant to a new PCR tube and continue the next reaction or store it in a -20°C refrigerator.

[0114] 9. cDNA amplification cDNA amplification was performed using the Terra PCR Direct Polymerase Mix (Clontech, #639270) kit, and the reaction system was prepared as shown in Table 4: Table 4 This system uses specific cDNA amplification primers (SEQ ID NO: 3): 5'- / 5Biosg / ACACTCTTTCCCTACACGACGC-3'; where 5Biosg is 5' biotin.

[0115] After thoroughly mixing by pipetting and centrifuging briefly, execute the PCR program shown in Table 5 (the number of cycles needs to be determined based on the amount of sample entering the sample; in this experiment, it is generally 19-21 cycles): Table 5 10. cDNA repurification (1) Take the magnetic beads from 4°C to room temperature 30 minutes in advance to equilibrate. Too low a temperature will reduce the binding efficiency of the magnetic beads and DNA. Shake the magnetic beads thoroughly to ensure that they are fully mixed.

[0116] (2) Pipette 0.6 times the volume (30 μL) of magnetic beads into a PCR tube, mix thoroughly by pipetting multiple times, and incubate at room temperature for 5 min. During this period, prepare 400 μL of 80% ethanol.

[0117] (3) After incubation, place the PCR tube on a magnetic rack and wait for about 5 minutes until the solution becomes completely clear. Then carefully remove the supernatant.

[0118] (4) Add 180 μL of 80% ethanol to rinse the surface of the magnetic beads. After incubating at room temperature for 30 s, remove the supernatant. Repeat this operation once.

[0119] (5) After the second rinse, remove the liquid adhering to the surface of the tube as completely as possible, open the cap to dry the surface of the magnetic beads until the surface of the magnetic beads becomes matte.

[0120] (6) After the surface of the magnetic beads becomes matte, remove the tube from the magnetic rack, add 21 μL of nuclease-free water, mix thoroughly and incubate at room temperature for 5 min.

[0121] (7) After incubation, place the PCR tube on a magnetic rack and let it stand for 5 minutes until the solution is completely clear. Transfer the supernatant to a new PCR tube and continue the next reaction or store it in a -20°C refrigerator.

[0122] 11. Sequencing Library Construction Sequencing libraries were constructed using the TruePrep DNA Library Prep Kit V2 for Illumina.

[0123] (1) DNA fragmentation Prepare the reaction mixture as shown in Table 6 in the PCR tube and mix thoroughly: Table 6 After brief centrifugation, place the sample in a PCR instrument pre-programmed as shown in Table 7: Table 7 Immediately after the reaction is complete, add 5 μL of 5×TS to prevent excessive fragmentation of the library caused by continued reaction. After adding 5×TS, mix thoroughly with a pipette and incubate at room temperature for 5 min.

[0124] (2) Library expansion Place the PCR tubes on ice and prepare the reaction system according to Table 8: Table 8 The sequence of the N5 connector is (SEQ ID NO: 4): 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCG A T C T -3'; where, It represents a phosphorothioate bond.

[0125] After thoroughly mixing by pipetting and centrifuging briefly, place the reaction tube in a PCR instrument and run the reaction program in Table 9: Table 9 The number of PCR amplification cycles needs to be adjusted reasonably according to the sample size and fragment distribution characteristics. In this experiment, the number of cycles required to start library construction with 5 ng DNA is generally n=7~13.

[0126] (3) Length sorting of amplified products The amplification products were sorted by fragment length using Bechman AMPure XP magnetic beads. After the concentration was detected by Qubit, the library quality was detected by Agilent 2100. The fragment distribution of the library should be between 300-800bp.

[0127] 12. High-throughput sequencing Sequencing was performed using the Illumina NovaSeq system.

[0128] Sequencing results: Figure 2 The invention demonstrates the immunofluorescence staining effect of PLZF-positive cells in the testes of 6-week-old mice obtained by spatial transcriptomics technology on frozen sections of tissue fixed with 4% PFA. After fixation with 4% PFA, the nuclear signals labeled with DAPI dye and the signals of undifferentiated spermatogonia labeled with PLZF antibody are clearly visible, proving that this method can obtain good immunofluorescence staining results.

[0129] Figure 3The image shows the Agilent 2100 peak diagram of cDNA from PLZF-positive cells in the testes of 6-week-old mice obtained by the spatial transcriptomics technique of frozen sections of tissue fixed with 4% PFA. The main peak length of the cDNA reaches about 800 bp, indicating that this method can obtain high-quality cDNA fragments.

[0130] Figure 4 The image shows an Agilent 2100 quality control plot of a transcriptome library of PLZF-positive testicular cells from 6-week-old mice obtained using the spatial transcriptome technique of frozen tissue sections fixed with 4% PFA. The main peak of the transcriptome library reaches approximately 400 bp, indicating that this method can obtain a high-quality transcriptome library.

[0131] Table 10 shows the in situ transcriptome sequencing results of 150 PLZF-positive cells from the testes of 6-week-old mice obtained by the spatial transcriptome technique of frozen sections of tissue fixed with 4% PFA: Table 10 The results showed that this method can obtain high-quality transcriptome data from 150 cells micro-sorted by laser microdissection, with an average alignment rate of 85.97% per sample and an average of 10,356 genes detected per sample.

[0132] Figure 5 The invention presents a pairwise scatter plot of spatial transcriptome data from frozen tissue sections fixed with 4% PFA. The Pearson correlation coefficients between all pairs of samples are above 0.92, indicating that the method has good reproducibility.

[0133] Example 2. Spatial transcriptome sequencing method for fixed tissue (testis) sections based on DSP fixative In this embodiment, frozen sections of mouse testicular tissue fixed with 1 mg / ml DSP solution were used as experimental materials. Rapid immunofluorescence staining with PLZF antibody for RVC protection was used to analyze the spatial transcriptome of PLZF-positive cells.

[0134] 1. Collection and freezing of materials by the organization To ensure the quality of tissue RNA, all metal instruments used for dissection were baked at 180°C for 8 hours before use. Nuclease-free PBS, cell culture dishes, and tissue cryovials were pre-chilled on ice before dissection. Six-week-old C57 male mice were euthanized by cervical dislocation, and testicular tissue was harvested and placed in cell culture dishes containing PBS. Excess adipose tissue around the testes was removed as quickly as possible, and the surface water was blotted dry with lint-free paper. The tissue was then placed in cell cryovials, flash-frozen in liquid nitrogen for 30 minutes, and then transferred to a freezer at -80°C.

[0135] 2. Frozen slices Mouse testicular tissue samples were transferred from a -80°C freezer to a cryostat for equilibration. Before freezing, the stage, blades, anti-roll plate, and sample brush of the cryostat were cleaned with 75% ethanol. An immunohistochemical pen was used to pre-mark the slide mounting area. The tissue was fully embedded in OCT embedding medium. For tissues requiring directional sampling from specific locations, the orientation of the tissue was marked before embedding to ensure the ideal section was cut. The frozen section thickness was set to 10µm (based on the volume of cells to be sorted). The tissue sections were mounted on RNAZap-treated PET slides, and the slides were equilibrated in the cryostat for 1-2 minutes.

[0136] 3. Rapid immunofluorescence staining protected by RVC (1) Reagent preparation: I. RVC buffer: Weigh 584 mg NaCl and 610 mg MgCl and dissolve them thoroughly in 1000 ml of nuclease-free water. Seal with sealing film and store at room temperature. Before use, mix 49 ml with 1 ml of 1 M Tris-HCl to make RVC buffer (10 mM NaCl, 3 mM MgCl, 20 mM Tris-HCl, pH 7.4).

[0137] II. 20mM RVC Solution: Remove 200mM RVC stock solution from -20℃ and dissolve it completely in a 65℃ water bath. Aliquot 1ml into 1.5ml centrifuge tubes, seal with sealing film, and store at -20℃. When using, remove one tube of RVC stock solution from -20℃, dissolve it completely at room temperature, and then dilute it with RVC buffer at a ratio of 1:10 to obtain a 20mM RVC solution. Any unused 20mM RVC solution should be diluted to 10mM and stored at 4℃.

[0138] III. 10mM RVC Solution: Remove 200mM RVC stock solution from -80℃ and dissolve it completely in a 65℃ water bath. Aliquot 1ml into 1.5ml centrifuge tubes, seal each tube with sealing film, and store at -20℃. When using, remove one tube of RVC stock solution from -20℃, dissolve it completely at room temperature, and then dilute it with RVC buffer at a ratio of 1:20 to obtain a 10mM RVC solution. Any unused portion should be sealed with sealing film and stored at 4℃.

[0139] IV. Blocking solution: Mix serum-free protein solution with 20mM RVC solution at a volume ratio of 1:1 to ensure the final concentration of RVC solution is 10mM. Prepare the solution 15-30 minutes in advance and place it on ice for later use.

[0140] V. Antibody buffer: Mix the blocking solution with 10mM RVC solution at a volume ratio of 1:1 to ensure that the final concentration of RVC solution is 10mM. Then dilute according to the dilution requirements of each antibody.

[0141] (2) Transfer the glass slide that has been equilibrated to a humidified chamber, add the prepared 1 mg / ml DSP fixative, and fix at 4°C for 20 min.

[0142] (3) Pour the DSP into the waste liquid tube, add glycine solution with a final concentration of 100 mM, and react at 4℃ for 10 min.

[0143] (4) Discard the glycine, add the blocking solution to block, and react at 4°C for 20 min.

[0144] (5) Add primary antibody PLZF to antibody buffer at a ratio of 1:100 and react at 4°C for 3 hours.

[0145] (6) After the primary antibody incubation is completed, wash with 10 mM RVC 6 to 8 times. During the washing process, gently shake the slide by hand. In order to minimize the exposure time of the tissue sections at room temperature, each washing process should be performed as quickly as possible.

[0146] (7) Add fluorescent secondary antibody to antibody buffer at a ratio of 1:200 and react at 4°C for 1 h.

[0147] (8) After the secondary antibody incubation is completed, wash with 10 mM RVC 6-8 times. During the washing process, gently shake the slide by hand. To minimize the exposure time of the tissue sections at room temperature, each washing operation should be performed as quickly as possible. Then, laser microdissection and sorting can be carried out.

[0148] 4. Preparation of cell collection solution: Prepare the cell collection medium according to the components in Table 11 (containing 40 U / ul RNase inhibitor, 10% Triton X-100, and 2 μmol barcode): Table 11 Add 10 µL of cell collection medium to a single nuclease-free PCR tube, where the barcode is a primer with a cell tag. After preparation, store in a 4°C refrigerator for later use.

[0149] 5. Laser micro-cutting and sorting of samples Turn on the dehumidifier beforehand to reduce the humidity in the room to below 45%. Turn on the instrument and calibrate it in advance, adjusting the parameters to ensure normal cutting and ejection, using the lowest possible cutting and ejection energy. Adjust the microscope focus, circle individual target cells based on the positive fluorescence signal after staining, and then perform laser cutting.

[0150] Fix the collection tube with the adhesive cap onto the LCM 8×200 µL collection plate holder, adjust the position of the cap so that it faces the center of the microscope field of view, and collect cells (about 150 cells) by laser ejection. After collection, add 10 µL of cell collection solution to the cap, incubate at room temperature for 10-20 min, centrifuge at 10000g for 10 min, and then immediately transfer to a -80℃ freezer for storage.

[0151] 6. Cell lysis Remove the PCR tube containing the cells from the -80°C freezer, place it on ice (0°C) for about 10 min to thaw, then centrifuge at 10,000 rpm for 10 min at 4°C. Collect the sample to the bottom of the tube (the precipitate at the bottom of the tube is mRNA and cell debris).

[0152] 7. mRNA is reverse transcribed into cDNA The reaction system in Table 12 was prepared using Maxima H Minus Reverse Transcriptase (Thermo Scientific, #EP0753).

[0153] Table 12 Add 9 μL of the premixed reagent to each sample, mix well, centrifuge at 10000g for 30 s at 4°C, and then incubate at 42°C for 90 min in a PCR instrument.

[0154] 8. cDNA purification (1) Take the magnetic beads from 4°C to room temperature 30 minutes in advance to equilibrate. Too low a temperature will reduce the binding efficiency of the magnetic beads and DNA. Shake the magnetic beads thoroughly to ensure that they are fully mixed.

[0155] (2) Pipette 0.6 times the volume (11.4 μL) of magnetic beads into a PCR tube, mix thoroughly by pipetting multiple times, and incubate at room temperature for 5 min. During this period, prepare 400 μL of 80% ethanol.

[0156] (3) After incubation, place the PCR tube on a magnetic rack and wait for about 5 minutes until the solution becomes completely clear. Then carefully remove the supernatant.

[0157] (4) Add 180 μL of 80% ethanol to rinse the surface of the magnetic beads. After incubating at room temperature for 30 s, remove the supernatant. Repeat this operation once.

[0158] (5) After the second rinse, remove the liquid adhering to the surface of the tube as completely as possible, open the cap to dry the surface of the magnetic beads until the surface of the magnetic beads becomes matte.

[0159] (6) After the surface of the magnetic beads becomes matte, remove the tube from the magnetic rack, add 23 μL of nuclease-free water, mix thoroughly and incubate at room temperature for 5 min.

[0160] (7) After incubation, place the PCR tube on a magnetic rack and let it stand for 5 minutes until the solution is completely clear. Transfer the supernatant to a new PCR tube and continue the next reaction or store it in a -20°C refrigerator.

[0161] 9. cDNA amplification cDNA amplification was performed using the Terra PCR Direct Polymerase Mix (Clontech, #639270) kit, and the reaction mixture was prepared as shown in Table 13. Table 13 After thoroughly mixing by pipetting and centrifuging briefly, execute the PCR program in Table 14 (the number of cycles needs to be determined based on the amount of sample entering the sample; in this experiment, it is generally 19-20 cycles): Table 14 10. cDNA repurification (1) Take the magnetic beads from 4°C to room temperature 30 minutes in advance to equilibrate. Too low a temperature will reduce the binding efficiency of the magnetic beads and DNA. Shake the magnetic beads thoroughly to ensure that they are fully mixed.

[0162] (2) Pipette 0.6 times the volume (30 μL) of magnetic beads into a PCR tube, mix thoroughly by pipetting multiple times, and incubate at room temperature for 5 min. During this period, prepare 400 μL of 80% ethanol.

[0163] (3) After incubation, place the PCR tube on a magnetic rack and wait for about 5 minutes until the solution becomes completely clear. Then carefully remove the supernatant.

[0164] (4) Add 180 μL of 80% ethanol to rinse the surface of the magnetic beads. After incubating at room temperature for 30 s, remove the supernatant. Repeat this operation once.

[0165] (5) After the second rinse, remove the liquid adhering to the surface of the tube as completely as possible, open the cap to dry the surface of the magnetic beads until the surface of the magnetic beads becomes matte.

[0166] (6) After the surface of the magnetic beads becomes matte, remove the tube from the magnetic rack, add 21 μL of nuclease-free water, mix thoroughly and incubate at room temperature for 5 min.

[0167] (7) After incubation, place the PCR tube on a magnetic rack and let it stand for 5 minutes until the solution is completely clear. Transfer the supernatant to a new PCR tube and continue the next reaction or store it in a -20°C refrigerator.

[0168] 11. Sequencing Library Construction Sequencing libraries were constructed using the TruePrep DNA Library Prep Kit V2 for Illumina.

[0169] (1) DNA fragmentation Prepare the reaction mixture in Table 15 in the PCR tube and mix thoroughly: Table 15 After brief centrifugation, place the sample in a PCR instrument pre-programmed as shown in Table 16: Table 16 Immediately after the reaction is complete, add 5 μL of 5×TS to prevent excessive fragmentation of the library caused by continued reaction. After adding 5×TS, mix thoroughly with a pipette and incubate at room temperature for 5 min.

[0170] (2) Library amplification Place the PCR tubes on ice and prepare the reaction system according to Table 17: Table 17 After thoroughly mixing by pipetting and centrifuging briefly, place the reaction tube in a PCR instrument and run the reaction program in Table 18: Table 18 The number of PCR amplification cycles needs to be adjusted reasonably according to the sample size and fragment distribution characteristics. In this experiment, the number of cycles required to start library construction with 5 ng DNA is generally n=7~13.

[0171] (3) Length sorting of amplified products The amplification products were sorted by fragment length using Bechman AMPure XP magnetic beads. After the concentration was detected by Qubit, the library quality was detected by Agilent 2100. The fragment distribution of the library should be between 300-800bp.

[0172] 12. High-throughput sequencing Sequencing was performed using the Illumina NovaSeq system.

[0173] Sequencing results: Figure 6 The invention demonstrates the immunofluorescence staining effect of PLZF-positive cells in the testes of 6-week-old mice obtained by spatial transcriptomics technology on frozen sections of tissue fixed with 1 mg / ml DSP. After fixation with 1 mg / ml DSP solution, the nuclear signals labeled with DAPI dye and the signals of undifferentiated spermatogonia labeled with PLZF antibody are clearly visible, proving that this method can obtain good immunofluorescence staining results.

[0174] Figure 7 The image shows the Agilent 2100 peak diagram of cDNA from PLZF-positive cells in the testes of 6-week-old mice obtained by spatial transcriptomics technology using frozen sections of tissue fixed with 1 mg / ml DSP. The main peak length of the cDNA reached approximately 1000 bp, indicating that this method can obtain high-quality cDNA fragments.

[0175] Figure 8 The Qseq quality control plot of a transcriptome library of PLZF-positive cells from the testes of 6-week-old mice obtained by spatial transcriptomics technology using frozen sections of tissue fixed with 1 mg / ml DSP is shown. The main peak of the transcriptome library reached approximately 696 bp, indicating that this method can obtain a high-quality transcriptome library.

[0176] Table 19 shows the in situ transcriptome sequencing results of 150 PLZF-positive cells from the testes of 6-week-old mice obtained by the spatial transcriptome technique of frozen sections of tissue fixed with 1 mg / ml DSP. Table 19 The results showed that after changing the DSP fixative, this method could obtain high-quality transcriptome data from 150 cells micro-sorted by laser microdissection, with the average alignment rate per sample further improved to 91.17% and the average number of genes detected per sample increased to 17,615.

[0177] Figure 9The spatial transcriptomics technique of the 1 mg / ml DSP-fixed frozen tissue sections of the invention was used to obtain the correlation of three sets of repeated experiments. The Pearson correlation coefficients between each pair of samples were all above 0.95, indicating that the method has good reproducibility.

[0178] Figure 10 The study compared the quality of spatial transcriptome data based on PFA or DSP fixation, showing that the alignment rate, UMI number, and gene number of the obtained transcriptome data were significantly improved after applying 1 mg / ml DSP solution as a fixative.

[0179] Example 3. Spatial transcriptome sequencing method for fixed tissue (liver) sections based on DSP fixative In this embodiment, frozen sections of mouse liver tissue fixed with 4% PFA solution and 1 mg / ml DSP solution were used as experimental materials. Rapid immunofluorescence staining with Ecad antibody for RVC protection was used to analyze the spatial transcriptome of Ecad-positive cells.

[0180] 1. Collection and freezing of materials by the organization To ensure the quality of tissue RNA, all metal instruments used for dissection were baked at 180°C for 8 hours before use. Nuclease-free PBS, cell culture dishes, and tissue cryovials were pre-chilled on ice before dissection. Six-week-old C57 male mice were euthanized by cervical dislocation, and liver tissue was harvested and placed in cell culture dishes containing PBS. The surface water was blotted dry with lint-free paper, and the tissue was placed in cell cryovials. The cells were then flash-frozen in liquid nitrogen for 30 minutes and then transferred to a -80°C freezer.

[0181] 2. Frozen slices Mouse liver tissue samples were transferred from a -80°C freezer to a cryostat for equilibration. Before freezing, the stage, blades, anti-roll plate, and sample brush of the cryostat were cleaned with 75% ethanol. An immunohistochemical pen was used to pre-mark the slide mounting area. The tissue was fully embedded in OCT embedding medium. For tissues requiring directional sampling from specific locations, the orientation of the tissue was marked before embedding to ensure the ideal section was cut. The frozen section thickness was set to 10µm (based on the volume of cells to be sorted). The tissue sections were mounted on RNAZap-treated PET slides, and the slides were equilibrated in the cryostat for 1-2 minutes.

[0182] 3. Rapid immunofluorescence staining protected by RVC (1) Reagent preparation: I. RVC buffer: Weigh 584 mg NaCl and 610 mg MgCl and dissolve them thoroughly in 1000 ml of nuclease-free water. Seal with sealing film and store at room temperature. Before use, mix 49 ml with 1 ml of 1 M Tris-HCl to make RVC buffer (10 mM NaCl, 3 mM MgCl, 20 mM Tris-HCl, pH 7.4).

[0183] II. 20mM RVC Solution: Remove 200mM RVC stock solution from -20℃ and dissolve it completely in a 65℃ water bath. Aliquot 1ml into 1.5ml centrifuge tubes, seal with sealing film, and store at -20℃. When using, remove one tube of RVC stock solution from -20℃, dissolve it completely at room temperature, and then dilute it with RVC buffer at a ratio of 1:10 to obtain a 20mM RVC solution. Any unused 20mM RVC solution should be diluted to 10mM and stored at 4℃.

[0184] III. 10mM RVC Solution: Remove 200mM RVC stock solution from -80℃ and dissolve it completely in a 65℃ water bath. Aliquot 1ml into 1.5ml centrifuge tubes, seal each tube with sealing film, and store at -20℃. When using, remove one tube of RVC stock solution from -20℃, dissolve it completely at room temperature, and then dilute it with RVC buffer at a ratio of 1:20 to obtain a 10mM RVC solution. Any unused portion should be sealed with sealing film and stored at 4℃.

[0185] IV. Blocking solution: Mix serum-free protein solution with 20mM RVC solution at a volume ratio of 1:1 to ensure the final concentration of RVC solution is 10mM. Prepare the solution 15-30 minutes in advance and place it on ice for later use.

[0186] V. Antibody buffer: Mix the blocking solution with 10mM RVC solution at a volume ratio of 1:1 to ensure that the final concentration of RVC solution is 10mM. Then dilute according to the dilution requirements of each antibody.

[0187] (2) Transfer the glass slide that has been equilibrated to a humidified chamber, add the prepared 4% PFA fixative, fix at 4℃ for 10 min or 1 mg / ml DSP fixative, fix at 4℃ for 20 min.

[0188] (3) Pour the fixative into the waste liquid tube, add glycine solution with a final concentration of 100 mM, and react at 4℃ for 10 min.

[0189] (4) Discard the glycine, add the blocking solution to block, and react at 4°C for 20 min.

[0190] (5) Add primary antibody Ecad to antibody buffer at a ratio of 1:100 and react at 4°C for 3 hours.

[0191] (6) After the primary antibody incubation is completed, wash with 10 mM RVC 6 to 8 times. During the washing process, gently shake the slide by hand. In order to minimize the exposure time of the tissue sections at room temperature, each washing process should be performed as quickly as possible.

[0192] (7) Add fluorescent secondary antibody to antibody buffer at a ratio of 1:200 and react at 4°C for 1 h.

[0193] (8) After the secondary antibody incubation is completed, wash with 10 mM RVC 6-8 times. During the washing process, gently shake the slide by hand. To minimize the exposure time of the tissue sections at room temperature, each washing operation should be performed as quickly as possible. Then, laser microdissection and sorting can be carried out.

[0194] 4. Preparation of cell collection solution: Prepare the cell collection medium according to the components in Table 20 (containing 40 U / μL RNase inhibitor, 10% Triton X-100, and 2 μL barcode): Table 20 Add 10 µL of cell collection medium to a single nuclease-free PCR tube, where the barcode is a primer with a cell tag. After preparation, store in a 4°C refrigerator for later use.

[0195] 5. Laser micro-cutting and sorting of samples Turn on the dehumidifier beforehand to reduce the humidity in the room to below 45%. Turn on the instrument and calibrate it in advance, adjusting the parameters to ensure normal cutting and ejection, using the lowest possible cutting and ejection energy. Adjust the microscope focus, circle individual target cells based on the positive fluorescence signal after staining, and then perform laser cutting.

[0196] Fix the collection tube with the adhesive cap onto the LCM 8×200 µL collection plate holder, adjust the position of the cap so that it faces the center of the microscope field of view, and collect cells (about 100 cells) by laser ejection. After collection, add 10 µL of cell collection solution to the cap, incubate at room temperature for 10-20 min, centrifuge at 10000g for 10 min, and then immediately transfer to a -80℃ freezer for storage.

[0197] 6. Cell lysis Remove the PCR tube containing the cells from the -80°C freezer, place it on ice (0°C) for about 10 min to thaw, then centrifuge at 10,000 rpm for 10 min at 4°C. Collect the sample to the bottom of the tube (the precipitate at the bottom of the tube is mRNA and cell debris).

[0198] 7. mRNA is reverse transcribed into cDNA The reaction system in Table 21 was prepared using Maxima H Minus Reverse Transcriptase (Thermo Scientific, #EP0753). Table 21 Add 9 μL of the premixed reagent to each sample, mix well, centrifuge at 10000g for 30 s at 4°C, and then incubate at 42°C for 90 min in a PCR instrument.

[0199] 8. cDNA purification (1) Take the magnetic beads from 4°C to room temperature 30 minutes in advance to equilibrate. Too low a temperature will reduce the binding efficiency of the magnetic beads and DNA. Shake the magnetic beads thoroughly to ensure that they are fully mixed.

[0200] (2) Pipette 0.6 times the volume (11.4 μL) of magnetic beads into a PCR tube, mix thoroughly by pipetting multiple times, and incubate at room temperature for 5 min. During this period, prepare 400 μL of 80% ethanol.

[0201] (3) After incubation, place the PCR tube on a magnetic rack and wait for about 5 minutes until the solution becomes completely clear. Then carefully remove the supernatant.

[0202] (4) Add 180 μL of 80% ethanol to rinse the surface of the magnetic beads. After incubating at room temperature for 30 s, remove the supernatant. Repeat this operation once.

[0203] (5) After the second rinse, remove the liquid adhering to the surface of the tube as completely as possible, open the cap to dry the surface of the magnetic beads until the surface of the magnetic beads becomes matte.

[0204] (6) After the surface of the magnetic beads becomes matte, remove the tube from the magnetic rack, add 23 μL of nuclease-free water, mix thoroughly and incubate at room temperature for 5 min.

[0205] (7) After incubation, place the PCR tube on a magnetic rack and let it stand for 5 minutes until the solution is completely clear. Transfer the supernatant to a new PCR tube and continue the next reaction or store it in a -20°C refrigerator.

[0206] 9. cDNA amplification cDNA amplification was performed using the Terra PCR Direct Polymerase Mix (Clontech, #639270) kit, and the reaction mixture was prepared as shown in Table 22: Table 22 After thoroughly mixing by pipetting and centrifuging briefly, execute the PCR program in Table 23 (the number of cycles needs to be determined based on the amount of sample entering the sample; in this experiment, it is generally 19-20 cycles): Table 23 10. cDNA repurification (1) Take the magnetic beads from 4°C to room temperature 30 minutes in advance to equilibrate. Too low a temperature will reduce the binding efficiency of the magnetic beads and DNA. Shake the magnetic beads thoroughly to ensure that they are fully mixed.

[0207] (2) Pipette 0.6 times the volume (30 μL) of magnetic beads into a PCR tube, mix thoroughly by pipetting multiple times, and incubate at room temperature for 5 min. During this period, prepare 400 μL of 80% ethanol.

[0208] (3) After incubation, place the PCR tube on a magnetic rack and wait for about 5 minutes until the solution becomes completely clear. Then carefully remove the supernatant.

[0209] (4) Add 180 μL of 80% ethanol to rinse the surface of the magnetic beads. After incubating at room temperature for 30 s, remove the supernatant. Repeat this operation once.

[0210] (5) After the second rinse, remove the liquid adhering to the surface of the tube as completely as possible, open the cap to dry the surface of the magnetic beads until the surface of the magnetic beads becomes matte.

[0211] (6) After the surface of the magnetic beads becomes matte, remove the tube from the magnetic rack, add 21 μL of nuclease-free water, mix thoroughly and incubate at room temperature for 5 min.

[0212] (7) After incubation, place the PCR tube on a magnetic rack and let it stand for 5 minutes until the solution is completely clear. Transfer the supernatant to a new PCR tube and continue the next reaction or store it in a -20°C refrigerator.

[0213] 11. Sequencing Library Construction Sequencing libraries were constructed using the TruePrep DNA Library Prep Kit V2 for Illumina.

[0214] (1) DNA fragmentation Prepare the reaction mixture in Table 24 in the PCR tube and mix thoroughly: Table 24 After brief centrifugation, place the sample in a PCR instrument pre-programmed as shown in Table 25: Table 25 Immediately after the reaction is complete, add 5 μL of 5×TS to prevent excessive fragmentation of the library caused by continued reaction. After adding 5×TS, mix thoroughly with a pipette and incubate at room temperature for 5 min.

[0215] (2) Library amplification Place the PCR tubes on ice and prepare the reaction system according to Table 26: Table 26 After thoroughly mixing by pipetting and centrifuging briefly, place the reaction tube in a PCR instrument and run the reaction program in Table 27: Table 27 The number of PCR amplification cycles needs to be adjusted reasonably according to the sample size and fragment distribution characteristics. In this experiment, the number of cycles required to start library construction with 5 ng DNA is generally n=7~13.

[0216] (3) Length sorting of amplified products The amplification products were sorted by fragment length using Bechman AMPure XP magnetic beads. After the concentration was detected by Qubit, the library quality was detected by Agilent 2100. The fragment distribution of the library should be between 300-800bp.

[0217] 12. High-throughput sequencing Sequencing was performed using the Illumina NovaSeq system.

[0218] result: Table 28 shows the in situ transcriptome sequencing results of 100 Ecad-positive cells from the liver tissue of 6-week-old mice obtained using the spatial transcriptome technique of frozen sections fixed with 4% PFA and 1 mg / ml DSP. Table 28 The results showed that this method is also suitable for constructing transcriptome libraries from trace amounts of cells in other tissue samples. In particular, the use of 1 mg / ml DSP solution as a fixative resulted in higher quality transcriptome data from liver parenchymal cells. The alignment rate, UMI number, and gene number of the obtained transcriptome data were significantly improved compared with PFA fixation.

[0219] discuss: Compared with existing transcriptomics technologies, the fixed and quick-frozen tissue spatial transcriptomics technology of the present invention has the following main advantages: 1. Achieve spatial transcriptome analysis of specific cell types at single-cell resolution. Laser microdissection technology can sort frozen tissue samples at single-cell resolution. When combined with antibody labeling, this technology can analyze the spatial transcriptome of specific cell types based on accurate spatial localization. Compared with traditional transcriptomics, this provides richer biological information and allows for targeted study of gene expression in specific cell types of interest.

[0220] 2. Obtaining high-quality cDNA from cross-linked and fixed tissue samples The combination of laser microdissection and antibody labeling for accurate cell type identification inevitably involves a lengthy immunofluorescence staining process, which can lead to significant RNA degradation and hinder downstream transcriptome library construction. Furthermore, effective immunofluorescence staining relies on cross-linking fixation of tissue sections; different fixative types, fixation times, and decross-linking conditions all affect sample quality. The spatial transcriptome method of this invention completes the entire immunofluorescence staining process under RVC protection and optimizes decross-linking conditions. It can obtain high-quality cDNA fragments from quick-frozen tissue sections treated with different fixatives and fixation times, meeting the requirements for subsequent transcriptome library construction.

[0221] 3. Construction of a spatial transcriptome library using a small number of cells. In practical applications, many precious clinical samples or rare cell types that constitute a small proportion of the sample have limited cell quantities, making it difficult to construct libraries using traditional transcriptomics techniques. The method of this invention uses as few as 150 cells (approximately 0.12 pg of total mRNA) as the upstream sample input, making it suitable for a wider range of biological samples.

[0222] 4. Good repeatability Using the novel spatial transcriptomics technique of this invention, approximately 150 undifferentiated spermatogonia were isolated from tissue sections fixed with 1 mg / ml DSP and stained with PLZF antibody via laser microdissection. Library construction and sequencing were performed on samples from three biological replicates. The results showed that the Pearson correlation coefficients between each pair of the three samples were greater than 0.95. Figure 9 The results indicate that the data have good repeatability and the method is stable and reliable.

[0223] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A spatial transcriptomics sequencing method for quick-frozen tissues, characterized in that, The method includes: (1) Tissue fixation: A tissue sample to be tested is provided and a tissue section is obtained. The tissue section is fixed using a cross-linking fixative DSP or PFA. (2) Antibody immunofluorescence staining: Antibody immunofluorescence staining was performed on the fixed tissue sections, and ribonucleoside vanadyl complex (RVC) solution was used to treat the tissue sections throughout the entire antibody immunofluorescence staining process. The RVC solution is an RNase inhibitor. (3) Target cell sorting: Laser microdissection is performed on the stained tissue sections, target cells are sorted based on fluorescence signals, and the target cells are placed in cell collection solution; (4) mRNA reverse transcription: The target cells are lysed to obtain a lysate solution. The mRNA is reverse transcribed into cDNA directly in the lysate solution using reaction system A, wherein the reaction system A contains the reverse transcription primers shown in SEQ ID NO.

2. (5) cDNA amplification and purification: The cDNA is purified and amplified using reaction system B, wherein the reaction system B contains cDNA amplification primers as shown in SEQ ID NO.

3. (6) Library construction: The amplified cDNA was used to construct a library; (7) Sequencing.

2. The sequencing method as described in claim 2, characterized in that, The thickness of the tissue sections is 7-12 μm.

3. The sequencing method as described in claim 3, characterized in that, The concentration of the DSP fixative is 0.5-2 mg / ml, preferably 1 mg / ml.

4. The sequencing method as described in claim 1, characterized in that, The concentration of the PFA fixative is 2-6%, preferably 4%.

5. The sequencing method as described in claim 5, characterized in that, In step (2), before adding the primary antibody solution and the secondary antibody solution, the sample prepared by the slide is cleaned with RVC solution.

6. The sequencing method as described in claim 1, characterized in that, In step (4), RNA is not extracted for reverse transcription after the target cells are lysed, but the reverse transcription reaction is carried out directly in the cell lysis solution.

7. The sequencing method as described in claim 1, characterized in that, In step (4), the reaction system A also includes dithiothreitol (DTT), which decrosslinks by reducing disulfide bonds, thereby achieving simultaneous decrosslinking and reverse transcription.

8. A spatial transcriptomics sequencing system for quick-frozen tissues, characterized in that, The system includes: (1) Tissue sectioning and fixation module, wherein the module is configured to perform the following operations: sectioning the sample to be tested to obtain tissue sections, and fixing the tissue sections with a fixative; (2) Immunofluorescence staining module, the module being configured to perform the following operations: performing immunofluorescence staining on tissue sections using specific antibodies, and using RVC solution as an RNase inhibitor to inhibit RNA degradation throughout the immunofluorescence staining process; (3) A cell sorting module based on laser microscopy, wherein the module is configured to perform the following operations: laser microscopy to cut tissue sections based on fluorescence signals to obtain target cells; (4) mRNA reverse transcription and cDNA amplification module, wherein the module is configured to perform the following operations: directly reverse transcription in target cell lysate to obtain reverse transcription product cDNA, and amplify cDNA; wherein the reverse transcription system contains the reverse transcription primers described in SEQ ID NO.2; and the cDNA amplification system contains the cDNA amplification primers described in SEQ ID NO.

3. (6) Library construction and sequencing module, wherein the module is configured to perform the following operations: construct a library from the amplified cDNA and sequence it. (7) Data output module, which is configured to perform the following operations: analyze the sequencing data and output the results.

9. A reverse transcription primer, characterized in that, The sequence of the primer is shown in SEQ ID NO.2: 5'-iCiGiCACACTCTTTCCCTACACGACGCrGrGrG-3'; Where iC stands for iso-dC (a C base modified with locked nucleic acid); iG stands for iso-dG; and rG stands for RNA G (i.e., ribonucleotide G).

10. A cDNA amplification primer, characterized in that, The primer sequence is shown in SEQ ID NO.3: 5'- / 5Biosg / ACACTCTTTCCCTACACGACGC-3'; where 5Biosg is 5' biotin.

Images